UNIVERSIDAD NACIONAL AUTÓNOMA DE MÉXICO POSGRADO  EN  CIENCIAS  BIOLÓGICAS   INSTITUTO  DE  BIOLOGÍA   SISTEMÁTICA     DELIMITACIÓN DE ESPECIES Y DIVERSIDAD GENÉTICA DEL GÉNERO NEOECHINORHYNCHUS STILES Y HASSALL 1905 DE MÉXICO Y CENTROAMÉRICA   TESIS   QUE  PARA  OPTAR  POR  EL  GRADO  DE:   DOCTOR EN CIENCIAS     PRESENTA:   CARLOS  DANIEL  PINACHO  PINACHO     TUTOR  PRINCIPAL  :  DR.  JOSÉ  MARTÍN  GARCÍA  VARELA.  INSTITUTO  DE  BIOLOGÍA         COMITÉ  TUTOR:  DR.  GERARDO  PÉREZ  PONCE  DE  LEÓN.  INSTITUTO  DE  BIOLOGÍA                                                                            DR.  JOSÉ  JAIME  ZÚNIGA  VEGA.  FACULTAD  DE  CIENCIAS     MÉXICO, D.F. JUNIO, 2016. UNAM – Dirección General de Bibliotecas Tesis Digitales Restricciones de uso DERECHOS RESERVADOS © PROHIBIDA SU REPRODUCCIÓN TOTAL O PARCIAL Todo el material contenido en esta tesis esta protegido por la Ley Federal del Derecho de Autor (LFDA) de los Estados Unidos Mexicanos (México). El uso de imágenes, fragmentos de videos, y demás material que sea objeto de protección de los derechos de autor, será exclusivamente para fines educativos e informativos y deberá citar la fuente donde la obtuvo mencionando el autor o autores. Cualquier uso distinto como el lucro, reproducción, edición o modificación, será perseguido y sancionado por el respectivo titular de los Derechos de Autor. UNIVERSIDAD NACIONAL AUTÓNOMA DE MÉXICO POSGRADO  EN  CIENCIAS  BIOLÓGICAS   INSTITUTO  DE  BIOLOGÍA   SISTEMÁTICA     DELIMITACIÓN DE ESPECIES Y DIVERSIDAD GENÉTICA DEL GÉNERO NEOECHINORHYNCHUS STILES Y HASSALL 1905 DE MÉXICO Y CENTROAMÉRICA   TESIS   QUE  PARA  OPTAR  POR  EL  GRADO  DE:   DOCTOR EN CIENCIAS     PRESENTA:   CARLOS  DANIEL  PINACHO  PINACHO     TUTOR  PRINCIPAL  :  DR.  JOSÉ  MARTÍN  GARCÍA  VARELA.  INSTITUTO  DE  BIOLOGÍA         COMITÉ  TUTOR:  DR.  GERARDO  PÉREZ  PONCE  DE  LEÓN.  INSTITUTO  DE  BIOLOGÍA                                                                            DR.  JOSÉ  JAIME  ZÚNIGA  VEGA.  FACULTAD  DE  CIENCIAS     MÉXICO, D.F. JUNIO, 2016. NS M E COORDINACIÓN Ciencias Biológicas Dr. Isidro Ávila Martínez Director General de Administración Escolar, UNAM Presente Me permito informar a usted que en la reunión del Subcomité por Campo de Conocimiento de Biología Evolutiva y Sistemática del Posgrado en Ciencias Biológicas, celebrada el día 7 de marzo de 2016, se aprobó el siguiente jurado para el examen de grado de DOCTOR EN CIENCIAS del alumno PINACHO PINACHO CARLOS DANIEL con número de cuenta 510020792 con la tesis titulada: “Delimitación de especies y diversidad genética del género Neoechinorhynchus Stiles y Hassall 1905 de México y Centroamérica”, realizada bajo la dirección del DR. JOSÉ MARTÍN GARCÍA VARELA: Presidente: DR. DANIEL IGNACIO PIÑERO DALMAU Vocal: DR. DAVID SEBASTIAN GERNANDT Secretario: DR. ROGELIO AGUILAR AGUILAR Suplente: DRA. BLANCA ESTELA HERNANDEZ BAÑOS Suplente DRA. CLAUDIA PATRICIA ORNELAS GARCÍA Sin otro particular, me es grato enviarle un cordial saludo. ATENTAMENTE ENC AER “POR MI RAZA HABLARA EL ESPIRITU” AREA Cd. Universitaria, Cd. Mx, a 14 de junio de 2016. Z DRA. MARÍA DEL CORO ARIZMENDI ARRIAGA COORDINACIÓN COORDINADORA DEL PROGRAMA c.c.p. Expediente del (la) interesado (a) Unidad de Posgrado + Coordinación del Posgrado en Ciencias Biológicas Edificio D, ler. Piso, Circuito de Posgrados Cd. Universitaria Delegación Coyoacán C.P. 04510 México, D.F. Tel. 5623 7002 http://pcbiol.posgrado.unam.mx U N¡{M ~ POSGR DO~1 ; ~A1 · . B' l " ~ l Clas 10 oglcas r, i ro vila artinez ir ctor eneral e dministración scolar, AM r sente RDINACIÓN e r ito n ar t d e ni n el ubcomité or a po e onocimiento e i l gía volutiva i t ática el sgrado i ncias i l gicas , l r da l i e arzo e 16, r bó l i i nte o ra l en e r do e TOR I CIAS el l no O O LOS NIEL n ero e enta 020792 n is tu a : " eli it ción ecies i r i d nética el nero eoechinorhynchus til s a satl 05 éxico entr américa", l a jo i ci n el O o SÉ ARTíN ARCíA RELA: Presidente: Vocal: Secretario: Suplente: uplente R. NIEL G CI O AU R. VID ASTIAN NANOT OR. GELlO UIL R UIL R ORA. CA TELA ANOEZ OS ORA. UDIA TRICIA NELAS ARCiA i tr articular, e s r to viarle n rdia l l do. TAMENTE " R I ZA BLARA L PIRITU" d. niversitaria, d . x, e io e 16. ~ ; &J &w al J!J)' ORA, ARíA EL RO I X RI GA RDI ADORA EL RAMA . .p. xpediente el ) n e do ) RDINACiÓN nidad e osgrado . oordinación el sgrado iencias i l gicas dificio , r. iso, ircuito e sgrados d. niversitaria elegación oyoacán .P. 510 éxico, n. . el. 23 02 p:/ pcbio1.posgrado.unarn.lYlX Agradecimientos Al Posgrado en Ciencias Biológicas de la Universidad Nacional Autónoma de México, por todo el apoyo logístico brindado durante los 4 años Al Consejo Nacional de Ciencia y Tecnología (CONACYT) por la beca otorgada durante mis estudios de Doctorado Al Dr. Martín García Varela por su interés en cada momento de que las cosas marcharan de la mejor manera, por el apoyo económico, académico y moral. (Gracias tutor)… Al comité Tutoral, Dr. Gerardo Pérez Ponce de León y Dr. Jaime Zúñiga por sus comentarios y sugerencias para mejorar el proyecto en cada tutoral Dedicatoria Este logro académico está dedicado al motor de mi vida: Karla Pinacho Pérez y a mis padres: Sebastián Pinacho Ríos y Carmela Pinacho Ramírez Índice Página RESUMEN………………………………………………………………………… 1 ABSTRACT………………………………………………………………………... 5 1. INTRODUCCIÓN……………………………………………………………… 8 1.1. Métodos para la delimitación de especies………………………………….. 9 1.1.1. Los primeros métodos para la delimitación de especies………………….. 10 1.1.2. Nuevos métodos, nuevos datos y enfoques para la delimitación de especies……………………………………………………………………………... 12 1.1.3. Métodos de delimitación de especies utilizados en parásitos…………….. 15 1.2. Teoría de especiación………………………………………………………. 18 1.2.1. Modos de especiación…………………………………………………….. 19 1.2.2. Mecanismos de especiación………………………………………………. 22 1.3. Marcadores moleculares……………………………………………………. 23 1.4. Especies del género Neoechinorhynchus como sistema de estudio………… 26 1.4.1. Ciclo de vida de Neoechinorhynchus…………………………………….. 29 Literatura citada…………………………………………………………………. 31 2. OBJETIVOS……………………………………………………………………. 48 2.1. Objetivo general…………………………………………………………….. 49 2.1.1. Objetivos particulares…………………………………………………….. 49 3. ARTÍCULOS DE INVESTIGACIÓN………………………………………… 50 3.1. Pinacho-Pinacho C. D., Pérez-Ponce de León G. y García-Varela M. (2012). Description of a new species of Neoechinorhynchus (Acanthocephala: Neoechinorhynchidae) a parasite of Dormitator latifrons from Southwestern Mexico based on morphological and molecular characters. Parasitology International, 61: 634–644………………………………………………………….. 51 3.2. Pinacho-Pinacho C. D., Sereno-Uribe A. L. y García-Varela M. (2014). Morphological and molecular data reveal a new species of Neoechinorhynchus (Acanthocephala: Neoechinorhynchidae) from Dormitator maculatus in the Gulf of Mexico. Parasitology International, 63: 763–771……………………………….. 63 3.3. Pinacho-Pinacho C. D., Sereno-Uribe A. L., Pérez-Ponce de León G. y García-Varela M. (2015). Checklist of the species of Neoechinorhynchus (Acanthocephala: Neoechinorhynchidae) in fishes and turtles in Middle-America, and their delimitation based on sequences of the 28S rDNA. Zootaxa, 3985: 098– 116………………………………………………………………………………….. 73 4. DISCUSIÓN GENERAL………………………………………………………. 93 5. CONCLUSIONES GENERALES……………………………………………... 102 6. APÉNDICES……………………………………………………………………. 105 6.1. Un enfoque coalescente en la delimitación de especies en endoparásitos con complejos ciclos de vida: Un ejemplo en un grupo hiper-diverso (Acanthocephala, Neoechinorhynchidae, Neoechinorhynchus) en Centroamérica. En preparación……………………………………………………………………… 106 6.2. First Record of the Intermediate Host of Pseudocorynosoma constrictum Van Cleave, 1918 (Acanthocephala: Polymorphidae) in Central Mexico…………. 140 6.3. Using mitochondrial and ribosomal DNA sequences to test the taxonomic validity of Clinostomum complanatum Rudolphi, 1814 in fish-eating birds and freshwater fishes in Mexico, with the description of a new species………………... 142 6.4. Diversity of sea lice (Copepoda: Caligidae) parasitic on marine fishes with commercial and aquaculture importance in Chamela Bay, Pacific coast of Mexico by using morphology and DNA barcoding, with description of a new species of Caligus……………………………………………………………………………… 144 6.5. Richness and similarity of helminth communities of the freshwater fish Profundulus punctatus (Pisces: Cyprinodontidae) from Oaxaca, Mexico…………. 146 6.6. Morphological and molecular analyses of larval and adult stages of Echinoparyphium recurvatum von Linstow 1873 (Digenea: Echinostomatidae) from central Mexico………………………………………………………………... 148 6.7. Phyllodistomum spinopapillatum sp. nov. (Digenea: Gorgoderidae), from the Oaxaca killifish Profundulus balsanus (Osteichthyes: Profundulidae) in Mexico, with new host and locality records of P. inecoli: Morphology, ultrastructure and molecular evidence……………………………………………… 150 6.8. Haliotrematoides spp. (Monogenoidea: Dactylogyridae) parasitizing Lutjanus guttatus (Lutjanidae) in two localities of the Pacific coast of Mexico, and their phylogenetic position within the Ancyrocephalinae through sequences of the 28S rRNA…………………………………………………………………………... 152 6.9. Molecular and morphological characterization of Austrodiplostomum ostrowskiae Dronen, 2009 (Digenea: Diplostomatidae), a parasite of cormorants in the Americas………………………………………………………………………... 154 6.10. Checklist of the helminth parasites of the genus Profundulus Hubbs, 1924 (Cyprinodontiformes, Profundulidae), an endemic family of freshwater fishes in Middle-America…………………………………………………………………….. 156 6.11. An integrative taxonomic study reveals a new species of Tylodelphys Diesing, 1950 (Digenea: Diplostomidae) in central and northern Mexico…………. 158 6.12. Maritrema corai n. sp. (Digenea: Microphallidae) from the white ibis Eudocimus albus (Linnaeus) (Aves: Threskiornithidae) in Mexico………………... 160 6.13. Phylogenetic analysis using the 28S rRNA gene reveals that the genus Paracreptotrema Choudhury, Pérez-Ponce de León, Brooks and Daverdin, 2006 (Digenea: Allocreadiidae) is not monophyletic; description of two new genera and one new species…………………………………………………………………….. 162 Índice de figuras Página Figura 1. Genoma mitocondrial de animales…………………………………………….. 25 Figura 2. Organización de genes del RNA ribosomal en Eucariontes…………………... 26 Figura 3. Microfotografía de Neoechinorhynchus (Neoechinorhynchus) brentnickoli parásito de Dormitator latifrons de Laguna de Tres Palos, Guerrero, México………….. 28 Figura 4. Ciclo de vida de Neoechinorhynchus rutili (Müller 1780) Stiles y Hassall 1905…………………………………………………………………………………….... 30         Resumen El género Neoechinorhynchus es el grupo de acantocéfalos más diverso con aproximadamente 116 especies. Estos son endoparásitos principalmente de peces dulceacuícolas, marinos, estuarinos y tortugas dulceacuícolas con una distribución cosmopolita. La mayor diversidad de especies se concentra en Norteamérica, por lo cual se ha sugerido que ésta región podría ser su centro de radiación. Especies de Neoechinorhynchus en Centroamérica son comunes en especies de peces de las familias Cichlidae y Eleotridae (principalmente del género Dormitator). Los mecanismos de diversificación de Neoechinorhynchus son el resultado de los cambios en los sistemas hidrológicos y de los procesos de diversificación de sus huéspedes. Neoechinorhynchus representa un modelo excelente para realizar un análisis de delimitación de especies, análisis filogenéticos y biogeográficos para dilucidar la diversidad de especies y la historia evolutiva de este grupo en Centroamérica. Los objetivos centrales de esta tesis fueron los siguientes: a) Realizar la reconstrucción filogenética de las especies de Neoechinorhynchus en Centroamérica. b) Delimitar las especies del género Neoechinorhynchus a través de métodos basados en árboles (GMYC, General Mixed Yule-Coalescent model, por sus siglas en inglés) y en distancias genéticas (ABGD, Automatic Barcode Gap Discovery, por sus siglas en inglés). c) Validar las hipótesis filogenéticas y de delimitación de especies a través de análisis de Species Tree by Multispecies Coalescent, por sus siglas en inglés (*BEAST). d) Conocer si los patrones filogenéticos de las especies de Neoechinorhynchus corresponden con la distribución de sus huéspedes. e) Evaluar las diferentes hipótesis filogenéticas y de delimitación de especies mediante el análisis morfológico de cada una de las especies de Neoechinorhynchus. 1 Entre agosto de 2012 y enero de 2016 se muestrearon 24 especies de huéspedes, en 57 localidades de cuatro países (México, Guatemala, Honduras y Costa Rica), en los cuales se muestrearon diferentes sistemas hidrológicos como ríos, lagos, lagunas, esteros, arroyos y oasis. En total se obtuvieron secuencias parciales de tres marcadores moleculares, citocromo oxidasa 1 (COI, 351 secuencias), espaciadores internos transcritos (ITS1+5.8S+ITS2, 329 secuencias), y de los dominios D2+D3 de la subunidad mayor del ADN ribosomal (28S, 277 secuencias). Con base en los resultados de esta información generada durante cuatro años se publicaron tres artículos de investigación y un cuarto manuscrito en elaboración. En el primer artículo de investigación se describió una nueva especie, Neoechinorhynchus (Neoechinorhynchus) mamesi, colectada del intestino de Dormitator latifrons en tres localidades de lagunas costeras del estado de Chiapas, México. A partir de la información de 46 caracteres morfológicos se realizaron análisis estadísticos como MANOVA y componentes principales (PCA) para diferenciar esta especie de otras distribuidas en México. Adicionalmente se obtuvieron secuencias de dos marcadores genéticos, un fragmento del gen citocromo oxidasa 1 (COI) y los dominios D2+D3 de la subunidad mayor del 28S del ADN ribosomal. Los análisis filogenéticos se realizaron para comparar esta nueva especie con otras registradas previamente en México. La validez de esta especie fue confirmada por caracteres morfológicos y moleculares. En un segundo artículo se describió otra nueva especie, Neoechinorhynchus (Neoechinorhynchus) mexicoensis recolectada del intestino de Dormitator maculatus en ríos y lagunas de las vertientes del Golfo de México. Esta especie fue comparada morfológicamente con otras 33 especies distribuidas en el continente americano, y se obtuvieron secuencias de los espaciadores transcritos internos (ITS) y los dominios D2+D3 2 de la subunidad mayor del 28S. Análisis filogenéticos se realizaron para comparar con otras especies descritas de peces dulceacuícolas, estuarinos y marinos distribuidos en México. Basado en múltiples evidencias tanto genéticas, morfológicas y ecológicos se determinó que los acantocéfalos asociados al pez estuarino Dormitator maculatus correspondían a una nueva especie. En el tercer artículo se realizó un listado de verificación de todas las especies de Neoechinorhynchus asociados a peces dulceacuícolas, marinos, estuarinos y tortugas dulceacuícolas distribuidas en Centroamérica. Este listado contiene registros de todos los artículos publicados sobre Neoechinorhynchus, adicionalmente se consultaron y revisaron todos los especímenes depositados en la Colección Nacional de Helmintos (CNHE). Los registros de este listado incluyen información de nueve especies de Neoechinorhynchus encontrados en 55 especies de peces, una especie de tortuga, para 87 localidades a lo largo de cinco países (México, Guatemala, Nicaragua, Honduras y Costa Rica). Para mayor confiabilidad en la delimitación de las especies de este listado, se obtuvieron secuencias de los dominios D2+D3 de la subunidad mayor del 28S para 262 especímenes correspondientes a estas nueve especies en Centroamérica. Finalmente para integrar toda la información generada durante la investigación se está elaborando un cuarto manuscrito. Para este último proyecto se obtuvieron secuencias parciales de 351 especímenes para el gen mitocondrial citocromo oxidasa 1 (COI), 329 especímenes para los espaciadores internos transcritos (ITS1+5.8S+ITS2) y 277 especímenes para los dominios D2+D3 de la subunidad mayor del 28S en 57 localidades de cuatro países en Centroamérica. Los resultados preliminares de este trabajo basados en diferentes métodos para la delimitación de especies (GMYC, ABGD y *BEAST) en combinación con análisis estadísticos morfológicos (MANOVA, PCA) mostraron que el 3 género Neoechinorhynchus en Centroamérica es un grupo hiper-diverso conformado por múltiples especies crípticas. Adicionalmente a las nueve especies descritas morfológicamente en Centroamérica, en este estudio se encontraron al menos otras nueve especies crípticas (linajes) y una especie morfológicamente distinta (linaje 8), asociados a especies de peces estuarinos del género Dormitator y peces dulceacuícolas de la familia Cichlidae. 4 Abstract The genus Neoechinorhynchus is the most diverse group of acanthocephalans with approximately 116 described species. These are endoparasites mainly of freshwater fishes, and marine and freshwater turtles, with a cosmopolitan distribution. The greatest diversity of species is registered in North America, it has been suggested that this region could be the center of radiation for Neoechinorhynchus. Species of Neoechinorhynchus in Middle America commonly parasitize the fish families Cichlidae and Eleotridae (mainly from the genus Dormitator). The diversification processes in Neoechinorhynchus are the result of changes in hydrological systems and the mechanism of diversification of their hosts. Neoechinorhynchus represents an excellent model for analysis of species delimitation to elucidate the diversity of species and evolutionary history of this group in Middle America. The main objectives of the present thesis were to: a) perform the phylogenetic reconstruction of Neoechinorhynchus spp. in Middle America, b) delineate species of the genus Neoechinorhynchus through tree-based methods (GMYC, General Mixed Yule- Coalescent model) and genetic distances (ABGD, Automatic Barcode Gap Discovery), c) validate the hypothesis of delimitation of species using of Species Tree by Multispecies Coalescent (*BEAST), d) determine whether the phylogenetic patterns of Neoechinorhynchus spp. correspond to the distribution of this host, and e) evaluate the different hypothesis by morphological analysis of each species of Neoechinorhynchus. Between August 2012 and January 2016, 24 species of host were revised in 57 localities in four countries (Mexico, Guatemala, Honduras, and Costa Rica), in which different water systems such as rivers, lakes, ponds and streams were sampled. Partial sequences of three molecular markers were obtained; mitochondrial cytochrome oxidase 1 (COI, 351 sequences), internal transcribed spacers (ITS1 + 5.8S + ITS2, 329 sequences) of 5 nuclear ribosomal DNA and the D2 + D3 domains of the large subunit (28S, 277 sequences). Based on the information generated over four years, we published three research articles and a fourth manuscript is in the process of submission. In the first research article a new species was described as Neoechinorhynchus (Neoechinorhynchus) mamesi. The species was collected from the intestine of Dormitator latifrons in three localities of coastal lagoons in the State of Chiapas, Mexico. The statistic analyses such as multivariate analysis of variance (MANOVA) and principal components analysis (PCA) were performed to differentiate this species from others distributed in Mexico. Additionally, we obtained sequences from two genetic markers, partial sequences from cytochrome oxidase 1 (COI) and the D2/D3 domains of the large subunit of 28S. The phylogenetic analyses were performed to compare his new species with others of the genus previously recognized in Mexico. Morphological and molecular characters confirmed the validity of this species. A second species was described in my second article as Neoechinorhynchus (Neoechinorhynchus) mexicoensis, collected in the intestine of Dormitator maculatus from rivers and lagoons of the Gulf of Mexico. The morphology of his new species was compared with 33 other species distributed in the American continent. We obtained and compared sequences of ITS region and the D2/D3 domains of the large subunit of 28S. Phylogenetic inference was performed to compare it with other freshwater, estuarine and marine species distributed in Mexico. Based on multiple evidence, such as genetic, morphological and ecological, it was determined that the acanthocephalans associated with the estuarine fish Dormitator maculatus corresponded to a new species. In the third article we present a checklist of all the species of Neoechinorhynchus associated with freshwater, marine, and estuarine fish and freshwater turtles distributed in 6 Middle America. This list comprises records from all articles published on Neoechinorhynchus. Additionally, for this work I consulted and analyzed all specimens deposited in the Colección Nacional de Helmintos (CNHE). The records of this checklist include information on nine species of Neoechinorhynchus found in 55 species of fishes and one species of turtle in 87 localities from five countries (Mexico, Guatemala, Nicaragua, Honduras, and Costa Rica). For greater reliability in the species delimitation of this checklist, sequences were obtained for the D2/D3 domains of the large subunit of 28S from 262 specimens corresponding to the nine species in Middle America. Finally, in order to integrate the information generated during his work we are preparing a fourth manuscript. In this work, we obtained 351 partial sequences for the mitochondrial gene, cytochrome oxidase 1 (COI); for 329 specimens we sequenced the internal transcribed spacer (ITS1+5.8S+ITS2) and for 277 for specimens the D2+D3 domains of the large subunit of RNA 28S in 57 localities of four countries in Middle America. The preliminary results of this work based on multiple methods of species delimitation (General Mixed Yule-Coalescent model, Automatic Barcode Gap Discovery, and Species Tree) show that the genus Neoechinorhynchus in Middle America is a hyper- diverse group comprising multiple cryptic species. In addition, to the nine species described morphologically in Middle America, in this study we found at least nine other cryptic species and one species diagnosed as morphologically different (lineage 8) associated with species of estuarine fishes of the genus Dormitator and freshwater fishes of the family Cichlidae. 7 1. INTRODUCCIÓN 8 1.1. Métodos para la delimitación de especies El interés por los métodos para delimitación de especies y la inferencia de patrones y mecanismos de especiación surgió a mediados del siglo XX durante la era denominada “Nueva Sistemática” (Mayr 1982), posteriormente este interés se redujo considerablemente (Wiens 1999); sin embargo, hubo un renacimiento del tema adoptado por Sites y Marshall (2003); para describir la práctica empírica de la delimitación de especies, con la necesidad de distinguir entre una definición ontológica de las especies (no operacional) en comparación con los datos empíricos (operacional) necesarios para probar su realidad (Frost y Kluge 1994, de Queiroz 1998). A pesar de las diversas definiciones contemporáneas actuales del concepto de especie; de Queiroz (1998) argumenta que las diferencias entre estas definiciones no reflejan las diferencias fundamentales con respecto al concepto general de especie. Por lo que considera que todas las definiciones de las especies “modernas” equiparan, ya sea explícita o implícitamente las especies con segmentos de linajes evolutivos a nivel de población. Por ello, adopta el concepto general de linaje (GLC por sus siglas en inglés) que define a una especie como "un linaje (una secuencia ancestral descendiente de poblaciones) que evoluciona por separado de los demás y con su propia función en la evolución y tendencias" (Simpson 1961). La definición sobre lo qué es una especie constituye un concepto separado de los aspectos metodológicos de la delimitación de especies; previamente éstos se habían fusionado con el propósito de que las propiedades que se utilizan para inferir los límites de las especies (la prueba empírica) fueran también necesarias para la definición de una especie (un tema de conceptualización). En los conceptos alternativos de especie se adoptan diferentes propiedades adquiridas por los linajes durante el curso de su divergencia (por 9 ejemplo, aislamiento reproductivo intrínseco, diagnosis, monofilia) y estos se determinan como propiedades secundarias definitorias (criterios secundarios de las especies) (de Queiroz 2007). Sin embargo, la mayoría de estos conceptos se puede ver como criterios secundarios de las especies, relevantes para la delimitación de especies. 1.1.1. Los primeros métodos para la delimitación de especies En un principio existieron diferentes métodos relacionados con la detección y delimitación de las propiedades de los linajes, los cuales se dividieron en dos métodos: aquellos no basados en árboles y los basados en árboles (Sites y Marshall 2003). Los primeros incluyen: (1) distancias genéticas pareadas que podrían ser probadas, ya sea para las correlaciones con el aislamiento reproductivo (Highton 1990), las distancias morfológicas (Puorto et al. 2001), o las distancias geográficas (Good y Wake 1992); (2) los estadísticos de flujo génico, para estimar la magnitud del flujo genético a través de zonas híbridas (Porter 1990); (3) los estados de caracteres alternativos fijos, como un indicador de la ausencia de flujo de genes en un "análisis de agregación de la población" (PAA) (Davis y Nixon 1992); (4) la presencia de genotipos heterocigóticos como un indicador de un "campo para la recombinación" (Doyle 1995), y (5) grupos genéticos (Mallet 1995). Por otra parte los métodos basados en árboles incluyen: (1) tres variables del concepto filogenético de especie basado en apomorfía, la separación de linajes, o criterios basados en un nodo, siguiendo la terminología de Brooks y McLennan (1999); (2) la acumulación de haplotipos cladísticos (Brower 1999); (3) la evaluación molecular y morfológica utilizando diagramas de flujo dicotómicas (Wiens y Penkrot 2002); (4) la exclusividad genealógica (Baum y Shaw 1995), y (5) una extensión del análisis de clados anidados de Templeton et al. (1995), que incluye pruebas de límites de especies (Templeton 2001). Los conjuntos de datos en estos primeros estudios con ambos métodos, con mayor 10 frecuencia incluyeron genotipos de isoenzimas multilocus (Marshall et al. 2006), caracteres morfológicos (generalmente merísticos), y pocos estudios basados en secuencias de ADN mitocondrial (ADNmt; Dettman 2003). Otros métodos para la delimitación de especies fueron desarrollados; así por ejemplo, Puorto et al. (2001), mostraron un enfoque diferente para probar hipótesis, utilizando una combinación de métodos filogeográficos, morfometría multivariada y pruebas de asociación de matriz, para investigar los límites entre especies de serpientes brasileñas tradicionalmente asignadas a las especies Bothrops leucurus y B. pradoi, estos autores utilizaron la prueba de asociación de matriz para relacionar los patrones de variación morfológica con la variación de las secuencia de ADN mitocondrial. Templeton (2001) propuso una superposición de la geografía en el árbol de genes para probar una hipótesis nula, donde la muestra es de un único linaje evolutivo. Esta segunda prueba se llevó a cabo por los contrastes directos de linajes identificados previamente o mediante la superposición de datos reproductivos y/o ecológicos en el árbol de genes y pruebas para las transiciones significativas que son concordantes con los linajes previamente identificados. Wiens y Penkrot (2002) en su método utilizaron árboles con datos de ADN mitocondrial y árboles con datos morfológicos, para comparar límites de especies inferidos a partir de estos enfoques. Morando et al. (2003) combinaron varios métodos de reconstrucción filogenética, basados en árboles y con el análisis de clados anidados para extraer la señal de máximo histórico en los distintos niveles de la especie Liolaemus elongatus. Implementaron una metodología basado en árboles para las secuencias de ADN, para probar los límites entre especies, y propusieron modificaciones para dar cabida a grandes conjuntos de datos y regiones de genes con tasas de sustitución heterogéneos. Combinando árboles de haplotipos 11 y con el análisis de clados anidados, permitió probar límites de las especies con base de un criterio definido a priori. 1.1.2. Nuevos métodos, nuevos datos y enfoques para la delimitación de especies Por otro lado se hicieron propuestas ambiciosas, con el propósito de acelerar el descubrimiento y descripción de nuevas especies; entre ellas se incluyen los códigos de barras de ADN (Hebert et al. 2003, 2004), la taxonomía de ADN (Tautz et al. 2003), y la taxonomía basada en redes (por ejemplo, Godfray 2002; Scoble 2004; Knapp et al. 2007). Controversias sobre estas propuestas están disponibles en la literatura (especialmente en códigos de barras de ADN), algunos ejemplos en Will et al. (2005); Brower (2006); Hickerson et al. (2006) y Meier et al. (2006), otros aspectos de delimitación de especies y sobre las consecuencias de los nuevos enfoques en la delimitación de especies para otros campos, como la ecología y la conservación (ver Agapow et al. 2004; Padial y de la Riva 2006). Posteriormente, Pons et al. (2006) optaron por los modelos de crecimiento de linaje estocástico (modelos de Yule) que se combinaron con la teoría de coalescencia para desarrollar un nuevo método de probabilidad, que determinó el punto de transición de un nivel de especies (especiación y extinción) a nivel de la población (coalescencia) y los procesos evolutivos. A partir del año 2007 surgieron novedosos métodos para delimitar especies, uno de ellos fue el método sin árbol de genes monofileticos propuesto por Knowles (2007), que estima límites coalescentes de las especies, sobre la base de múltiples árboles de genes no ligados, y que no requiere de especies que se han caracterizado por monofilia recíproca. Sobre este mismo tema, Shaffer y Thomson (2007) en su método introdujeron una población basado en grandes conjuntos de polimorfismos de un sólo nucleótido (SNP), lo que sería más adecuado para la delimitación de especies de muy corta 12 edad. Por último se incluyen dos métodos más (por ejemplo Raxworthy et al. 2007; Leaché et al. 2009), considerando datos ecológicos y modelado de nichos ecológicos para sustentar los datos moleculares o morfológicos en la delimitación de especies. Otros métodos fueron desarrollados basándose en múltiples líneas de evidencia y métodos estadísticos, entre algunos de estos está el enfoque de Bond y Stockman (2008), que es especialmente relevante para las poblaciones geográficamente estructuradas, en la que de un conjunto de datos de secuencias se pueden recuperar una estructura bien definida, bien apoyada, geográficamente concordante y genéticamente divergente, pero poblaciones morfológicamente crípticas (especies). Con un enfoque diferente (Cummings et al. 2008), se basa en pruebas estadísticas tanto de estructura de la población y la exclusividad genealógica de loci nucleares, para poner a prueba las especies identificadas provisionalmente a partir de haploclados de ADNmt bien apoyados. Como un tercer ejemplo, Puillandre et al. (2012a) describieron un enfoque de cuatro pasos para "la generación de hipótesis de especiación robustas" en la familia de moluscos Turridae (género Gemmula) basados en el análisis de: (1) la recolección de código de barras de ADN del gen COI para GMYC, General Mixed Yule-Coalescent (Pons et al. 2006) y ABGD, Automatic Barcode Gap Discovery (Puillandre et al. 2012b), simultáneamente con (2) genes nucleares (28S del rRNA), datos morfológicos, geográficos y batimétricos, para redefinir los límites entre especies de este grupo. En estos resultados se duplicó la diversidad de las especies previamente conocidas en Gemmula, y se concluyó que estos métodos pueden ser útiles para la delimitación de especies a gran escala en grupos megadiversos. Otros ejemplos adicionales incluyen métodos basados en el genotipo de marcadores multi-locus dominantes y co-dominantes (Hausdorf y Hennig 2010), las estimaciones 13 combinadas de los tiempos de divergencia y el flujo genético para discriminar intraespecíficamente de los patrones interespecíficos (Hey y Pinho 2012), y una extensión del programa GENELAND implementado en el paquete R, que incluye genética fenotípica (morfométricas) y datos geográficos para la delimitación de poblaciones y especies (Guillot et al. 2012). La reciente fusión de la teoría coalescente con la filogenética ha impulsado una nueva generación de métodos de delimitación de especies y un nuevo paradigma en la sistemática (Edwards 2009). Este nuevo marco teórico, y sus aplicaciones analíticas derivadas, en parte, fue requerido como una solución para el mejoramiento del conflicto observado entre las genealogías de múltiples loci (los árboles de genes) con las genealogías a nivel de población subyacentes (árboles de especies) (Maddison 1997). Se han desarrollado varios métodos para la estimación de árboles de especies a partir de una colección de múltiples árboles de genes, bajo diferentes algoritmos (Kubatko et al. 2009; Liu 2008). Con estos nuevos métodos, se generaron metodologías para la delimitación de especies totalmente coalescentes, que consiste en seleccionar el mejor modelo de árbol de especies a partir de un conjunto de modelos alternativos que representan hipótesis diferentes en los límites entre especies. Otro método de delimitación de especies, que consiste en el muestreo de la distribución posterior bayesiana de las especies, usando salto-reversible de las cadenas Markov de Monte Carlo (rjMCMC) con el programa de BP&P 2.1 (Yang y Rannala 2010), en este método se utiliza un enfoque de modelado bayesiano para generar las probabilidades posteriores de las asignaciones para especies, tomando en cuenta las incertidumbres debido a los árboles de genes desconocidos y el proceso de coalescencia ancestral. Por otro lado enfoques heurísticos y/o semi-paramétricos se han desarrollado para resolver el límite entre coalescencia y procesos de especiación usando árboles de genes 14 individuales (mezcla de Yule + coalescencia generalizada) (Pons et al. 2006), la búsqueda de árboles de especies y los límites de las especies a través de la minimización del gen conflicto de árbol y la estructura intraespecífica (O’Meara 2010), así como la selección de modelos de delimitación de especies con el uso de computación bayesiana aproximada (ABC) (Camargo et al. 2012). El desarrollo de nuevos métodos de delimitación de especies enfocados en multi- especies/multi-locus, también se debió en parte a la demanda de herramientas analíticas eficientes para manejar la creciente cantidad de datos moleculares obtenidos con técnicas de secuenciación de próxima generación (NGS, por sus siglas en Inglés). Los nuevos métodos de delimitación de especies deben ser capaces de manejar miles de loci para múltiples individuos derivados de loci nucleares, intrones, y loci codificantes de proteínas obtenidos de técnicas genómicas (Thomson et al. 2010; Portik et al. 2012). Sin embargo, estos nuevos métodos de delimitación de especies al parecer son inadecuados para analizar datos de todo el genoma que se han comenzado a obtener para una amplia diversidad de organismos a través de tecnologías de secuenciación de nueva generación (Holsinge 2010; Tautz et al. 2010). 1.1.3. Métodos de delimitación de especies utilizados en parásitos La delimitación de especies en parásitos tradicionalmente se ha realizado mediante rasgos morfológicos para excluir o incluir individuos a ciertas entidades taxonómicas. El tipo de reconocimiento a través de cualquier característica morfológica se conoce como concepto linneano o morfológico de especie (Mayden 1995). La variación morfológica de las especies de parásitos se asocia por ejemplo a la distribución de sus huéspedes, al tipo de especie de huésped y las condiciones ecológicas donde éstas se encuentran (Hanzelová et al. 2005). Tradicionalmente la morfología descriptiva, la morfometría geométrica y 15 caracteres ecológicos se han utilizado para establecer límites entre diferentes grupos de parásitos. Solo por mencionar algunos ejemplos tenemos los trabajos de Gibson et al. (2002), Jones et al. (2005) y Bray et al. (2008) para trematodos; Modry et al. (2000) y Keeler et al. (2012) para protozoarios; Flechmann y McMurtry (2009) y Fernandez et al. (2013) en ácaros y garrapatas. Por otro lado con el avance del uso de marcadores moleculares, el código de barras de ADN ha sido utilizado ampliamente para la delimitación de especies de parásitos. Estas secuencias mitocondriales (COI) generalmente se han analizado en los contextos filogenético, de distancias genéticas, y en combinación con caracteres morfológicos para establecer límites entre especies. Existe una larga lista de trabajos publicados, por ejemplo Ogedengbe et al. (2011) para protozoarios; Moszczynska et al. (2009), Ferri et al. (2009), López-Caballero et al. (2013) para helmintos, y Debert et al. (2008), Jin-Bo et al. (2013) para ácaros. El uso de análisis filogenéticos, las distancias genéticas, caracteres morfológicos y ecológicos, ha contribuido en gran medida a la identificación y delimitación de parásitos pese al microscópico tamaño que algunos llegan a tener, lo cual sería casi imposible mediante el solo estudio de su morfología. Sin embargo, a pesar de la gran cantidad de métodos disponibles para la delimitación de especies, su uso es poco común entre los parasitólogos. Se buscaron trabajos publicados en los últimos 6 años para parásitos donde se haga uso de algunos de los métodos mencionados anteriormente. Para esta búsqueda se utilizó la base de datos del ISI Web of Knowledge, en la búsqueda se utilizaron las palabras clave como “species delimitation in parasites”; “species delimitation of parasites”; “GMYC parasites”; “ABGD parasites”; “BP&P parasites”. En esta revisión solo se lograron encontrar algunos trabajos que a continuación se mencionan. Entre los trabajos 16 publicados se encuentran el de Martínez-Aquino et al. (2013), quienes utilizaron el modelo General Mixed Yule-Coalescent (GMYC) para la delimitación de especies del género Margotrema, parásito de peces dulceacuícolas del centro México. Adicionalmente estos autores realizaron un análisis de species tree (*BEAST) para corroborar la congruencia de sus resultados del modelo GMYC. Los resultados obtenidos mostraron que el género Margotrema se compone de dos especies válidas y una de ellas con al menos 3 linajes sin describir. Para el mismo grupo de parásitos (trematodos), Georgieva et al. (2014) utilizaron datos moleculares, morfológicos y ecológicos en la delimitación de especies del género Echinostoma en Europa. Locke et al. (2015a) utilizaron dos métodos: el algoritmo de Barcode Index Numbers (BINs; Ratnasingham y Hebert 2013) y el método ABGD (Automatic Barcode Gap Discovery; Puillandre et al. 2012b) para delimitar especies del género Clinostomum en una escala global. Sus resultados mostraron que ambos métodos son congruentes, encontrando al menos ocho especies putativas en una escala global de la distribución del género, sin embargo estas especies no fueron descritas por que sólo analizaron los estadios larvales (metacercarias). En otro grupo de parásitos Bochkov et al. (2014) utilizaron el método de Markov de Monte Carlo (rjMCMC) con el programa de BP&P 2.1 (Yang y Rannala 2010) para delimitar especies de ácaros del género Chorioptes. Herrmann et al. (2014) utilizaron un método bayesiano para la delimitación de especies en Stegodexamene anguillae, obteniendo dos especies cripticas. Blasco-Costa et al. (2014) usaron diferente fuentes de información (árboles de especies) para determinar 16 linajes en Diplostomum. Locke et al. (2015b) utilizaron dos métodos: el algoritmo de Barcode Index Numbers (BINs) y el ABGD (Automatic Barcode Gap Discovery) para delimitar larvas de Diplostomidos. Con esto es evidente que los parasitólogos utilizan diferentes estrategias en la delimitación de especies como la reconstrucción filogenética 17 (por ejemplo; métodos de distancia, máxima parsimonia, máxima verosimilitud, inferencia bayesiana), distancias genéticas (por ejemplo; distancias p, distancias Kimura-2- parámetros), caracteres morfológicos (por ejemplo; morfometría geométrica, microscopia electrónica) y ecológicos (tipo de huésped, tipo de ciclo de vida, distribución geográfica) para delimitar especies de parásitos. Por lo tanto, son poco los estudios donde se incluyen los métodos estrictamente desarrollados para la delimitación de especies. 1.2. Teoría de especiación A pesar de que han transcurrido 157 años desde que el libro famoso de Darwin fue publicado “El origen de las especies” (Darwin 1859) y uno de los temas centrales de la biología evolutiva sigue siendo cuestionado, en como las especies evolucionan (Coyne y Orr 2004). En un principio, el origen de nuevas especies había desconcertado a los biólogos evolutivos durante décadas, así por ejemplo, los primeros estudios se centraron en comprender cómo las especies evolucionan por medio de selección natural en un mismo hábitat, ideas propuesta por Darwin (Brooks 1950). Más tarde Futuyama y Mayer (1980), fueron sólo algunos de los que buscaron alternativas a la selección natural como un modo de especiación. Años más tarde con el avance en biología molecular, aspectos genéticos de la especiación fueron ganando interés (algunos ejemplos mostrados en Coyne y Orr 2004). Hoy en día, con los avances en biología molecular, gracias a lo posibilidad de obtener de una manera rápida y confiable grandes cantidades de información genética y complementarla con datos ecológicos y morfológicos, es más factible obtener un mayor avance en la comprensión de los mecanismos que promueven la evolución y especiación (Butlin 2010). Debido a la complejidad de interacciones que experimentan los individuos y las poblaciones con sus congéneres y estos con el medio ambiente, los diferentes modos de 18 especiación se han clasificado para poder estudiar los diferentes procesos involucrados. Una de las clasificaciones más ampliamente aceptada es basada en las condiciones geográficas y en los mecanismos subyacentes a la especiación (Coyne y Orr 2004). Particularmente, se ha aceptado que el proceso de especiación puede finalizar cuando una subpoblación ha logrado ya sea su aislamiento precigótico, es decir, no pueden recombinarse más con sus antecesores, ya sea a través de barreras geográficas o de comportamiento o cuando una subpoblación ha alcanzado el aislamiento postcigótico, es decir, cuando los genes han cambiado a un punto de incompatibilidad. Mientras que en el primer caso (precigótico) casos de descendencia híbrida viable puede resultar del cruzamiento, sin embargo, no se producirá ninguna descendencia viable porque el aislamiento postcigótico se ha establecido entre las poblaciones. 1.2.1. Modos de especiación Especiación alopátrica (Mayr 1942). Describe el origen de una nueva especie como la consecuencia de la fragmentación de una población distribuida inicialmente panmíctica en subpoblaciones, todo a causa de diferentes eventos geológicos como por ejemplo el surgimiento de una montaña que actúa como barrera para el flujo génico. Este tipo de especiación es poco discutida ya que es muy aceptada por la comunidad científica (Mayr 1942; Kawata y Yoshimura 2000; Mallet et al. 2009). Cuando surge una barrera geográfica, el flujo genético se ve reducido dando origen a la divergencia de ambas subpoblaciones en diferentes direcciones. Este proceso geológico va acompañado por acumulación de mutaciones y deriva genética, generalmente puede existir adaptación local y por consiguiente puede dar origen a un grupo de individuos aislados tanto morfológica como reproductivamente. Particularmente las mutaciones y la deriva genética son procesos estocásticos, por lo tanto la morfología no necesariamente tendría que cambiar, lo que daría 19 origen a especies crípticas, que formarían grupos genéticamente distintos pero morfológicamente similares (algunos ejemplos en Hebert et al. 2004; Elmer et al. 2007). Otro ejemplo, pero en el escenario opuesto, consiste en grupos de individuos morfológicamente distintos que no están reproductivamente aislados unos de otros, lo que puede ser resultado de especiación alopátrica, un ejemplo bastante claro son los peces de la familia Cichlidae (Stelkens et al. 2009). Especiación parapátrica (Smith 1955). Este modo de especiación describe una situación donde poblaciones con adaptaciones ecológicas divergentes tienen distribuciones adyacentes y la migración entre estas poblaciones da lugar a hibridación accidental. Debido a que ninguna de las especies parentales se adapta mejor a su propio hábitat, la cruza entre esas poblaciones suelen mostrar una adecuación por debajo del promedio en ambos hábitats y por lo tanto estas son seleccionadas en contra. El proceso de diferenciación inicial hasta la especiación completa con un fuerte aislamiento reproductivo es a menudo ayudado por un proceso llamado “refuerzo”; en él se describe el incremento del aislamiento reproductivo por la selección natural cuando los individuos híbridos menos aptos son seleccionados en contra y por lo tanto el emparejamiento selectivo en las dos poblaciones parentales proporciona una ventaja en la adecuación (Coyne y Orr 2004). Sin embargo, los hallazgos más recientes han demostrado que este tipo de especiación es mucho más complicado de lo que se pensaba normalmente (Líber et al. 2004), y se ha planteado que es casi imposible demostrar la especiación parapátrica en la naturaleza ya que las explicaciones alternativas son casi siempre posibles. Entre estas se incluye el contacto secundario en especiación alopátrica (Coyne y Orr 2004). Especiación simpátrica (Poulton 1903), se define como la condición de estar en el mismo lugar. En este tipo de especiación se da origen a una nueva especie dentro de una 20 población, sin aislamiento geográfico, sin embargo, esta sutíl definición solo podría ser una de las 12 definiciones mencionadas por Fitzpatrick et al. (2008). Existen numerosos ejemplos donde, en teoría, este tipo de especiación podría darse bajo condiciones estrictas (Kawata y Yoshimura 2000; Almeida y de Abreu 2003; Ripa 2009; van Doorn et al. 2009). En la naturaleza es poco común encontrarse con ejemplos claros de este tipo de especiación, son poco los trabajos que son ampliamente aceptados como el trabajo de Bolnick y Fitzpatrick (2007). La especiación simpátrica puede ser un proceso relativamente rápido si la adaptación a nichos ecológicos distintos se refuerza con el apareamiento selectivo. Como se ha indicado anteriormente para la especiación parapátrica, el proceso puede ser acelerado por el refuerzo a través de la selección contra individuos intermedios, favoreciendo de este modo la evolución del aislamiento reproductivo precigótico. Ejemplos famosos son los estudios de especiación simpátrica en especies de peces endémicos de pequeños lagos. Por lo general, ofrecen la posibilidad de examinar los procesos de especiación alopátrica y sin efectos de diferenciación de la población de confusión si un solo evento de colonización como se infiere de la genética molecular implicada en una monofilia. Algunos de los ejemplos ampliamente conocidos es el de los cíclidos en lagos africanos (Schliewen et al., 2001; Schliewen y Klee 2004), otro sistema para especiación simpátrica es en los cíclidos de los lagos de Nicaragua los cuales han tenido el foco de atención reciente por diversos biólogos evolutivos (Barluenga y Meyer 2004; Barluenga et al. 2006). 21 1.2.2. Mecanismos de especiación Selección natural, es un proceso clave en la evolución que conduce a la creación o desaparición de la adecuación de rasgos biológicos relevantes dentro de una población. La selección funciona a través de efectos sobre la supervivencia y reproducción de los organismos. Endler (1986) menciona que la selección se basa en cuatro componentes principales: variación, herencia, crecimiento demográfico y supervivencia diferencial. La variación entre individuos de una población puede darse por apariencia, comportamiento o cualquier otro rasgo. La herencia hace referencia a que algunos rasgos se transmiten de padres a hijos, es decir son hereditarios. El crecimiento demográfico, donde por lo general las poblaciones producen más descendientes que la cantidad de recursos disponibles, por lo tanto la competencia por los recursos conduce a la mortalidad en cada generación. En la supervivencia diferencial, individuos con rasgos más adecuados para la explotación de los recursos se reproducen con más éxito, y producen mayor descendencia, dando lugar al cambio en la frecuencia de un rasgo particular, probablemente en un rasgo que es benéfico para la población. La selección natural actúa sobre las frecuencias de un rasgo en particular y puede tomar la forma de estabilizadora, direccional y diversificadora (Coyne y Orr 2004). Bajo selección estabilizadora se eliminan las variaciones extremas y la distribución de las frecuencias de un rasgo se mantiene como en la generación anterior. En la selección direccional los individuos con rasgos de uno de los extremos de la distribución se mantienen, por lo que la frecuencia del rasgo en generaciones posteriores se desplaza de generación en generación en una sola dirección. En la selección diversificadora o disruptiva ambos extremos de un rasgo se ven favorecidos a costa de los intermedios. Selección sexual, esto ocurre con frecuencia a partir de la competencia entre machos por las hembras (Futuyama 1998). Esta forma de competencia intraespecífica se puede 22 generalizar como la variabilidad en la adecuación reproductiva como consecuencia del éxito diferencial de apareamiento. Los resultados de este tipo de selección son los individuos que ofrecen ya sea una ventaja en la competencia entre machos (por ejemplo, machos más robustos) o mejorar el atractivo de uno de los sexos (por ejemplo, caracteres sexuales secundarios). La Hibridación, puede incrementar la variación genética hasta formar un nuevo grupo de organismos, rasgos de adaptación beneficiosa surgen para la explotación de recursos no utilizados previamente (Stelkens et al. 2009). Los mismos mecanismos al mismo tiempo evitan la pérdida de variación genética debido a la fuerte selección que prevalece en los escenarios de especiación simpátrica e incluso pueden inducir la especiación (ver Mallet 2007). El producto no es necesariamente la formación de una especie híbrida, sino más bien un aumento en la variación genética con la forma de la introgresión de desaparecer en una nube híbrida. La teoría indica que la adaptación puede ser rápida y que la evolución actúa sobre la variación genética en lugar de confiar en la más rara ocurrencia de mutaciones beneficiosas (Barrett y Schluter 2008; Wolf et al. 2010). 1.3. Marcadores moleculares Los marcadores moleculares son biomoléculas que aportan información genética en términos genealógicos (Avise 2004). Los biólogos evolutivos usan tanto datos morfológicos como moleculares para establecer hipótesis de relaciones filogenéticas entre organismos, para estimar la variación dentro de las poblaciones y para probar hipótesis de adaptaciones ecológicas (Rentería-Alcántara 2007). Los marcadores moleculares son una herramienta alternativa en diversos campos de la biología, incluyendo evolución, ecología, biomedicina, ciencias forenses y estudios de biodiversidad. 23 Los marcadores moleculares pueden ser clasificados en tres grupos: 1. Marcadores con base en la hibridación del DNA, v. gr. polimorfismos en la longitud de fragmentos de restricción del DNA (RFLP, restriction fragment length polymorphisms); 2. Análisis de las secuencias del DNA nuclear y mitocondrial; y 3. Marcadores mixtos, v. gr. polimorfismo en la longitud de fragmentos amplificados de DNA, pueden considerarse como una combinación de RFLP y RAPD´s (Picca et al. 2002; Avise 2004; Rentaría-Alcántara 2007). Una de las moléculas más ampliamente utilizadas en análisis filogenéticos y filogeográficos es el ADN mitocondrial (Figura 1). Ésta es una molécula circular covalente de aproximadamente 16-20 kilobases. Este genoma generalmente contiene un total de 37 genes dependiendo del organismo (13 RNA mensajeros, 2 RNA ribosomales y 22 RNA de transferencia) (Avise et al. 1987). Las propiedades más interesantes en términos filogenéticos y filogeográficos, son su alta tasa de evolución (sustitución) a nivel de secuencias de nucleótidos, su nula recombinación, variación intraespecífica, y más importante, su herencia materna (con escasas excepciones). Estas características permiten describir la historia matrilineal de organismos coespecíficos y con ello aplicar estimaciones de reloj molecular y hacer análisis de coalescencia (Vázquez-Domínguez, 2007; Vázquez- Domínguez et al. 2009). En helmintos parásitos se han utilizado algunos genes mitocondriales para inferir la evolución de los grupos y separar especies (Macnish et al. 2002; Bensh et al. 2004; Miura et al. 2005; Grillo et al. 2007). 24 Figura 1. Genoma mitocondrial de animales. Otros de los marcadores ampliamente utilizado en helmintos parásitos son los genes nucleares del ADN nuclear ribosomal. El rADN se presenta en repeticiones tándem y está formado por tres subunidades altamente conservadas (18 rADN, 5.8 rADN y 28 rADN), separadas por dos espaciadores internos transcritos con elevadas tasas de sustitución (ITS1 e ITS2) (Eickbush y Eickbush 2007). Estas repeticiones en tándem se encuentran conservadas a lo largo de todo un genoma y evolucionan concertadamente, lo que se atribuye a eventos de recombinación como entrecruzamiento desigual y conversión génica (Figura 2) (Rentaría-Alcántara 2007, Eickbush y Eickbush 2007). Genes del RNA ribosomal (rRNA) (ITS1, 5.8S, ITS2 y de los dominios D2-D3 del 28S) se han utilizado para delimitar especies crípticas en helmintos parásitos (Blouin 2002; Luo et al. 2002, 25 2003; Macnish et al. 2002; Král’ová-Hromadová et al. 2003; Miura et al. 2005; Vilas et al. 2005; Marques et al. 2007; Steinauer et al. 2007; Martínez-Aquino et al. 2009). Figura 2. Organización de genes del RNA ribosomal en eucariotas. 1.4. Especies del género Neoechinorhynchus como sistema de estudio Los acantocéfalos del género Neoechinorhynchus Stiles y Hassall, 1905 son endoparásitos de peces dulceacuícolas, marinos y estuarinos, así como de anfibios y tortugas dulceacuícolas. Estos parásitos son considerados uno de los géneros más diversos dentro del phylum Acanthocephala, superando las 116 especies descritas con una distribución cosmopolita (Amin 2013; Smales 2013). En total se han descrito 49 especies para el continente americano, 33 especies para Norteamérica y 16 para Centro y Sudamérica (Amin 2002; Barger et al. 2004; Amin y Heckmann 2009; Pinacho-Pinacho et al. 2012; Salgado-Maldonado 2013). 26 En México se han descrito nueve especies del género Neoechinorhynchus, dos de estas especies parasitan tortugas dulceacuícolas; N. (N.) schmidti Barger, Thatcher y Nickol, 2004 y N. (N.) emyditoides Fisher, 1960; y las otras siete ocurren en peces dulceacuícolas, marinos y estuarinos; N. (N.) roseus Salgado-Maldonado 1978; N. (N.) golvani, Salgado-Maldonado 1978; N. (N.) chimalapasensis Salgado-Maldonado, Caspeta- Mandujano y Martínez-Ramírez, 2010; N. (N.) brentnickoli Monks, Pulido-Flores y Violante-González, 2011; N. (N.) mamesi Pinacho-Pinacho, Peréz-Ponce de Léon y García- Varela, 2012, N. (N.) panucensis Salgado-Maldonado 2013, y N. (N.) mexicoensis Pinacho- Pinacho, Sereno-Uribe y García-Varela, 2015 (Pinacho-Pinacho et al. 2012; Salgado- Maldonado 2013; García-Prieto et al. 2010; Monks et al. 2011). Taxonómicamente, el género Neoechinorhynchus es clasificado dentro de la familia Neoechinorhynchidae Ward 1917, en la clase Eoacanthocephala (Amin 1985; Near et al. 1998; Monks 2001; Near 2002). Las especies del género Neoechinorhynchus se caracterizan morfológicamente por presentar una proboscis (cabeza), globular o subcilíndrica, recubierta con 18 ganchos dispuestos en tres hileras horizontales de seis ganchos cada una, un receptáculo de la proboscis, ganglio cerebral ubicado en la base del receptáculo de la proboscis, un tronco sin espinas. Los machos presentan una sola glándula de cemento (Amin 2002) (Figura 3). Amin (2002) sugirió que el género Neoechinorhynchus está dividido en dos subgéneros: Hebesoma Van Cleave, 1928 y Neoechinorhynchus Stiles y Hassall 1905, con base en un solo carácter morfológico (forma de los huevos); sin embargo, la carencia de un análisis filogenético del género Neoechinorhynchus deja esta sugerencia taxonómica como una hipótesis que debe ponerse a prueba. 27 Figura 3. Microfotografía de Neoechinorhynchus (Neoechinorhynchus) brentnickoli parásito de Dormitator latifrons en Laguna de Tres Palos, Guerrero, México. El género Neoechinorhynchus es uno de los más diversos dentro del Phylum, con aproximadamente 116 especies descritas. El 35% de la diversidad de especies se distribuyen en Norteamérica y está región aparentemente es el centro de radiación (Amin 2002). Taxonómicamente las especies del género están delimitadas; sin embargo, desde el 28 punto de vista genético han sido poco estudiadas. Martínez-Aquino et al. (2009) realizaron un análisis de la variación genética interpoblacional del acantocéfalo N. (N.) golvani en México utilizando dos genes nucleares. La divergencia genética y los análisis filogenéticos sugirieron que N. (N.) golvani representa un complejo de especies crípticas que se compone de tres linajes. El primer linaje tiene una distribución desde el noreste, sur, centro y sureste de México asociado a peces dulceacuícolas de la familia Cichlidae. Los linajes 2 y 3 están asociados a peces de la familia Eleotridae que se distribuyen en el Golfo de México y en la vertiente del Pacífico y representan dos especies. El linaje 3 que habita las costas del Pacífico mexicano, asociado al pez eleotrido Dormiator latifrons se describió como una nueva especie denominada N. (N.) brentnickoli (Monks et al. 2011). Un estudio más reciente revelo una nueva especie de Neoechinorhynchus de las lagunas costeras del estado de Chiapas basado en caracteres moleculares y morfológicos (Pinacho-Pinacho et al. 2012). Los estudios genéticos de las especies de Neoechinorhynchus asociados a peces de México revelaron una alta variación genética debido a factores de aislamiento y fragmentación de las poblaciones. Por lo tanto estos parásitos representan un excelente modelo para realizar un estudio de delimitación y variación genética que nos permita delimitar las poblaciones o detectar nuevas especies. 1.4.1. Ciclo de vida de Neoechinorhynchus El ciclo de vida de Neoechinorhynchus es indirecto y alternativamente usan vertebrados como huéspedes definitivos y crustáceos como huéspedes intermediarios. Las formas sexualmente maduras habitan el intestino de varios tipos de vertebrados (por ejemplo peces, tortugas y anfibios); las hembras liberan huevos al medio ambiente acuático a través de las heces de sus huéspedes. Los huevos son ingeridos por un crustáceo en el cuál se desarrollan tres fases larvarias en el siguiente orden: (1) acantor, (2) acantela y (3) 29 cistacanto o fase infectiva. Al ser ingerido el crustáceo con la fase infectiva por el huésped definitivo, el ciclo de vida es completado (Figura 4) (Schmidt 1985, 1988; Kennedy 2006). Figura 4. Ciclo de vida de Neoechinorhynchus rutili (Müller 1780) Stiles y Hassall 1905. A) adulto con ganchos, 1) los adultos se pegan a la pared intestinal de su huésped definitivo (carpas y otros peces), 2) los embriones salen al medio por medio de las heces, 3-6) el huésped intermediario Asellus aquaticus es infectado por la captación de huevos, donde se desarrollan tres estadios, 4) Acantor, 5) Acantela y 6) Cistacanto, finalmente cuando el huésped intermediario parasitado es ingerido por el huésped definitivo el ciclo de vida es completado. Tomado y modificado de: http://parasitology.informatik.uni wuerzburg.de/login/n/h/0008.html. 30 Literatura citada Agapow P. M., O. R. P. Bininda-Emonds, K. A. Crandall, J. L. Gittleman, G. M. Mace, J. C. Marshall y A. Purvis. 2004. The impact of species concept on biodiversity studies. The Quarterly Review of Biology, 79: 161–179. Almeida C. R. y F. V. de Abreu. 2003. Dynamical instabilities lead to sympatric speciation. Evolutionary Ecology Research, 5: 739–757. Amin O. M. y R. Heckmann. 2009. Description of Neoechinorhynchus (N.) buckneri n. sp. from the blacktailed redhorse Moxostoma poecilurum (Catostomidae) in the Tchoutacabouffa River, Mississippi, with a key to species of Neoechinorhynchus with different dorsoventral body wall thickness. Comparative Parasitology, 76: 154–161. Amin O. M. 1985. Classification. En: Crompton D. W. T. y B. B. Nickol (Editores). Biology of the Acanthocephala. Cambridge University Press, Londres. p. 27–72. Amin O. M. 2002. Revision of Neoechinorhynchus Stiles y Hassall, 1905 (Acanthocephala: Neoechinorhynchidae) with keys to 88 species in two subgenera. Systematic Parasitology, 53: 1–18. Amin O. M. 2013. Classification of the Acanthocephala. Folia Parasitologica, 60: 273–305. Avise J. C. 2000. Phylogeography: the history and formation of species. Harvard University Press, Cambridge, MA, EUA. p. 464. Avise J. C. 2004. Molecular markers, natural history and evolution. Second edition. Sinauer Associates, Inc. Publishers. Sunderland, Massachusetts. p. 684. Avise J. C., J. Arnold, R. M. Ball, E. Bermingham, T. Lamb, J. E. Niegel, C. A. Reeb y N. C. Saunders. 1987. Intraspecific phylogeography: the mitochondrial DNA bridge 31 between population genetics and systematics. Annual Review of Ecology and Systematics, 18: 489–522. Barger M. A., E. V. Thatcher y B. B. Nickol. 2004. A new species of Neoechinorhynchus (Acanthocephala: Neoechinorhynchidae) from a red-eared slider (Trachemys scripta elegans) in Mexico. Comparative Parasitology, 71: 1–3. Barluenga M. y A. Meyer. 2004. The Midas cichlid complex: incipient sympatric speciation in Nicaraguan cichlid fishes?. Molecular Ecology, 13: 2061–2076. Barluenga M., K. N. Stölting, W. Salzburger, M. Muschik y A. Meyer. 2006. Sympatric speciation in Nicaraguan crater lake cichlid fish. Nature, 439: 719–723. Barrett R. D. H. y D. Schluter. 2008. Adaptation from standing genetic variation. Trends in Ecology and Evolution, 23: 38–44. Baum D. A. y K. L. Shaw. 1995. Genealogical perspectives on the species problem. En: Hoch P. C. y A. G. Stephenson (editores). Molecular and experimental approaches to plant biosystematics. St. Louis: Missouri Botanical Garden. p. 289–303. Bensch S., J. Perez-Tris, J. Waldenstrom y O. Hellgren. 2004. Linkage between nuclear and mitochondrial DNA sequences in avian malaria parasites: multiple cases of cryptic speciation?. Evolution, 58: 1617–1621. Blasco-Costa I., A. Faltynková, S. Georgieva, K. Skírnisson, T. Scholz y A. Kostadinova. 2014. Fish pathogens near the Arctic Circle: molecular, morphological and ecological evidence for unexpected diversity of Diplostomum (Digenea: Diplostomidae) in Iceland. International Journal of Parasitology, 44: 703–715. Blouin M. S. 2002. Molecular prospecting for cryptic species of nematodes: mitochondrial DNA versus internal transcribed spacer. International Journal for Parasitology, 32: 527–531. 32 Bochkov A. V., P. B. Klimov, G. Hestvik y A. P. Saveljev. 2014. Integrated Bayesian species delimitation and morphological diagnostics of chorioptic mange mites (Acariformes: Psoroptidae: Chorioptes). Parasitology Research, 113: 2603–27. Bolnick D. I. y B. M. Fitzpatrick. 2007. Sympatric speciation: models and empirical evidence. Annual Review of Ecology, Evolution and Systematics, 38: 459–487. Bond J. E. y A. K. Stockman. 2008. An integrative method for delimiting cohesion species: Finding the population-species interface in a group of California trapdoor spiders with extreme genetic divergence and geographic structuring. Systematic Biology, 57: 628–646. Bray R. A., D. I. Gibson y A. Jones. 2008. Keys to the Trematoda Vol. III, CAB International Publishing. Brooks D. R. y D. A. McLennan. 1999. Species: turning a conundrum into a research program. Journal of Nematology, 31: 117–133. Brooks J. L. 1950. Speciation in ancient lakes. Quaterly Review of Biology, 25: 131–176. Brower A. V. Z. 1999. Delimitation of phylogenetic species with DNA sequences: a critique of Davis and Nixon’s population aggregation analysis. Systematic Biology, 48: 199–213. Brower A. V. Z. 2006. Problems with DNA barcodes for species delimitation: “Ten species” of Astraptes fulgerator reassessed (Lepidoptera: Hesperiidae). Systematic Biodiversity, 4: 127–132. Butlin R. K. 2010. Population genomics and speciation. Genetica, 138: 409–418. Camargo A., M. Morando, L. J. Avila y J. W. Sites Jr. 2012. Species delimitation with ABC and other coalescent-based methods: a test of accuracy with simulations and 33 an empirical example with lizards of the Liolaemus darwinii complex (Squamata: Liolaemidae). Evolution, 66: 2834–2849. Coyne J. y H. A. Orr. 2004. Speciation. Sinauer: Sunderland, Massachusetts. p. 545. Cummings M. P., M. C. Neel y K. L. Shaw. 2008. A genealogical approach to quantifying lineage divergence. Evolution, 62: 2411–2422. Dabert J., R. Ehrnsberger y M. Dabert. 2008. Glaucalges tytonis sp. n. (Analgoidea, Xolalgidae) from the barn owl Tyto alba (Strigiformes, Tytonidae): compiling morphology with DNA barcode data for taxon descriptions in mites (Acari). Zootaxa, 1719: 41–52. Darwin C. 1859. On the origin of species by means of natural selection, or the preservation of favoured races in the struggle for life. London: John Murray. Davis J. I., y K. C. Nixon. 1992. Populations, genetic variation, and the delimitation of phylogenetic species. Systematic Biology, 41: 421–435. DeQueiroz K. 1998. The general lineage concept of species, species criteria, and the process of speciation. En: D. J. Howard y S. H. Berlocher (editores). Endless Forms: species and speciation. Oxford University Press. p. 57–75. DeQueiroz K. 2007. Species concepts and species delimitation. Systematic Biology, 56: 879–886. Dettman J. R., D. J. Jacobson y J. W. Taylor. 2003. A multilocus genealogical approach to phylogenetic species recognition in the model eukaryote Neurospora. Evolution, 57: 2703–2720. Doyle J. 1995. The irrelevance of allele tree topologies for species delimitation, and a non- topological alternative. Systematic Botany, 20: 574–588. 34 Edwards S. V. 2009. Is a new and general theory of molecular systematics emerging?. Evolution, 63: 1–19. Eickbush T. M. y D. G. Eickbush. 2007. Finely orchestrated movements: evolution of the ribosomal RNA genes. Genetics, 175: 477–485. Elmer K. R., J. Davila y S. Lougheed. 2007. Cryptic diversity and deep divergence in an upper Amazonian leaflitter frog, Eleutherodactylus ockendeni. BMC Evolutionary Biology, 7: 1–14. Endler J. A. 1986. Natural Selection in the Wild. Princeton University Press. p. 354. Fernandez N., P. Theron y C. Rollard. 2013. The family Carabodidae (Acari: Oribatida) I. Description of a new genus, Bovicarabodes with three new species, and the redescription of Hardybodes mirabilis Balogh, 1970. International Journal of Acarology, 39: 26–57. Ferri E., M. Barbuto, O. Bain, A. Galimberti, S. Uni, R. Guerrero, H. Ferté, C. Bandi, C. Martin y M. Casiraghi. 2009. Integrated taxonomy: traditional approach and DNA barcoding for the identification of filarioid worms and related parasites (Nematoda). Frontiers in Zoology, 6: 1–12. Fitzpatrick B. M., J. A. Fordyce y S. Gavrilets. 2008. What, if anything, is sympatric speciation?. Journal of Evolutionary Biology, 21: 1452–1459. Flechmann C. H. y J. A. McMurtry. 2009. Studies of cheliceral and deutosternal morphology of some phytoseiidae (Acari: Mesostigmata) by scanning electron microscopy. Intternational Journal of Acarology, 18: 163–169. Frost D. E. y A. G. Kluge. 1994. A consideration of epistemology in systematic biology, with special reference to species. Cladistics, 10: 259–294. 35 Futuyma D. J. 1998. Evolutionary Biology. 3rd ed. Sinauer Associates, Sunderland, Massachusetts. p. 763. Futuyma D. J. y G. C. Mayer. 1980. Non-allopatric speciation in animals. Systematic Zoology, 29: 254–271. García-Prieto L., M. García-Varela, B. Mendoza-Garfias y G. Pérez-Ponce De León. 2010. Checklist of the Acanthocephala in wildlife vertebrates of Mexico. Zootaxa, 2419: 1–50. Georgieva S, A. Faltýnková, R. Brown, I. Blasco-Costa, M. Soldánová, J. Sitko, T. Scholz y A. Kostadinova. 2014. Echinostoma 'revolutum' (Digenea: Echinostomatidae) species complex revisited: species delimitation based on novel molecular and morphological data gathered in Europe. Parasites and Vectors, 7: 520. Gibson D. I., A. Jones y R. A. Bray. 2002. Keys to the Trematoda Vol. I, CAB Interntional Publishing. Godfray H. C. J. 2002. Challenges for taxonomy. Nature, 417: 17–19. Good D. A. y D. B. Wake. 1992. Geographic variation and speciation in the torrent salamanders of the genus Rhyacotriton (Caudata: Rhyacotritonidae). University of California Publications in Zoology, 126: 1–91. Grillo V., F. Jackson, J. Cabaret y J. S. Gilleard. 2007. Population genetic analysis of the ovine parasitic nematode Teladorsagia circumcincta and evidence for a cryptic species. International Journal for Parasitology, 37: 435–447. Guillot G., S. Renaud, R. Ledevin, J. Michaux y J. Claude. 2012. A unifying model for the analysis of phenotypic, genetic, and geographic data. Systematic Biology, 61:897– 911. 36 Hanzelova V., R. Kuchta y A. P. Shinn. 2005. Morphometric analysis of four species of Eubothrium (Cestoda: Pseudophyllidea) parasites of salmonid fish: an interspecific and intraspecific comparison. Parasitology Intertnational, 54: 207–214. Hausdorf B. y C. Hennig. 2010. Species delimitation using dominant and codominant multilocus markers. Systematic Biology, 59: 491–503. Hebert P. D., E. H. Penton, J. M. Burns, D. H. Janzen y W. Hallwachs. 2004. Ten species in one: DNA barcoding reveals cryptic species in the neotropical skipper butterfly Astraptes fulgerator. Proceedings of the National Academy of Sciences USA, 41: 14812–14817. Hebert P. D., A. Cywinska, S. L. Ball y J. R. de Waard. 2003. Biological identifications through DNA barcodes. Proceedings of the Royal Society of London B, 270: 313– 321. Herrmann K. K., R. Poulin, D. B. Keeney y I. Blasco-Costa. 2014. Genetic structure in a progenetic trematode: signs of cryptic species with contrasting reproductive strategies. International Journal of Parasitology, 44: 811–818. Hey J. y C. Pinho. 2012. Population genetics and objectivity in species diagnosis. Evolution, 66: 1413–1429. Hey J. y C. Machado. 2003. The study of structured populations- a new hope for a difficult and divide science. Nature Reviews Genetics, 4: 535–543. Hickerson M. J., C. Meyer, y C. Moritz. 2006. DNA barcoding will fail to discover new animal species over broad parameter space. Systematic Biology, 55: 729–739. Highton R. R. 1990. Taxonomic treatment of genetically differentiated populations. Herpetologica, 46: 114–121. 37 Holsinger K. E. 2010. Next generation population genetics and phylogeography. Molecular Ecology, 19: 2361–2363. Jin-Bo L., Y. X. Li, J. T. Sun, X. F. Xue, X. N. Xu y X. Y. Hong. 2013. COI barcoding as a molecular assay for the identification of phytoseiid mites. Systematic and Applied Acarology, 17: 15–25. Jones A., R. A. Brian y D. I. Gibson. 2005. Keys to the Trematoda Vol. II, CAB Interntional Publishing. Kawata M. y J. Yoshimura. 2000. Speciation by sexual selection in hybridizing populations without viability selection. Evolutionary Ecology Research, 2: 897–909. Keeler S. P., M. J. Yabsley, S. E. J. Gibbs, S. N. McGraw y S. M. Hernandez. 2012. A new Isospora species of passerines in the family Turdidae from Costa Rica. Journal of Parasitology, 98: 167–169. Kennedy C. R. 2006. Ecology of the Acanthocephala. Cambridge University Press. p. 249. Knapp S., A. Polaszek y M. Watson. 2007. Spreading the word. Nature, 446: 261–262. Knowles L. L. y B. C. Carstens. 2007. Delimiting species without monophyletic gene trees. Systematic Biology, 56: 887–895. Král’ová-Hromadová I., D. F. Tietz, A. P. Shinn y M. Špakulová. 2003. ITS rDNA sequences of Pomphorhynchus laevis (Zoega in Müller, 1776) and P. lucyi Williams & Rogers, 1984 (Acanthocephala: Palaeacanthocephala). Systematic Parasitology, 56: 141–145. Kubatko L. S., B. C. Carstens y L. L. Knowles. 2009. STEM: species tree estimation using maximum likelihood for gene trees under coalescence. Bioinformatics, 25: 971– 973. 38 Leaché A. D., M. S. Koo, C. L. Spencer, T. J. Papenfuss, R. N. Fisher y J. A. McGuire. 2009. Quantifying ecological, morphological, and genetic variation to delimit species in the coast horned lizard species complex (Phrynosoma). Proceedings of the National Academy of Sciences of the USA, 106: 12418–12423. Liebers D., P. de Knijff y A. Helbig. 2004. The herring gull complex is not a ring species. Proceedings of the Royal Society of London Series B-­‐Biological Sciences, 271: 893–901. Liu L. 2008. BEST: Bayesian estimation of species trees under the coalescent model. Bioinformatics, 24: 2542–2543. Locke S. A., M. Caffara, D. J. Marcogliese y M. L. Fioravanti. 2015a. A large-scale molecular survey of Clinostomum (Digenea, Clinostomidae). Zoologica Scripta, 44: 203–217. Locke S. A., F. S. Al-Nasiri, M. Caffara, F. Drago, M. Kalbe, A. R. Lapierre, J. D. McLaughlin, P. Nie, R. M. Overstreet, G. T. R. Souza, R. M. Tokemoto y D. J. Marcogliese. 2015b. Diversity, specificity and speciation in larval Diplostomidae (Platyhelminthes: Digenea) in the eyes of freshwater fish, as revealed by DNA barcodes. International Journal of Parasitology, 45: 841–855. López-Caballero J., A. Oceguera-Figueroa y V. León-Regagnon. 2013. Detection of multiple species of human Paragonimus from Mexico using morphological data and molecular barcodes. Molecular Ecology Resource, 13: 1125–1136. Luo H. Y., P. Nie, Y. A. Zhang, G. T. Wang y W. J. Yao. 2002. Molecular variation of Bothriocephalus acheilognathi Yamaguti, 1934 (Cestoda: Pseudophyllidae) in different fish host species based on ITS rDNA sequences. Systematic Parasitology, 52: 159–166. 39 Luo H. Y., P. Nie, Y. A. Zhang, W. J. Yao y G. T. Wang. 2003. Genetic differentiation in populations of the cestode Bothriocephalus acheilognathi (Cestoda: Pseudophyllidea) as revealed by eight microsatellite markers. Parasitology, 126: 493–501. Macnish M. G., U. M. Morgan-Ryan, P. T. Monis, J. M. Behnke y R. C. A. Thompson. 2002. A molecular phylogeny of nuclear and mitochondrial sequences in Hymenolepis nana (Cestoda) supports the existence of a cryptic species. Parasitology, 125: 567–575. Maddison W. P. 1997. Gene trees in species trees. Systematic Biology, 46: 523–536. Mallet J. 2007. Hybrid speciation. Nature, 446: 279–283. Mallet J. A. 1995. Species definition for the modern synthesis. Trends in Ecology and Evolution, 10: 294–299. Mallet J., A. Meyer, P. Nosil y J. L. Feder. 2009. Space, sympatry and speciation. Journal of Evolutionary Biology, 22: 2332–2341. Marques J. F., M. J. Santos, D. I. Gibson, H. N. Cabral y P. D. Olson. 2007. Cryptic species of Didymobothrium rudolphii (Cestoda: Spathebothriidae) from the sand sole, Solea lascaris, off the Portuguese coast, with an analysis of their molecules, morphology, ultrastructure and phylogeny. Parasitology, 134: 1057–1072. Marshall J. C., E. Arévalo, E. Benavides, J. L. Sites y Jr. JW. Sites. 2006. Delimiting species: comparing methods for Mendelian loci using lizards of the Sceloporus grammicus complex (Phrynosomatidae). Evolution, 60: 1050–1065. Martínez-Aquino A., F. S. Ceccarelli y G. Pérez-Ponce de León. 2013. Molecular phylogeny of the genus Margotrema (Digenea: Allocreadiidae), parasitic flatworms of goodeid freshwater fishes across central Mexico: species boundaries, 40 host-specificity, and geographical congruence. Zoological Journal of the Linnean Society, 168: 1–16. Martínez-Aquino A., M. E. Reyna-Fabián, R. Rosas-Valdez, U. Razo-Mendivil, G. Pérez- Ponce de León y M. García-Varela. 2009. Detecting a complex of cryptic species within Neoechinorhynchus golvani (Acanthocephala: Neoechinorhynchidae) inferred from ITS’s and LSU rDNA gene sequences. Journal of Parasitology, 95: 1040–1047. Mayden R. L. y R. M. Wood. 1995. Systematics, species concepts and the evolutionarily significant unit in biodiversity and conservation biology. American Fisheries Society Symposium Series, 17: 58–113. Mayr E. 1942. Systematics and the origin of species from the viewpoint of a zoologist. New York: Columbia University Press. Mayr E. 1982. The Growth of Biological Thought, Harvard University Press. Meier R., R. K. Shiyang, G. Vaidya y P. K. L. Ng. 2006. DNA barcoding and taxonomy in Diptera: A tale of high intraspecific variability and low identification success. Systematic Biology, 55: 715–728. Miura O., A. M. Kuris, M. E. Torchin, R. F. Hechinger, E. J. Dunham y S. Chiba. 2005. Molecular-genetic analyses reveal cryptic species of trematodes in the intertidal gastropod, Batillaria cumingi (Crosse). International Journal for Parasitology, 35: 793–801. Modry D., J. R. Slapeta y B. Koudela. 2000. Six new species of coccidia (Apicomplexa: Eimeriidae) from east african chameleons (Sauria: Chamaeleonidae). Journal of Parasitology, 86: 373–379. 41 Monks S. 2001. Phylogeny of the Acanthocephala based on morphological characters. Systematic Parasitology, 48: 81–116. Monks S., G. Pulido-Flores y J. Violante-González. 2011. A new species of Neoechinorhynchus (Acanthocephala: Neoechinorhynchidae) in Dormitator latifrons (Perciformes: Eleotridae) from the Pacific Coast of Mexico. Comparative Parasitology, 78: 21–8. Morando M., L. J. Avila y J. W. Sites Jr. 2003. Sampling strategies for delimiting species: Genes, individuals, and populations in the Liolaemus elongatus-kriegi complex (Squamata: Liolaemidae) in Andean-Patagonian South America. Systematic Biology, 52: 159–185. Moszczynska A., S. A. Locke, J. D. McLaughlin, D. Marcogliese y T. J. Crease. 2009. Development of primers for the mitochondrial cytochrome c oxidase I gene in digenetic trematodes (Platyhelminthes) illustrates the challenge of barcoding parasitic helminths. Molecular Ecology Resources, 9: 75–82. Near T. J., J. R. Garey y S. A. Nadler. 1998. Phylogenetic relationships of the Acanthocephala inferred from 18S ribosomal DNA sequences. Molecular Phylogenetics and Evolution, 10: 287–298. Nei M. 1987. Molecular Evolutionary Genetics. Columbia University Press, New York, USA. O'Meara B. C. 2010. New heursitic methods for joint species delimitation and species tree inference. Systematic Biology, 59: 59–73. Ogedengbe J. D., R. H. Hanner y J. R. Barta. 2011. DNA barcoding identifies Eimeria species and contributes to the phylogenetics of coccidian parasites (Eimeriorina, Apicomplexa, Alveolata). Intertnational Journal of Parasitogy, 41: 843–850. 42 Padial J. M. y I. de la Riva. 2006. Taxonomic inflation and the stability of species lists: The perils of ostrich’s behavior. Systematic Biology, 55: 859–867. Picca A., M. Helguera, N. Salomón y A. Carrera. 2002. Marcadores Moleculares. En: Echenique V., C. Rubinstein y L. Mroginski (Editores). Biotecnología y Mejoramiento Vegetal. p. 61–68. Pinacho-Pinacho C. D., G. Pérez-Ponce De León y M. García-Varela 2012. Description of a new species of Neoechinorhynchus (Acanthocephala: Neoechinorhynchidae) a parasite of Dormitator latifrons from Southwestern Mexico based on morphological and molecular characters. Parasitology International, 61: 634–644. Pons J., T. G. Barraclough, J. Gomez-Zurita, A. Cardoso, D. P. Duran, S. Hazell, S. Kamoun, W. D Sumlin y A. Vogler. 2006. Sequence-based species delimitation for the DNA taxonomy of undescribed insects. Systematic Biology, 55: 595–609. Porter A. H. 1990. Testing nominal species boundaries using gene flow statistics: taxonomy of two hybridizing admiral butterflies (Limenitis: Nymphalidae). Systematic Zoology, 39: 131–147. Portik D. M., Jr. P. L. Wood, J. L. Grismer, E. L. Stanley y T. R. Jackman. 2012. Identification of 104 rapidly evolving nuclear protein-coding markers for amplification across scaled reptiles using genomic resources. Conservation Genetics Resources, 4: 1–10. Poulton E. B. 1903. What is a species?. Transactions of the Entomological Society of London, 1903: 77–116. Puillandre N., A. Lambert, S. Brouillet y G. Achaz. 2012a. ABGD, Automatic Barcode Gap Discovery for primary species delimitation. Molecular Ecology, 21: 1864– 1877. 43 Puillandre N., M. V. Modica, Y. Zhang, L. Sirovich, M. C. Boisselier, C. Cruaud, M. Holford y S. Samadi. 2012b. Large-scale species delimitation method for hyperdiverse groups. Molecular Ecology, 21:2671–2691. Puorto G., M. G. Salomao, R. D. G. Theakston, R. S. Thorpe, D. A.Warrell y W.Wuster. 2001. Combining mitochondrial DNA sequences and morphological data to infer species boundaries: Phylogeography of lanceheaded pitvipers in the Brazilian Atlantic forest, and the status of Bothrops pradoi (Squamata: Serpentes: Viperidae). Journal of Evolutionary Biology, 14: 527–538. Ratnasingham S. y P. D. Hebert. 2013. A DNA-based registry or all animal species: the Barcode Index Number (BIN) system. PLoS ONE, 8: e66213. Raxworthy C., C. M. Ingram, N. Rabibisoa y R. G. Pearson. 2007. Applications of ecological niche modeling for species delimitation: A review and empirical evaluating using day geckos (Phelsuma) from Madagascar. Systematic Biology, 56: 907–923. Rentería-Alcántara M. 2007. Breve revisión de los marcadores moleculares. En: Eguiarte L. E., V. Souza y X. Aguirre (Editores). Ecología Molecular. Instituto Nacional de Ecología, México D.F. p. 541–566. Ripa J. 2009. When is sympatric speciation truly adaptive? An analysis of the joint evolution of resource utilization and assortative mating. Evolutionary Ecology, 23: 31–52. Salgado-Maldonado G. 2013. Redescription of Neoechinorhynchus (Neoechinorhynchus) golvani Salgado-Maldonado, 1978 (Acanthocephala: Neoechinorhynchidae) and description of a new species from freshwater cichlids (Teleostei: Cichlidae) in Mexico. Parasitology Research, 112: 1891–1901. 44 Schliewen U. K., K. Rassmann, M. Markmann, J. Markert, T. Kocher y D. Tautz. 2001. Genetic and ecological divergence of a monophyletic cichlid species pair under fully sympatric conditions in Lake Ejagham. Cameroon. Molecular Ecology, 10: 1471–1488. Schliewen U. K. y B. Klee. 2004. Reticulate sympatric speciation in Cameroonian crater lake cichlids. Frontiers in Zoology, 1: 1–12. Schmidt G. D. 1985. Development and life cycles. En: Crompton D. W. T. y B. B. Nickol. Biology of the Acanthocephala. Cambridge University Press, Londres. p. 273–305. Schmidt G. D. 1988. Essentials of parasitology. Wm. C. Brown Publisher. p. 298. Scoble M. J. 2004. Unitary or unified taxonomy?. Philosophical Transactions of the Royal Society B, 359: 699–710. Shaffer H. B. y R. C. Thomson. 2007. Delimiting species in recent radiations. Systematic Biology, 56: 896–906. Simpson G. G. 1961. Principles of Animal Taxonomy. Columbia Univ. Press. p. 247. Sites J.W. Jr. y J. C. Marshall. 2003. Delimiting species: a Renaissance issue in systematic biology. Trends in Ecology and Evolution, 18: 462–420. Smales L. R. 2013. A review of the genus Neoechinorhynchus (Acanthocephala: Neoechinorhynchidae) from Australia with the description of two new species. Journal of Parasitology, 99: 1106–1112 Smith H. M. 1955. The perspective of species. Turtox News, 33: 74–77. Steinauer M. L., B. B. Nickol y G. Ortí. 2007. Cryptic speciation and patterns of phenotypic variation of a highly variable acanthocephalan parasite. Molecular Ecology, 16: 4097–4109. 45 Stelkens R. B., C. Schmid, O. Selz y O. Seehausen 2009. Phenotypic novelty in experimental hybrids is predicted by the genetic distance between species of Cichlid fish. BMC Evolutionary Biology, 9: 1–13. Tautz D., H. Ellegren y D. Weigel. 2010. Next generation molecular ecology. Trends in Ecology and Evolution, 19: 1–3. Tautz D., P. Arctander, A. Minelli, R. H. Thomas y A. P. Vogler. 2003. A plea for DNA taxonomy. Trends Ecology and Evolution, 18: 70–74. Templeton A. R., E. Routman y C. A. Phillips. 1995. Separating population structure from history: a cladistic analysis of the geographical distribution of mitochondrial DNA haplotype in the tiger salamander, Ambystoma tigrinum. Genetics, 140: 767–782. Templeton A. R. 2001. Using phylogeographic analyses of gene trees to test species status and boundaries. Molecular Ecology, 10: 779–791. Thomson R. C., I. J. Wang y J. R. Johnson. 2010. Genome-enabled development of DNA markers for ecology, evolution and conservation. Molecular Ecology, 19: 2184– 2195. Van Doorn G. S., P. Edelaar y F. J. Weissing. 2009. On the origin of species by natural and sexual selection. Science, 326: 1704–1707. Vázquez-Domínguez E. 2007. Filogeografia y vertebrados. En: Eguiarte L. E., V. Souza y X. Aguirre (Editores). Ecología Molecular. Instituto Nacional de Ecología, México D.F. p. 441–466. Vázquez-Domínguez E. 2009. Avances metodológicos para el estudio conjunto de la información genética, genealógica y geográfica en análisis evolutivos y de distribución. Revista Chilena de Historia Natural, 82: 277–297. 46 Vilas R., C. D. Criscione y M. S. Blouin. 2005. A comparison between mitochondrial DNA and the ribosomal internal transcribed regions in prospecting for cryptic species of platyhelminth parasites. Parasitology, 131: 1–8. Wiens J. J. y T. A. Penkrot. 2002. Species delimitation in systematics: inferring diagnostic differences between species. Proceedings of the Royal Society of London, Series B, 267: 631–636. Wiens, J. J. 1999. Polymorphism in systematics and comparative biology. Annual Review of Ecology, Evolution, and Systematics, 30: 327–362. Will K. W., B. D. Mishler y Q. D. Wheeler. 2005. The perils of DNA barcoding and the need for integrative taxonomy. Systematic Biology, 54: 844–851. Wolf J. B. W., J., Lindell y N. Backstrom. 2010. Speciation genetics: current status and evolving approaches introduction. Philosophical Transactions of the Royal Society Biological Sciences, 365: 1717-1733. Yang Z. y B. Rannala. 2010. Bayesian species delimitation using multilocus sequence data. Proceedings of the National Academy of Sciences of the USA, 107: 9264–9269. 47 2. OBJETIVOS 48 2.1. Objetivo general • Delimitar las especies del género Neoechinorhynchus distribuidas en México y Centroamérica empleando secuencias de genes mitocondriales, citocromo oxidasa subunidad 1 (COI) y genes del DNA nuclear ribosomal (ITS1, 5.8S, ITS2 y los dominios D2+D3 del 28S), así como caracteres morfológicos y ecológicos. 2.1.1. Objetivos particulares • Estimar la divergencia genética intra e interpoblacional de las especies del género Neoechinorhynchus con genes mitocondriales y nucleares. • Inferir las relaciones filogenéticas del género Neoechinorhynchus. • Conocer los patrones filogeográficos de Neoechinorhynchus brentnickoli y Neoechinorhynchus golvani utilizando secuencias de genes mitocondriales y nucleares. • Evaluar la diferenciación morfológica entre las especies de Neoechinorhynchus que se distribuyen en México y Centroamérica mediante análisis de componentes principales (PCA) y análisis discriminantes (DFA). • Evaluar las hipótesis taxómicas, incluyendo la descripción de nuevos taxones. 49 3. ARTÍCULOS DE INVESTIGACIÓN 50 3. 1. Artículo I Description of a new species of Neoechinorhynchus (Acanthocephala: Neoechinorhynchidae) a parasite of Dormitator latifrons from Southwestern Mexico based on morphological and molecular characters Carlos Daniel Pinacho-Pinacho, Gerardo Pérez-Ponce de León, Martín García-Varela Parasitology International (2012) 61: 634–644 51 Description of a new species of Neoechinorhynchus (Acanthocephala: Neoechinorhynchidae) a parasite of Dormitator latifrons from Southwestern Mexico based on morphological and molecular characters Carlos Daniel Pinacho-Pinacho, Gerardo Pérez-Ponce de León, Martín García-Varela ⁎ Departamento de Zoología, Instituto de Biología, Universidad Nacional Autónoma de México, A. P. 70‐153, C.P. 04510, México D.F., Mexico a b s t r a c ta r t i c l e i n f o Article history: Received 8 November 2011 Received in revised form 13 June 2012 Accepted 18 June 2012 Available online 23 June 2012 Keywords: Acanthocephala Neoechinorhynchus mamesi n. sp. Dormitator latifrons Cox 1 LSU Phylogeny Haplotype network Mexico Neoechinorhynchus mamesi n. sp. is described from the estuarine fish Dormitator latifrons collected in 3 local- ities along the coast of Chiapas State in Southwestern Mexico. The new species is characterized by possessing a small trunk, a very small proboscis with relatively very long apical proboscis hooks and small middle and posterior hooks, 2 giant nuclei in the ventral body wall, and males with testes smaller than the cement gland. A multivariate analysis of variance (MANOVA) and a Principal Component Analysis (PCA) of 46 mor- phometric traits for 21 mature females and 18 males of N. mamesi n. sp., N. brentnickoli and N. golvani, re- vealed morphological variation among species. DNA sequences of 2 genes, cytochrome oxidase subunit 1 (cox 1) of the mitochondrial DNA and the domains D2 and D3 of the large subunit of the nuclear ribosomal RNA (LSU) were used to corroborate the morphological distinction. The genetic divergence estimated among populations of N. brentnickoli and N. mamesi n. sp. ranged from 10.14 to 10.55% for LSU and from 20.53 to 22.06% for cox 1, whereas the genetic divergence between N. golvani and N. mamesi n. sp. ranged from 20.31 to 21.03% for LSU and from 22.24 to 24.95% for cox 1. Maximum likelihood, maximum parsimony and Bayesian inference analyses were performed for the combined data sets (LSU+cox 1) and each data set alone. All the phylogenetic analyses showed that the specimens from3 coastal lagoons of Chiapas State in South- western Mexico represented a monophyletic clade with strong bootstrap support and Bayesian posterior prob- abilities. The haplotype network based on the analysis of the cox 1 sequences indicated that N. mamesi n. sp. is separated by 84 substitutions from N. brentnickoli, and with 69 substitutions from N. golvani. The morphological evidence, the multivariate analyses, in combination with the genetic divergence estimated with two genes, the reciprocal monophyly in all the phylogenetic analyses, and the haplotype network, suggested that the acantho- cephalans found in the intestine of D. latifrons in Southwestern Mexico represent a new species, named N. mamesi n. sp., and it constitutes the second species of the genus Neoechinorhynchus associated with the Pacific fat sleeper along the Pacific Coast of Mexico. © 2012 Published by Elsevier Ireland Ltd. 1. Introduction Neoechinorhynchus Stiles and Hassall, 1905 is one of the most diverse genera within Acanthocephala with approximately 101 described species [1–8]. All these species are characterized by possessing a small globular or sub-cylindrical proboscis, armed with 3 circles of 6 hooks each, a single-walled proboscis receptacle and a cerebral ganglion located at the base of proboscis receptacle, males possessing 2 spherical to oblique testes, equatorial or post-equatorial, a single syncytial cement gland, genital pore termi- nal in both sexes or sub-terminal in females, and oval eggs, elliptical or elongate, with concentric shells or with polar prolongation of fer- tilization membrane [2]. In Mexico, 6 species of the genusNeoechinorhynchus have been de- scribed, 2 of these occur in freshwater turtles, i.e., N. schmidti Barger, Thatcher and Nickol, 2004 and N. emyditoides Fisher, 1960, and the other 4 species occur in marine, brackish and freshwater fishes, i.e., N. roseus Salgado-Maldonado, 1978, N. golvani, Salgado-Maldonado, 1978, N. chimalapasensis Salgado-Maldonado, Caspeta-Mandujano and Martínez-Ramírez, 2010, and N. brentnickoli Monks, Pulido-Flores and Violante-González, 2011 [7,9,10]. Recently, molecu- lar and morphological data revealed that the acanthocephalan N. golvani actually comprises a complex of cryptic species [9]. One line- age corresponded with N. golvani sensu stricto and is associated with cichlid fishes in strictly freshwater environments. Another two lineages are distributed in brackish water systems along the Gulf of Mexico and Pacific Sea slopes, and are associated with eleotrid fishes, i.e., Dormitator maculatus and Dormitator latifrons, respectively [9]. A Parasitology International 61 (2012) 634–644 ⁎ Corresponding author at: Departamento de Zoología, Instituto de Biología, UNAM, 04510, México D.F., Mexico. Tel.:+52 5 56229130; fax: +52 5 5550 0164. E-mail addresses: danyboy_jd26@hotmail.com (C.D. Pinacho-Pinacho), ppdleon@ibunam2.ibiologia.unam.mx (G. Pérez-Ponce de León), garciav@servidor.unam.mx (M. García-Varela). 1383-5769/$ – see front matter © 2012 Published by Elsevier Ireland Ltd. doi:10.1016/j.parint.2012.06.006 Contents lists available at SciVerse ScienceDirect Parasitology International j ourna l homepage: www.e lsev ie r .com/ locate /par in t 52 Table 1 Specimen information, collection sites (CS), sample number, species analyzed, specimen analyzed (N), host species, locality name, geographical coordinates, GenBank accession number, and catalog number (CNHE) for specimens studied in this work. Sequences marked with an asterisk were obtained in the current study. Nd = not determined. The sample number for each locality corresponds with the same number in Figs. 1, 4 and 5. CS Sample Species N Host Locality/sampling date Coordinates GenBank Specimens deposited (CNHE) North West Cox 1 LSU 1 1–5 N. mamesi n. sp. 5 Dormitator latifrons Rion Pijijiapan Lagoon, Chiapas/June, 2010 15° 31′ 54.3″ 93° 09′ 39.4″ JN830787* JN830788* JN830789* JN830790* JN830791* JN830763* JN830764* JN830765* 8180, 8181, 8182 2 6–10 N. mamesi n. sp. 5 Dormitator latifrons La Conquista Lagoon, Chiapas/June, 2010 15° 40′ 00.20″ 93° 24′ 51.61″ JN830792* JN830793* JN830794* JN830795* JN830796* JN830766* JN830767* JN830768* JN830769* 8184 3 11–15 N. mamesi n. sp. 5 Dormitator latifrons Joaquín Amaro Estuary, Chiapas/June, 2010 15° 46′ 16.19″ 93° 24′ 30.11″ JN830797* JN830798* JN830799* JN830800* JN830801* JN830770* JN830771* JN830772* JN830773* JN830774* 8183 4 16–20 N. brentnickoli 5 Dormitator latifrons Tamarindo River, Guerrero/June, 2010 16° 38′ 07.5″ 99° 08′ 26.4″ JN830802* JN830803* JN830804* JN830805* JN830806* 8179 5 21–28 N. brentnickoli 8 Dormitator latifrons Tres Palos Lagoon, Guerrero/September, 2008 16° 48′ 00″ 99° 47′ 00″ JN830807* JN830808* JN830809* JN830810* JN830811* JN830812* JN830813* JN830814* FJ968157 FJ968156 FJ968158 FJ968159 FJ388991 8178 6 29–33 N. brentnickoli 5 Dormitator latifrons Coyuca Lagoon, Guerrero/September, 2008 16° 57′ 00″ 100° 02′ 00″ JN830815* JN830816* JN830817* JN830818* JN830819* JN830775* JN830776* 8175 7 34–38 N. brentnickoli 5 Dormitator latifrons Barra de Pichi Estuary, Michoacán/July, 2010 17° 58′ 41.5″ 102° 19′ 30.0″ JN830820* JN830821* JN830822* JN830823* JN830824* 8174 8 39–43 N. brentnickoli 5 Dormitator latifrons Mexcalhuacan Estuary, Michoacán/June, 2010 18° 03′ 21.5″ 102° 39′ 29.8″ JN830825* JN830826* JN830827* JN830828* JN830829* JN830777* JN830778* JN830779* JN830780* JN830781* 8173 9 44–48 N. brentnickoli 5 Dormitator latifrons Huahua Estuary, Michoacán/July, 2010 18° 10′ 39.7″ 103° 00′ 26.3″ JN830830* JN830831* JN830832* JN830833* JN830834* 8177 10 49–58 N. brentnickoli 10 Dormitator latifrons Boca de Apiza Estuary, Michoacán/July, 2010 18° 41′ 14.46″ 103° 44′ 04.96″ JN830835* JN830836* JN830837* JN830838* JN830839* JN830840* JN830841* JN830842* JN830843* JN830844* JN830782* JN830783* JN830784* JN830785* JN830786* 8176 11 59–63 N. brentnickoli 5 Dormitator latifrons Cuyutlan Lagoon, Colima/October, 2010 19° 02′ 58.6″ 104° 15′ 58.2″ JN830845* JN830846* JN830847* JN830848* JN830849* 12 64–66 N. golvani 3 Paraneetroplus fenestratus Catemaco Lake, Veracruz/June, 2006 18° 25′ 95° 07′ JN830850* JN830851* JN830852* FJ388986 FJ968145 FJ968146 601, 603, 604, 606, 631, 632 13 67–69 N. golvani 3 Cichlasoma pearsei Nezahualcoyolt Dam, Chiapas/June, 2007 17° 10′ 49″ 93° 36′ 49″ JN830853* JN830854* JN830855* FJ388996 FJ968141 FJ968142 6756 14 70–72 N. golvani 3 Cichlasoma pearsei Chicoasen Dam, Chiapas/June, 2007 16° 56′ 02″ 93° 05′ 16″ JN830856* JN830857* JN830858* FJ388995 FJ968136 6755 (continued on next page) 635C.D. Pinacho-Pinacho et al. / Parasitology International 61 (2012) 634–644 53 morphological analysis of the specimens of Neoechinorhynchus associ- ated with the fish D. latifrons from a few localities along the Pacific Sea slope, allowed authors to describe one of the allegedly cryptic species (so-called lineage 3), as N. brentnickoli [7]. A thorough sampling of the eleotrid host (D. latifrons) in coastal la- goons along Southwestern Mexico (from Chiapas, northwards to Co- lima State) allowed us to detect the presence of an undescribed species of Neoechinorhynchus. In the current study we describe the new species by using both morphological and molecular evidence. 2. Materials and methods 2.1. Specimen collection Adult acanthocephalans were collected from the intestines of their definitive hosts from 19 localities in Mexico (Table 1; Fig. 1). Fish were examined for parasites immediately after their capture. The acanthocephalans recovered were placed in distilled water to relax the specimens for 10–12h at 4°C. Later, all the specimens were pre- served in 100% ethanol, and stored at 4°C. For taxonomic identifica- tion, some specimens were stained with Mayer's paracarmine, dehydrated in a graded ethanol series, cleared with methyl salicylate, and mounted on permanent slides with Canada balsam, and were deposited in the Colección Nacional de Helmintos (CNHE), Instituto de Biología, Universidad Nacional Autónoma de México, Mexico City, (Table 1). The acanthocephalans collected in this study were assigned to genus Neoechinorhynchus and were compared with type-specimens of other congeners, deposited at the CNHE as follows: N. chimalapasensis (holotype CNHE-5018, allotype CNHE-5019, 12 paratypes CNHE-5020); N. golvani (CNHE-0603); N. roseus (holotype CNHE-633, CNHE-634 paratypes) and N. brentnickoli (holotype CNHE-7537, allotype CNHE-7538, paratypes CNHE-7539–7540). 2.2. Morphological analyses The specimens collected in this study were initially identified as N. brentnickoli, N. golvani, N. roseus, and Neoechinorhynchus sp., and were drawn with the aid of a drawing tube attached to the microscope. Measurements of the trunk, proboscis hooks, proboscis receptacle, lemnisci, uterine bell, vagina, testes, and cement gland were taken from sexually mature specimens with the use of a light microscope. Measurements are given in micrometers (μm); for all morphological traits of the new species, ranges are given, followed in parentheses by mean values±standard deviation, and sample size (n). Measure- ments and drawings of eggs were made from fully developed eggs measured in situ through the body wall of female worms. Table 1 (continued) CS Sample Species N Host Locality/sampling date Coordinates GenBank Specimens deposited (CNHE) North West Cox 1 LSU FJ968137 FJ968138 15 73–75 N. golvani 3 Cichlasoma urophthalmum Ilusiones Lake, Tabasco/June, 2006 17° 58′ 46″ 92° 56′ 17″ JN830859* JN830860* FJ388992 FJ968143 FJ968144 16 76–78 N. golvani 3 Cichlasoma urophthalmum Carrizal River, Tabasco/June, 2006 18° 1′ 45″ 92° 55′ 00″ JN830861* JN830862* JN830863* FJ388993 FJ968134 FJ968135 6754 17 79–81 N. golvani 3 Parachromis friedrichsthalii Canitzan Lake, Tabasco/June, 2007 17° 28′ 57″ 91° 25′ 27″ JN830864* JN830865* JN830866* FJ388994 FJ968139 FJ968140 6757 18 82 N. roseus 1 Citharichthys gilberti Tovara Estuary, Nayarit/October, 2007 21° 31′ 37″ 105° 29′ 14″ JN830867* FJ389000 6763 19 83 N. roseus 1 Achirus mazatlanus Caimanero Estuary, Sinaloa/June, 2007 25° 36′ 30″ 108° 26′ 25″ JN830868* FJ388999 6762 20 84 N. saginatus 1 Nd Nd Nd Nd DQ089704 AY829091 1000 0 1000 Kilometers N EW S -115 -110 -105 -100 -95 -90 15 20 25 30 12 3 456 789 10 11 12 1413 15 16 17 18 19 Fig. 1. Sampling sites of specimens of Neoechinorhynchus mamesi n. sp. and the other 4 congeneric species reported fromMexico. Collection sites are numbered according to Table 1. The asterisk indicates localities where Pacific fat sleeper fishes were studied but negative of the infection. 636 C.D. Pinacho-Pinacho et al. / Parasitology International 61 (2012) 634–644 54 2.3. Multivariate analysis We used 46 morphometric traits, 35 for males and 37 for females (Table 2). Equality of variances among groups was examined using F test. We performed a multivariate analysis of variance (MANOVA) using Scheffé's F procedure for post hoc comparisons, because it is ro- bust to violations of assumptions inherent in multiple comparison procedures (e.g., the assumption of homogeneity of variances). In ad- dition, Principal Component Analysis (PCA) was implemented to ex- plore and describe patterns of variation of our data. For both analyses 8 females and 6 males of N. brentnickoli (holotype CNHE-7537, allotype CNHE-7538, paratypes CNHE-7539–7540), 8 females and 8 males of Neoechinorhynchus mamesi n. sp. (holotype CNHE: No. 8180; allotype CNHE: No. 8181; paratypes CNHE: No. 8182–8184) and 5 females and 2 males of N. golvani (CNHE-0603) were selected. The MANOVA and PCA analyses were conducted with the software STATISTICA version 7.1 [11]. 2.4. Amplification and sequencing of DNA Eighty three acanthocephalans from 19 populations were digested overnight at 56°C in a solution containing 10mM Tris–HCl (pH 7.6), 20mM NaCl, 100mM Na2 EDTA (pH 8.0), 1% Sarkosyl, and 0.1mg/ml proteinase K. Following digestion, DNA was extracted from the super- natant using the DNAzol reagent (Molecular Research Center, Cincin- nati, OH) according to themanufacturer's instructions. The two genes; cox 1 and LSU were amplified using the polymerase chain reaction (PCR). A fragment of the mitochondrial DNA cox 1, was amplified using the forward 5′-AGTTCTAATCATAA(R)GATAT(Y)GG-3′ and the reverse primer 5′‐TAAACTTCAGGGTGACCAAAAAATCA-3′. However, specific primers were designed for each species of Neoechinorhynchus (Table 3). The domains D2+D3 from LSU rDNA were amplified using the forward primer 5′ CAAGTACCGTGAGGGAAAGTTGC 3′ and the re- verse primer 5′ GTCGATAGGACTCCCTTTG 3′ [12]. PCR reactions (25μl) consisted of 10μMof each primer, 2.5μl of 10× buffer, 2mM MgCl2, and 1U of Taq DNA polymerase (Platinum Taq, Invitrogen Corporation, São Paulo, Brazil). PCR cycling parameters for rDNA amplifications included denaturation at 94°C for 1min, followed by 35cycles of 94°C for 1min, annealing at 50°C for 1min, and exten- sion at 72°C for 1min, followed by a post-amplification incubation at 72°C for 10min. PCR cycling conditions for the cox 1 amplifications in- cluded denaturation at 94°C for 5min, followed by 35cycles of 94°C for 1min, annealing at 40–50°C for each species of Neoechinorhynchus (Table 3) for 1min, and extension at 72°C for 1min, followed by a post-amplification incubation at 72°C for 10min. Sequencing reactions were performed using ABI Big Dye (Applied Biosystems, Boston, MA) terminator sequencing chemistry, and reaction products were separat- ed and detected using an ABI 3730 capillary DNA sequencer. Contigs were assembled and base-calling differences resolved using Codoncode Aligner version 3.5.4 (Codoncode Corporation, Dedham, MA). Se- quences were deposited in the GenBank data set (Table 1). 2.5. Alignments and phylogenetic analyses Sequences obtained in the current research from LSU and cox 1 were aligned separately using the software Clustal W [13] and adjust- ed manually with MacClade program [14]. Maximum parsimony (MP), maximum likelihood (ML) and Bayesian inference analyses were performed for each data set and the combined data sets (LSU+cox 1). The MP tree was inferred using the program PAUP*4.0b10 [15]. The ML tree was inferred using RAxML 7.0.4., for each and combined data sets [16]. The Modeltest program version 3.0 [17] was used for inferring the best model of evolution for all Table 2 Factor loadings for the first and second Principal Component Analysis (PCA) for females and males of N. mamesi n. sp., N. brentnickoli and N. golvani. Values greater than 0.50 in absolute value are considered significant and are shown in bold for emphasis. PCA 1 PCA 2 Females Males Females Males Body length −0.957 −0.959 0.164 −0.150 Body width −0.778 −0.910 −0.049 0.214 Apical hooks Dorsal hooks length 0.557 0.378 0.223 −0.301 Dorsal hooks width 0.059 0.140 0.278 −0.226 Roots length 0.503 0.262 0.325 −0.742 Roots width −0.008 0.320 −0.701 0.377 Lateral hooks length 0.806 0.662 0.268 0.180 Lateral hooks width 0.662 0.427 0.185 0.513 Ventral hooks length 0.622 0.577 0.400 −0.226 Ventral hooks width 0.192 0.422 0.531 0.233 Middle hooks Length 0.187 −0.313 0.875 −0.615 Width −0.416 0.020 0.227 0.119 Posterior hooks Length 0.519 0.535 0.522 −0.670 Width 0.018 −0.007 0.645 −0.471 Proboscis length −0.342 −0.387 0.660 −0.717 Proboscis width −0.594 −0.108 0.344 0.187 Neck length −0.263 −0.550 0.232 −0.104 Neck width −0.764 −0.244 0.144 0.226 Trunk length −0.952 −0.960 0.181 −0.123 Trunk width −0.778 −0.910 −0.049 0.214 Proboscis receptacle length −0.618 −0.371 −0.205 0.396 Proboscis receptacle width −0.675 −0.718 0.276 0.081 Longer lemniscus length −0.926 −0.751 0.067 0.032 Longer lemniscus width −0.855 −0.771 0.213 −0.117 Shorter lemniscus length −0.935 −0.738 0.060 0.006 Shorter lemniscus width −0.751 −0.823 0.219 −0.049 Anterior testis length −0.706 −0.054 Anterior testis width −0.925 0.115 Posterior testis length −0.926 −0.319 Posterior testis width −0.955 0.011 Cement gland length −0.935 −0.077 Cement gland width −0.915 0.122 Reproductive system length in males −0.935 −0.257 Seminal vesicle length −0.341 0.569 Seminal vesicle width −0.289 0.631 Reproductive system length in females −0.787 −0.097 Uterine bell length −0.764 −0.256 Uterine bell width −0.853 0.075 Uterus length −0.552 0.521 Uterus width −0.159 −0.374 Vagina length −0.277 −0.388 Vagina width −0.447 0.111 Genital pore length −0.315 −0.557 Genital pore width −0.633 0.051 Eggs length −0.247 0.607 Eggs width −0.260 0.009 Table 3 Primer sequence information. Locus Species Primer name Primer sequence (5′–3′) Tm Cox 1 N. mamesi n. sp. N. roseus 509F This study 510R This study AGTTCTAATCATAA(R)GATAT(Y)GG TAAACTTCAGGGTGACCAAAAAATCA 42°C N. brentnickoli 520F This study GTGTGAGGAGGGTTAGTTGG 50°C 521R This study AAAGATAATTGTTCTAATTTTAGG N. golvani 512F This study GGGTTTGTATAACATRGTTG 40°C 513R This study TTAAAATTTCGATCTAACAA LSU 502F (García-Varela and Nadler, 2005) CAAGTACCGTGAGGGAAAGTTGC 50°C 536R (García-Varela and Nadler, 2005) GTCGATAGGACTCCCTTTG 637C.D. Pinacho-Pinacho et al. / Parasitology International 61 (2012) 634–644 55 the data sets (Table 4). Tree searches were performed using 1000 (MP) random taxon addition heuristic searches. Clade support was assessed by bootstrap resampling with 10,000 replicates by MP and ML trees. Additionally, Bayesian analyses were performed with the program MRBAYES version 3.1.2 [18]. The settings were 2 simulta- neous runs of the Markov chain Monte Carlo (MCMC) for 10million generations, sampling every 200 generations, a heating parameter value of 0.2 and a ‘burn-in’ of 10%. Trees were drawn using FigTree program version 1.3.1 [19]. 2.6. Haplotype network construction Gene genealogies were inferred using two approaches for haplotype network construction. Median-joining networks were calculated with the program NETWORK version 4.2.0.1 (www.fluxusengineering.com) keeping the parameter ε=0 [20]. This method starts with minimum spanning trees combined within a single network and then, to reduce tree length,median vectors (consensus sequences) are added. Suchvec- tors can be interpreted as possibly extant unsampled sequences or ex- tinct ancestral sequence [20]. In addition, TCS program version 1.21 [21]was employed to infer the haplotypenetworks using statistical par- simony [22] with a confidence of 95%. 3. Results 3.1. Morphological description 3.1.1. N. mamesi n. sp. (Fig. 2) Description based on 21 specimens (10 males and 11 females). Trunk cylindrical swollen in anterior region, slender in posterior re- gion (Fig. 2: A, B). Trunk with a thick wall in both dorsal and ventral sides, containing 5 dorsal giant subcuticular nuclei and 2 ventral nu- clei (n=21). Proboscis wider than long, bearing 3 circular rows each of 6 hooks (n=21) (Fig. 2: C). Apical hooks with strong roots. Apical, middle, posterior hooks are similar in size in both sexes (Table 5). Small sensory papillae located near the neck (Fig. 2: C). Neck wider than long. Proboscis receptacle attached to the junction of the neck with the trunk. Cerebral ganglion triangular, slightly con- spicuous. Binucleate lemniscus shorter than uninucleate lemniscus. Both lemnisci extend beyond the proboscis receptacle. Lemnisci nu- clei are ovoid and fragmented in some specimens (Fig. 2: D). Striated ligament sac connected to the uterine bell in females. Uterine bell narrow at anterior opening, vagina elongate, wide at posterior end. Females with one pair of muscle bands attached ventrally at genital pore, extending to dorsal body wall (Fig. 2: E). Testes oval, tandem, overlapping (Fig. 2: A), posterior testis overlapping cement gland (Fig. 2: A). Anterior testis slightly larger than the posterior. Efferent ducts connecting each testis with each seminal gland. Seminal gland oval, possessing an ejaculatory duct. Single cement gland with 8 unfragmented nuclei. Reservoir of the cement gland located behind the cement gland. Saefftingen's pouch located immediately posterior to cement gland. Genital pore ventral in both sexes. Mature eggs oval, without elongation of fertilization membranes. Eggs measured through body wall 22–25 (23±1, n=6) long, 6–9 (7±1, n=6) wide (Fig. 2: F). Male (Fig. 2: A, D): body 1230–2360 (1993±470, n=9) long, 430–820 (641±132, n=9) wide. Trunk 1165–2284 (1847±500, n=7) long, 430–820 (637±141, n=8) wide. Proboscis 26–44 (36±6, n=8) long, 50–150 (68±30, n=9) wide. Proboscis hooks in anterior circle, dorsal hooks 38–52 (45±5, n=8) long, 7–9 (8± 0.8, n=8) wide at base, root of dorsal hooks 20–23 (21±1, n=5) long, 6–8 (7±0.7, n=5) wide; lateral hooks 38–53 (44±5, n=7) long, 8–9 (8±0.4, n=7) wide at base, root of lateral hooks 22 (22±0, n=2) long, 8 (8±0, n=2) wide; ventral hooks 40–52 (45±4, n=7) long, 8–9 (8±0.8, n=7) wide at base, root of ventral hooks 23–23 (23±0, n=2) long, 7 (7±0, n=2) wide. Hooks of mid- dle circle 12–17 (14±1, n=27) long, 4–9 (4±1, n=27) wide; poste- rior circle 13–17 (15±1, n=24) long, 3–9 (4±0.6, n=24) wide. Neck 18–40 (30±7, n=9) long, 55–212 (82±49, n=9) wide. Pro- boscis receptacle 205–275 (241±21, n=10) long, 5–8 (6±10, n= 10) wide. Longer lemniscus 235–500 (405±87, n=10) long, 30–87 (59±21, n=10) wide; shorter lemniscus 167–470 (366±95, n= 10) long, 20–100 (55±24, n=10) wide. Reproductive system almost fully occupies posterior 2/3 of body length, 750–1830 (1386±414, n=9) long. Anterior testis 177–660 (419±160, n=9) long, 155–400 (310±94, n=9) wide. Posterior testis 152–440 (317± Table 4 Tree statistics for LSU and cox 1, and combined (LSU+cox 1) data sets. Number of informative characters, C.I., and tree length refer to parsimony inference. Pinv (proportion of in- variable sites), Gd (shape of gamma distribution), −ln likelihood refers to maximum likelihood inference and Akaike Information Criterion (AIC) model inferred with Modeltest program. Data set Total characters Uninformative characters Constant characters Informative characters C.I. Tree length −ln likelihood Pinv Gd Model AIC Cox 1 538 30 290 218 0.78 463 2582.838973 0.3598 0.7024 TVM+I+G LSU 754 64 379 311 0.89 567 3207.672566 0.4101 0 TVM+I cox 1+LSU 1292 94 669 529 0.84 1027 7427.997809 0.1933 0.6046 K81uf+I+G Fig. 2. Neoechinorhynchus mamesi n. sp. A. Male (holotype). B. Female (allotype). C. Pro- boscis of (allotype). D. Anterior region of the male. E. Posterior region of the female. F. Eggs (paratypes). 638 C.D. Pinacho-Pinacho et al. / Parasitology International 61 (2012) 634–644 56 109, n=8) long, 167–430 (325±93, n=8) wide. Seminal vesicle 62–425 (187±115, n=7) long, 10–600 (156±185, n=8) wide. Ce- ment gland 115–580 (343±188, n=10) long, 165–450 (310±114, n=10) wide. Copulatory bursa opens terminally 57–130 (104±40, n=3) long, 57–117 (83±30, n=3) wide, which was measured with- in the trunk. Female (Fig. 2: B, C, E, F): body 1450–3620 (2323±859, n=7) long, 350–1110 (746±252, n=10) wide. Trunk 1383–3542 (2414±717, n=11) long, 350–1110 (746±252, n=10) wide. Pro- boscis 26–58 (47±10, n=8) long, 60–71 (66±4, n=8) wide. Pro- boscis hooks in anterior circle, dorsal hooks 35–54 (46±6, n=8) long, 8–10 (8±0.6, n=8) wide at base, root of dorsal hooks 22–25 (23±1, n=7) long, 7–9 (8±0.6, n=7) wide; lateral hooks 37–54 (44±5, n=8) long, 7–9 (8±0.5, n=8) wide at base, root of lateral hooks 23 (23±0, n=2) long, 8 (8±0, n=2) wide; ventral hooks 37–55 (45±5, n=8) long, 8–9 (8±0.4, n=8) wide at base, root of ventral hooks 22–23 (22±0.5, n=3) long, 7–8 (7±0.5, n=3) wide. Hooks of middle circle 13–17 (15±1, n=23) long, 4–6 (4±0.5, n= 23) wide; posterior circle 13–20 (16±2, n=23) long, 4–5 (4±0.7, n=22) wide. Neck 15–35 (25±6, n=8) long, 60–80 (68±6, n=8) wide. Proboscis receptacle 215–300 (248±30, n=8) long, 52–87 (68±14, n=8) wide. Longer lemniscus 187–465 (342±114, n=6) long, 20–87 (58±23, n=6) wide; shorter lemniscus 162–425 (304±102, n=6) long, 20–92 (52±26, n=5) wide. Total length of reproductive system from anterior margin of the uterine bell to ter- minal genital pore 350–700 (475±156, n=4) long. Uterine bell 150–340 (207±80, n=5) long, 43–120 (62±32, n=5) wide. Uterus 100–223 (158±47, n=6) long, 20–96 (49±29, n=6) wide. Length vagina 25–137 (70±43, n=7) long, 9–35 (22±7, n=7) wide. Geni- tal pore subterminal 20–55 (34±12, n=8) long, 18–52 (34±13, n= 8) wide. Eggs elliptical 22–25 (23±1, n=6) long, 6–9 (7±1, n=6) wide. 3.1.2. Taxonomic summary Type-host: D. latifrons (Richardson, 1844) (Eleotridae: Pacific fat sleeper). Site of infection: Intestine Type-locality: Rión Pijijiapan, Chiapas State, Mexico (15° 31′ 54.3″ N, 93° 09′ 39.4″ W) Additional localities: La Conquista, Chiapas State, Mexico (15° 40′ 00.20″ N, 93° 24′ 51.61″ W) and Joaquín Amaro, Pijijiapan, Chiapas State, Mexico (15° 46′ 16.19″ N, 93° 24′ 30.11″ W). Type-material: Holotype CNHE: No. 8180; allotype CNHE: No. 8181; paratypes CNHE: No. 8182–8184. Infection: Rión Pijijiapan 8/8 fish (prevalence 100%); La Conquista 1/1 fish (prevalence 100%) and Joaquín Amaro 1/1 fish (prevalence 100%) were parasitized by acanthocephalans. Etymology: The new species is named after the Mayan ethnic group (Mames) that inhabits the coastal region of Chiapas, Mexico and Guatemala. 3.1.3. Multivariate analyses Multivariate descriptive statistics from MANOVA post hoc tests re- vealed that 14 from 37 characters for the females and 11 from 35 characters for males were significantly different between species (Pb0.05) in at least one pairwise group comparison in both sexes. When considering only diagnostic characters in the MANOVA, signif- icant differences were found, e.g., lengths of dorsal, ventral and lateral apical hooks in females (Wilks' λ=0.42033, Pb0.02284; Fig. 3A); lengths of middle and posterior hooks in females (Wilks' λ= 0.12491, Pb0.000001; Fig. 3A); lengths of length, dorsal, lateral and ventral apical hooks in males (Wilks' λ=0.67415, Pb0.058095; Fig. 3B); lengths of middle and posterior hooks in males (Wilks' λ= 0.09615, Pb0.00001; Fig. 3B); proboscis length in females (Wilks' λ=0.32756, Pb0.00063; Fig. 3C); proboscis length in males (Wilks' λ=0.12754, Pb0.00004; Fig. 3C) and anterior and posterior testis length (Wilks' λ=0.41047, Pb0.02541; Fig. 3D). PCA analysis clearly shows that, for females (Fig. 3E), three clusters are formed, corresponding with each of the three species considered in that anal- ysis, i.e., N. brentnickoli, N. golvani, and N. mamesi n. sp.; however, for males (Fig. 3F), polygons of N. brentnickoli and N. mamesi overlap slightly, while that of N. golvani is clearly separated from the other two. The first two axes of the PCA for females and males (Fig. 3E, F) accounted for 50.81 and 54.25% of the variation, respectively. We considered factor loadings with an absolute value greater than 0.50 highly significant in interpreting principal component structure (Table 2). 3.1.4. Remarks In Mexico 4 species of the genus Neoechinorhynchus associated with brackish and freshwater fishes have been described [10]. The new species can be readily distinguished from N. chimalapasensis and N. roseus by its smaller size and by having a smaller body length-to-width ratio (LWR) (see Table 5). N. mamesi n. sp. closely re- sembles N. golvani and N. brentnickoli. On average, the new species is relatively similar in size with respect to N. golvani but it is smaller with respect to N. brentnickoli. However, it can be distinguished from N. golvani by having a less marked dimorphism in trunk length between sexes (males 1165–2284 (1847) females 1383–3542 Table 5 Hook sizes for Neoechinorhynchus mamesi n. sp. and the other congeneric species from Mexico. Sizes are given as average (minimum–maximum). Apical hook Posterior hook Length–width of the trunk Length-to-width ratio Dorsal Lateral Ventral Middle hook N. brentnickoli Male 43 (40–47) 39 (37–43) 43 (39–45) 18 (15–22) 15.5 (15–16) 3140 (2150–3550) 753 (450–910) 4:1 Female 42 (40–47) 38 (35–40) 43 (40–47) 19 (15–20) 16 (14–19) 5553 (4000–8100) 915 (800–1350) 6:1 N. chimalapasensis Male 34.2 (33–35) 34.2 (33–35) 34.2 (33–35) 19 (15–20) 16.4 (15–19) 5458 (3831–7672) 587 (485–712) 9:1 Female 38 (36–40) 38 (36–40) 38 (36–40) 20 (19–22) 15 (15) 9832 (7761–13,117) 724 (554–851) 14:1 N. golvani Male 48 (48) 45 (45) 48 (48) 18 (18) 18.5 (18–19) 1020 (1019–1021) 350 (350) 3:1 Female 48 (46–51) 48 (45–52) 50 (47–53) 23 (22–25) 19 (19–20) 1962 (740–3200) 512 (220–850) 3:1 N. roseus Male 45 (45) 44.5 (42–47) 43.5 (42–45) 15 (15) 15 (15) 6525 (5850–7,2000) 765 (750–780) 8:1 Female 45.5 (45–46) 42 (42) 44 (42–46) 17.5 (17–18) 15.5 (15–16) 7325 (6750–7900) 630 (550–710) 12:1 N. mamesi n. sp. Male 45 (38–52) 44 (38–53) 45 (40–52) 14 (12–17) 15 (13–17) 1847 (1165–2284) 637 (430–820) 3:1 Female 46 (35–54) 44 (37–54) 45 (37–55) 15 (13–17) 16 (13–20) 2414 (1383–3542) 746 (350–1110) 3:1 639C.D. Pinacho-Pinacho et al. / Parasitology International 61 (2012) 634–644 57 (2414) vs. males 1020 (1019–1021) females 1962 (740–3200) re- spectively) (Table 5). In addition, the new species possesses 2 giant ventral nuclei instead of only 1, has shorter hooks in the 3 circles in both sexes (anterior 44 to 45 vs. 45 to 48, middle 12 to 17 vs.18, and posterior 13 to 17 vs.18 to 19, respectively in males) and (anteri- or 44 to 46 vs. 48 to 50, middle 13 to 17 vs. 22 to 25, and posterior 13 to 20 vs. 19 to 20 respectively in females), and has larger testes (anterior testis 177–660 (419) long by 155–400 (310) wide vs. 112–408 long by 123–262 wide and posterior testis 152–440 (317) long by 167–430 (325) wide vs. 112–262 long by 153–300 wide, respectively). On the other hand, N. mamesi n. sp. is morphologically very similar toN. brentnickoli and they both are found parasitizing Pacific fat sleepers along the Pacific Coast of Mexico, but also can be distinguished by hav- ing less dimorphism in trunk length between sexes (males 1165–2284 (1847) females 1383–3542 (2414) vs.males 3140 (2150–3550) females 5553 (4000–8100), respectively) (Table 5). Additionally, the new spe- cies is distinguished from N. brentnickoli because even though they both possess 2 giant ventral nuclei, in the new species these nuclei are separated and not contiguous as in the latter species, and also because proboscis hooks in N. mamesi n. sp. differ in size with respect to those in N. brentnickoli (i.e., anterior hooks 44 to 45 vs. 39 to 43, middle hooks 12 to 17 vs.15 to 22 and posterior hooks 13 to 17 vs.15 to 16 re- spectively in males) and (anterior hooks 44 to 46 vs. 38 to 43, middle 13 to 17 vs. 15 to 20 and posterior 13 to 20 vs. 14 to 19 respectively in females) (Table 5). Finally, the new species possesses smaller testes (anterior testis 177–660 (419) long by 155–400 (310) wide vs. 425–640 (568) long by 255–450 (361) wide and posterior testis 152–440 (317) long by 167–430 (325) wide vs. 265–545 (428) long by 240–465 (365) wide, respectively). 3.2. Base composition and genetic divergence DNA fragments of the LSU and cox 1 were amplified and se- quenced for individuals representing 5 species of the genus Neoechinorhynchus. N. mamesi n. sp., N. brentnickoli, N. golvani, N. -12 -10 -8 -6 -4 -2 0 2 4 6 8 10 -8 -6 -4 -2 0 2 4 6 8 P C A 2 ( 13 .6 2% o f v ar ia tio n) PCA 1 (37.19% of variation) N. mamesi n. sp. N. brentnickoli N. golvani n=5 n=8 n=8 -10 -8 -6 -4 -2 0 2 4 6 8 10 -8 -6 -4 -2 0 2 4 6 8 PCA 1 (42.38% of variation) P C A 2 ( 11 .8 7% o f v ar ia tio n) N. golvani n=8 n=8 n=2 N. mamesi n. sp. N. brentnickoli Apical dorsal hooks length Apical lateral hooks length Apical ventral hooks length Middle hooks length Posterior hooks length N. mamesi n. sp. N. brentnickoli N. golvani 0.010 0.015 0.020 0.025 0.030 0.035 0.040 0.045 0.050 0.055 0.060 Apical dorsal hooks length Apical lateral hooks length Apical ventral hooks length Middle hooks length Posterior hooks length N. mamesi n. sp. N. brentnickoli N. golvani 0.010 0.015 0.020 0.025 0.030 0.035 0.040 0.045 0.050 0.055 0.060 Proboscis length females Proboscis width females Proboscis length males Proboscis width males N. mamesi n. sp. N. brentnickoli N. golvani 0.00 0.02 0.04 0.06 0.08 0.10 0.12 Anterior testis length Anterior testis width Posterior testis length Posterior testis width N. mamesi n. sp. N. brentnickoli N. golvani -0.3 -0.2 -0.1 0.0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0.9 1.0 E F A C D B Fig. 3.Multivariate analysis of variance in three species of Neoechinorhynchus. Apical, middle and posterior hooks length of females (A). Apical, middle and posterior hooks length of males (B). Proboscis length and wide of females and males (C). Testis length and width (D). Principal Component Analysis scatterplots for females (E) and males (F). 640 C.D. Pinacho-Pinacho et al. / Parasitology International 61 (2012) 634–644 58 roseus and N. saginatus. PCR products varied from 815 to 824bp for LSU and from 490 to 620bp for cox 1. The 5 species analyzed in this study amplified with different sets of primers for cox 1 (see Table 3). Nucleotide frequencies for the combined (LSU+cox 1) data set were 0.26 (A), 0.15 (C), 0.23 (G), and 0.34 (T). The total length of each data set and the concatenation of these (LSU+cox 1) data sets are shown in Table 4. The genetic divergence estimated among the populations of N. mamesi n. sp., N. brentnickoli, and N. golvani ranged from 10.14 to 21.03% for LSU and from 20.53 to 25.91% for cox 1 (Table 6). Table 6 Genetic divergence estimated among 5 clades (species) and intraclade, with the LSU gene (LSU; lower matrix) and cox 1 gene (cox 1; upper matrix). Uncorrected P distances are expressed as percentages. Cox 1/LSU N. brentnickoli N. golvani N. roseus N. saginatus N. mamesi n. sp. Intraclade cox 1 LSU N. brentnickoli 23.79 to 25.91 22.77 to 24.12 27.61 to 28.07 20.53 to 22.06 0.23 to 3.21 0.13 to 0.27 N. golvani 21.43 to 22.28 26.25 to 28.11 28.42 to 30.77 22.24 to 24.95 0.23 to 10.41 0.12 to 1.37 N. roseus 31.42 to 31.57 32.13 to 32.73 27.21 to 27.84 0 0.29 N. saginatus 33.21 to 33.35 31.86 to 32.15 35.76 to 36.20 29.53 to 30.46 0 0 N. mamesi n. sp. 10.14 to 10.55 20.31 to 21.03 32.07 to 32.38 33.34 to 33.50 0.23 to 2.06 0.1 to 0.13 Fig. 4. Trees inferred with the combined (cox 1+LSU) data set, using maximum parsimony (1027 steps) and maximum likelihood (−ln likelihood 7427.997809) methods and Bayesian inference. Numbers near internal nodes show MP/ML bootstrap clade frequencies and posterior probability clade frequencies. Bars — 500μm. 641C.D. Pinacho-Pinacho et al. / Parasitology International 61 (2012) 634–644 59 3.3. Combined LSU+cox 1 data set This data set consisted of two genes (LSU+cox 1), included 49 in- dividuals with 1292 characters, of which 529 were parsimony infor- mative. Parsimony analysis of this combined dataset yielded 14,520 trees with a C.I.=0.84 and a length of 1027 steps (Table 4). The MP strict consensus tree shows the 5 main clades, which are recognized as five species. The 12 specimens collected in Pacific fat sleepers from Southwestern Mexico form a monophyletic clade with 100% bootstrap support. In the combined data set this clade is the sister taxa to N. (N) brentnickoli, and both clades received strong nodal sup- port (Fig. 4). The ML analysis yielded a single tree with −ln= 7427.997809. The ML topology also showed the main 5 clades as in the MP tree, but the support among the clades was lower than MP analysis. The Bayesian tree also yielded the same branch pattern as the MP and ML trees and it was well supported with posterior probability values (Fig. 4). To examine the separate contribution of each data set in the systematic position of the species of Neo- echinorhynchus, additional phylogenetic analyses were conducted using cox 1 and LSU data sets separately as we show next. 3.4. Cox 1 data set This data set included 83 taxa, with 538 characters (missing data treated in the analysis), of which 218 were parsimony informative (Table 4). Maximum parsimony analysis (Fig. 5: A) yielded 2039 trees with a C.I.=0.78 and length of 463 steps. The MP strict consen- sus tree, as well as the ML and Bayesian inference trees showed 5 major clades that received high bootstrap support and Bayesian pos- terior probabilities (Fig. 5: A). The tree inferred with cox 1 data set, placed N. mamesi n. sp., as the sister species of N. golvani albeit nodal support was low for this sister taxa relationship (Fig. 5: A). 3.5. LSU data set This data set included 50 taxa, with 754 characters, of which 311 were parsimony informative. Maximum parsimony analysis (Fig. 5: B) yielded 195 trees with a C.I.=0.89 and length of 567 steps (Table 4). The MP strict consensus tree yielded the same topology as the ML and Bayesian trees, and also the same topology as the cox 1 analyses. Five main clades are recognized, with almost identical 27 59 /100/ 100/100/1 76/100/1 /69/0.88 100/91/1 100/100/1 /74/0.93 100/98/1 100/98/1 82 83 84 0.2 61 62 63 60 49 50 51 52 53 54 55 56 57 58 29 30 21 34 35 36 37 39 44 40 41 42 43 45 46 47 48 38 22 23 16 24 25 31 32 26 33 17 18 28 19 20 11 6 12 13 7 8 14 15 1 2 3 4 9 10 579 80 73 74 76 77 78 64 65 66 81 67 70 71 72 68 69 100/100/1 82 83 84 29 39 21 40 41 22 30 23 49 50 51 52 53100/100/0.91 42 43 24 25 1 6 100/96/0.66 2 7 11 8 12 13 3 14 15 9 100/64/1 67 68 76 77 70 71 69 72 79 78 73 80 74 75 100/100/1 81 64 65 66 100/97/1 100/100/ 1 2 3 A B 0.2 N. roseus N. saginatus N. brentnickoli N. mamesi n.sp. N. golvani N. roseus N. saginatus N. brentnickoli N. mamesi n.sp. N. golvani Fig. 5. Trees inferred with the maximum parsimony and maximum likelihood methods and Bayesian inference. A. Cox 1 data set. B. LSU data set. Numbers near internal nodes show MP/ML bootstrap clade frequencies and posterior probability clade frequencies. 642 C.D. Pinacho-Pinacho et al. / Parasitology International 61 (2012) 634–644 60 sister group relationships, excepting that the new species is nested with N. brentnickoli, a relationship strongly supported by bootstrap and posterior probability values, and not with N. golvani, as suggested by the cox 1 analyses. 3.6. Haplotype network construction This data set included 435 characters (the alignment was shorter than for phylogenetic analyses to avoid inclusion of sites for which some data were missing). Of 37 haplotypes detected, 12 derived from N. mamesi n. sp., 8 from N. golvani, 15 from N. brentnickoli, 1 from N. roseus and 1 from N. saginatus. The haplotype clusters were separated into three groups. The haplogroup representing N. mamesi n. sp. is separated by 84 substitutions from N. brentnickoli, and by 69 substitutions from N. golvani. Five specimens of each locality of N. mamesi n. sp., were analyzed, representing 3 populations from coastal lagoons from Chiapas The Rión Pijijiapan lagoon samples had 4 haplotypes, the Conquista lagoon had 5 haplotypes and the Joaquín Amaro Estuary had 4 haplotypes (Fig. 6). 4. Discussion N. mamesi n. sp. is the seventh species of the genus described from Mexico [10,23] and it represents the second species particularly associated with an estuarine fish, the Pacific fat sleeper (D. latifrons) in the Pacific Sea slope. The genetic divergence estimated within 3 populations of N. mamesi n. sp., ranged from 0.23 to 2.06% for cox 1, whereas the genetic divergence found among 8 populations of N. brentnickoli ranged from 0.23 to 3.21%. These ranges of intraspecific genetic divergence are higher than those previously described for other populations of acanthocephalans, e.g., Pomphorhynchus laevis Muller 1776. This species of acanthocephalan showed a divergence varying from 0.35 to 0.70% [24], while individuals of polymorphid acanthocephalans such as Corynosoma strumosum Lühe 1904, South- wellina hispida Van Cleave 1925, Polymorphus brevis Van Cleave, 1916, Profilicollis altmani Perry 1942, and Profilicollis botulus Van Cleave 1916 exhibited intraspecific genetic divergence ranging from 1 to 5% [25]. Likewise, the 17 specimens representing 6 populations of N. golvani, associated with cichlid fishes in strictly freshwater envi- ronments analyzed in the current study, revealed high genetic diver- gence ranging from 0.23 to 10.41% with cox 1. These values suggested that these specimens could represent a complex of cryptic species, however additional molecular work is needed to support this finding. Additionally, a nuclear gene (LSU) was used as another molecular marker to establish a more robust species delimitation criterion among populations of the genus Neoechinorhynchus. The genetic di- vergence of LSU estimated within the populations of N. mamesi n. sp., ranged from 0.1 to 0.13%, while for N. brentnickoli divergence ranged from 0.13 to 0.27% and for N. golvani it ranged from 0.12 to 1.37%. These ranges of genetic divergence within populations are also similar to those previously described for Neoechinorhynchus spp. [9]. All the phylogenetic trees inferred with each molecular marker analyzed independently, and the concatenated data set, showed that the five species of Neoechinorhynchus analyzed in this study represent independent clades, with extremely high genetic di- vergence varying between 20.53 and 24.95% for cox 1 and between 10.14 and 21.03% for LSU (Table 6). The haplotype network obtained in this study showed that three species of Neoechinorhynchus form 3 independent haplogroups and that the species N. mamesi n. sp. con- tains at least 12 haplotypes, which are separated by 1 to 3 substitu- tions (Fig. 6). The morphological data, the multivariate analyses, in combination with high genetic divergence estimated for each gene, the haplotype network, the reciprocal monophyly of the populations in all the phylogenetic trees inferred with cox 1, LSU, and combined data sets (cox 1+LSU), clearly demonstrate that specimens associat- ed with D. latifrons from 3 localities along the Chiapas State coastline, represent a new taxon for which the name N. mamesi n. sp. was coined. The definitive host of the newly described species of acanthoceph- alan, D. latifrons, has a wide distribution range along the Pacific Ocean slope of the Americas, extending from southern California, USA to Northern Peru [26]. Other than Mexico, no records of acanthocepha- lans have been published for this estuarine fish along its distribution- al range. In this study, 46 Pacific fat sleepers were collected in 3 coastal lagoons along the Oaxaca state coast, i.e., Laguna Superior (2), Laguna Chacahua (31), and Laguna Pastoria (13). This region of Neoechinorhynchus mamesi n. sp. Neoechinorhynchus brentnickoli Neoechinorhynchus golvani 84 15 13 20 55 5 3 4 3 3 2 2 2 4 4 4 3 2 3 69 Fig. 6. Median-joining network of N. mamesi n. sp., N. golvani, and N. brentnickoli built with cytochrome c oxidase subunit I (cox 1) gene sequences. Each circle represents a hap- lotype, with size proportional to the haplotype's frequency in the population. Numbers between haplogroups indicate the number of steps. MV1–MV20 indicates haplotypes not detected. 643C.D. Pinacho-Pinacho et al. / Parasitology International 61 (2012) 634–644 61 Southwestern Mexico seems to represent a gap in the distribution of Neoechinorhynchus spp., even though its definitive host is commonly found in coastal lagoons in Oaxaca. The absence of acanthocephalans in populations of Pacific fat sleepers in Oaxaca allows us to speculate that such gap is the result of the absence of the crustacean intermediate host, which is probably restricted to strictly freshwater environments [27], whereD. latifrons eventually penetrates, andmay become infected. Other possibilities could be related to seasonal variations (i.e. dry orwet season) or the life cycle stage of the definitive host (i.e. during the repro- ductive period the host reduces feeding activity and therefore the abun- dance of the acanthocephalans is low) [28]. Since the fish definitive host occurs along the entire Pacific Coast of Mexico, it seems likely that the intermediate host plays a major role in the diversification of Neoechinorhynchus, with the Isthmus of Tehuantepec acting in some way as a biogeographical barrier that separated N. brentnickoli and the new species from their ancestor. This region of Mexico has a complex geologic history and is the major factor responsible for the divergence of numerous animal ter- restrial lineages [29–31]. Future samplings of Pacific fat sleepers along Central America Pacific Coast, and even samplings in northern South America will determine if the new species is also found there, or if other potential biogeographical barriers determine if other spe- cies of Neoechinorhynchus will be found in the near future. Still, the hypothesis that the intermediate host is the limiting factor in the dis- tribution of these species of acanthocephalans (and not the definitive host) needs to be determined by proper sampling of potential inter- mediate hosts, and in addition to that, a more extensive sampling of Pacific fat sleepers in Oaxaca will be needed to corroborate it repre- sents a gap in the distribution of these acanthocephalans. 5. Conclusions N. mamesi n. sp. is the second species of the genus associated to the Pacific fat sleeper (D. latifrons) in the Southwestern Pacific Ocean coast of Mexico. Morphologically, the new species is distin- guished from the other six congeneric species described from reptiles and fishes in Mexico by possessing a small trunk, a very small probos- cis with long apical proboscis hooks and small middle and posterior hooks. Morphological distinction was further demonstrated by MANOVA and PCA analyses and sequencing 2 molecular markers. The high levels of genetic divergence, the topology of phylogenetic trees with evidence of reciprocal monophyly, and the haplotype net- work support the erection of the new species. Acknowledgments We are grateful to Luis García Prieto for providing specimens of Neoechinorhynchus from the CNHE, Laura Marquez for her help with the use of the DNA sequencer, and Rogelio Rosas Valdez and David Ivan Guadalupe Hernández Mena for their support during field work. This research was partially supported by grants from the Programa de Apoyo a Proyectos de Investigación e Inovación Tecnológica (PAPIIT 215709 and PAPIIT 202111) and the Consejo Nacional de Ciencia y Tecnología (CONACYT 83043) to GPPL. CDPP thanks CONACyT for the scholarship and the Posgrado en Ciencias Biológicas, Universidad Nacional Autónoma de México. References [1] Aho JM, Mulvey M, Jacobsen KC, Esch GW. Genetic differentiation among conge- neric acanthocephalans in the yellow-bellied slider turtle. Journal of Parasitology 1992;78:974–81. [2] Amin OM. Revision of Neoechinorhynchus Stiles & Hassall, 1905 (Acanthocephala: Neoechinorhynchidae) with keys to 88 species in two subgenera. Systematic Par- asitology 2002;53:1–18. [3] Amin OM, Abdullah MAS, Mhaisen FT. Neoechinorhynchus (Neoechinorhynchus) zabensis sp. n. (Acanthocephala: Neoechinorhynchidae) from freshwater fish in northern Iraq. Folia Parasitologica 2003;50:293–7. [4] Barger MA, Thatcher VE, Nickol BB. A new species of Neoechinorhynchus (Acanthocephala: Neoechinorhynchidae) from a red-eared slider (Trachemys scripta elegans) in Mexico. Comparative Parasitology 2004;71:1–3. [5] Barger MA, Nickol BB. A key to the species of Neoechinorhynchus (Acanthocephala: Neoechinorhynchidae) from turtles. Comparative Parasi- tology 2004;71:4–8. [6] Amin OM, ChristisonWK. Neoechinorhynchus (Neoechinorhynchus) dorsovaginatus n. sp. (Acanthocephala: Neoechinorhynchidae) from the dusky kob Argyrosomus japonicus (Sciaenidae) on the southern coast of South Africa. Systematic Parasitol- ogy 2005;61:173–9. [7] Monks S, Pulido-Flores G, Violante-González J. A new species of Neoechinorhynchus (Acanthocephala:Neoechinorhynchidae) in Dormitator latifrons (Perciformes: Eleotridae) from the Pacific Coast of Mexico. Comparative Parasitology 2011;78: 21–8. [8] Amin OM, Ha NV, Ha DN. The description of six new species of Neoechinorhynchus from marine fish in Vietnam. Parasite 2011;18:21–34. [9] Martínez-Aquino A, Reyna-Fabián ME, Rosas-Valdez R, Razo-Mendivil U, Pérez-Ponce de León G, García-Varela M. Detecting a complex of cryptic species within Neoechinorhynchus golvani (Acanthocephala: Neoechinorhynchidae) in- ferred from ITSs and LSU rDNA gene sequences. Journal of Parasitology 2009;95: 1040–7. [10] García-Prieto L, García-Varela M, Mendoza-Garfias B, Pérez-Ponce de León G. Checklist of the Acanthocephala in wildlife vertebrates of Mexico. Zootaxa 2010;2419:1–50. [11] StatSoft Inc. STATISTICA (data analysis software system), version 7.1. www. statsoft.com2005. [12] García-Varela M, Nadler SA. Phylogenetic relationships of palaeacanthocephala (Acanthocephala) inferred from SSU and LSU rDNA gene sequences. Journal of Parasitology 2005;91:1401–9. [13] Thompson J, Higgins D, Gibson T. CLUSTAL W: improving the sensitivity of pro- gressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Research 1994;22:4673–80. [14] Maddison DR, Maddison WP. MacClade Version 4.0. Sunderland, Massachusetts: Sinauer Associates; 2002. [15] Swofford DL. PAUP 4.0b10. Phylogenetic analysis using parsimony (and other methods). Sunderland, Massachusetts: Sinauer Associates; 2002. [16] Stamatakis A. Raxml-vi-hpc: maximum likelihood-based phylogenetic with thou- sands of taxa and mixed models. Bioinformatics 2006;22:2688–90. [17] Posada D, Crandall KA. Modeltest: testing the model of DNA substitution. Bioin- formatics 1988;9:817–8. [18] Huelsenbeck JP, Ronquist F. MrBayes: Bayesian inference of phylogeny. Bioinfor- matics 2001;17:754–5. [19] Rambaut A. FigTree v1.3.1. Institute of evolutionary biology. University of Edin- burgh; 2006. [20] Bandelt HJ, Forster P, Rohl A. Median-joining networks for inferring intraspecific phylogenies. Molecular Biology and Evolution 1999;16:37–48. [21] Clement M, Posada D, Crandall KA. TCS: a computer program to estimate gene ge- nealogies. Molecular Ecology 2000;9:1657–9. [22] Templeton AR, Crandall KA, Sing CF. A cladistic‐analysis of phenotypic asso- ciations with haplotypes inferred from restriction endonuclease mapping and DNA-sequence data III. Cladogram estimation. Genetics 1992;132: 619–33. [23] García-Varela M, García-Prieto L, Pérez Rodríguez R. Molecular identification and first description of the male of Neoechinorhynchus schmidti (Acanthocephala: Neoechinorhynchidae), a parasite of Trachemys scripta (Testudines) in México. Parasitology International 2011;60:433–9. [24] O'Mahony EM, Bradley DG, Kennedy CR, Holland CV. Evidence for the hypothesis of strain formation in Pomphorhynchus laevis (Acanthocephala): an investigation using mitochondrial DNA sequences. Parasitology 2004;129:341–7. [25] García-Varela M, Pérez-Ponce de León G. Validating the systematic position of Profilicollis Meyer, 1931 and Hexaglandula Petrochenko, 1950 (Acanthocephala: Polymorphidae) using cytochrome C oxidase (cox 1). Journal of Parasitology 2008;94:212–7. [26] Miller RR. Freshwater fishes of México. Chicago: The University of Chicago Press; 2005. [27] Kennedy CR. Ecology of the Acanthocephala. School of Biological Sciences, Univer- sity of Exeter; 2006. [28] Violante-González J, Aguirre-Macedo ML, Vidal-Martínez VM. Temporal variation in the helminth parasite communities of the pacific fat sleeper, Dormitator latifrons, from Tres Palos lagoon, Guerrero, Mexico. Journal of Parasitology 2008;94:326–34. [29] Cortés-Rodríguez N, Hernández-Baños BE, Navarro-Sigüenza AG, Peterson AT, García-Moreno J. Phylogeography and population genetics of the Amethyst-throated Hummingbird (Lampornis amethystinus). Molecular Phylogenetics and Evolution 2008;48:1–11. [30] Daza JM, Castoe TA, Parkinson CL. Using regional comparative phylogeographic data from snake lineages to infer historical processes in Middle America. Ecography 2010;33:343–54. [31] Guevara-Chumacero LM, López-Wilchis R, Pedroche FF, Juste J, Ibáñez C, Barriga-Sosa I. Molecular phylogeography of Pteronotus davyi (Chiroptera: Mor- moopidae) in Mexico. Journal of Mammalogy 2010;91:220–32. 644 C.D. Pinacho-Pinacho et al. / Parasitology International 61 (2012) 634–644 62       3. 2. Artículo II Morphological and molecular data reveal a new species of Neoechinorhynchus (Acanthocephala: Neoechinorhynchidae) from Dormitator maculatus in the Gulf of Mexico Carlos Daniel Pinacho-Pinacho, Ana L. Sereno-Uribe, Martín García- Varela Parasitology International (2014) 63: 763–771 63 Morphological and molecular data reveal a new species of Neoechinorhynchus (Acanthocephala: Neoechinorhynchidae) from Dormitator maculatus in the Gulf of Mexico Carlos Daniel Pinacho-Pinacho a, Ana L. Sereno-Uribe b, Martín García-Varela b,⁎ a Posgrado en Ciencias Biológicas, Instituto de Biología, Universidad Nacional Autónoma de México, A.P. 70-153, C.P. 04510 México D.F., México b Departamento de Zoología, Instituto de Biología, Universidad Nacional Autónoma de México, A.P. 70-153, C.P. 04510 México D.F., México a b s t r a c ta r t i c l e i n f o Article history: Received 24 December 2013 Received in revised form 5 July 2014 Accepted 12 July 2014 Available online 23 July 2014 Keywords: Acanthocephala Neoechinorhynchus (Neoechinorhynchus) mexicoensis Morphology Molecular data ITS LSU Gulf of Mexico Dormitator maculatus Neoechinorhynchus (Neoechinorhynchus) mexicoensis sp. n. is described from the intestine of Dormitator maculatus (Bloch 1792) collected in 5 coastal localities from the Gulf of Mexico. The new species is mainly distinguished from the other 33 described species of Neoechinorhynchus from the Americas associated with freshwater, marine and brackish fishes by having smaller middle and posterior hooks and possessing a small proboscis with three rows of six hooks each, apical hooks longer than other hooks and extending to the same level as the posterior hooks, 1 giant nucleus in the ventral body wall and females with eggs longer than other congeneric species. Sequences of the internal transcribed spacer (ITS) and the large subunit (LSU) of ribosomal DNA including the domain D2 + D3 were used independently to corroborate the morphological distinction among the new species and other congeneric species associated with freshwater and brackish water fish from Mexico. The genetic divergence estimated among congeneric species ranged from 7.34 to 44% for ITS and from 1.65 to 32.9% for LSU. Maximum likelihood and Bayesian inference analyses with each dataset showed that the 25 specimens analyzed from 5 localities of the coast of the Gulf of Mexico parasitizing D. maculatus represent an independent clade with strong bootstrap support and posterior probabilities. The morphological evidence, plus the monophyly in the phylogenetic analyses, indicates that the acanthocephalans collected from intestine of D. maculatus from the Gulf of Mexico represent a new species, herein named N. (N.) mexicoensis sp. n. © 2014 Published by Elsevier Ireland Ltd. 1. Introduction The fat sleeper fish, Dormitator maculatus (Eleotridae) (Bloch 1792), is distributed in the Atlantic Ocean from North Carolina of the south- eastern United States to southeastern Brazil including the West Indies [1]. It represents an important local source of food for humans along the coast of the Gulf of Mexico [2]. The biology of the fat sleeper is well known; it lives in freshwater and brackish water, streams, rivers, springs, lagoons, swamps, and muddy ponds [1]. Its diet is mostly composed of zooplanktonic microcrustaceans and phytoplankton [2]. Species of Neoechinorhynchus Stiles and Hassall, 1905 are endoparasites of freshwater brackish water fish and freshwater turtles with approxi- mately 116 described species classified into two subgenera: Neoechinorhynchus Hamann 1892 and Hebesoma Van Cleave 1928 distributed worldwide [3,4]. A total of 49 species have been described from the Americas, 33 from North America and 16 from Central and South America [5–9]. In Mexico, 8 species belonging to the subgenus Neoechinorhynchus have been described, 2 of these occur in freshwater turtles, i.e., Neoechinorhynchus (Neoechinorhynchus) schmidti Barger, Thatcher andNickol, 2004 andNeoechinorhynchus (Neoechinorhynchus) emyditoides Fisher, 1960, and the other 6 species occur in marine, brackish and fresh- water fishes: Neoechinorhynchus (Neoechinorhynchus) roseum Salgado- Maldonado, 1978; Neoechinorhynchus (Neoechinorhynchus) golvani, Salgado-Maldonado, 1978; Neoechinorhynchus (Neoechinorhynchus) chimalapasensis Salgado-Maldonado, Caspeta-Mandujano and Martínez- Ramírez, 2010; Neoechinorhynchus (Neoechinorhynchus) brentnickoli Monks, Pulido-Flores and Violante-González, 2011; Neoechinorhynchus (Neoechinorhynchus) mamesi Pinacho-Pinacho, Peréz-Ponce de Léon and García-Varela, 2012; and Neoechinorhynchus (Neoechinorhynchus) panucensis Salgado-Maldonado, 2013 [8–11]. During a helminthological survey, adult acanthocephalans were collected in the intestine of the fat sleeper fish D.maculatus in five local- ities from the Gulf of Mexico. These acanthocephalans represent an undescribed species of Neoechinorhynchus, which is herein described and compared with the other 33 species from the Americas associated with freshwater, marine and brackish fishes. Molecular data were gen- erated from Neoechinorhynchus and compared with the other species previously recorded in Mexico. ⁎ Corresponding author. Tel.: +52 5 56229130; fax: +52 5 55500164. E-mail address: garciav@servidor.unam.mx (M. García-Varela). Parasitology International 63 (2014) 763–771 http://dx.doi.org/10.1016/j.parint.2014.07.003 1383-5769/© 2014 Published by Elsevier Ireland Ltd. Contents lists available at ScienceDirect Parasitology International j ourna l homepage: www.e lsev ie r .com/ locate /par in t 64 2. Materials and methods 2.1. Specimen collection Adult acanthocephalans were collected from the intestines of their definitive hosts in 5 localities from the Gulf of Mexico (Table 1; Fig. 1). Fish were examined for parasites immediately after their capture. The acanthocephalans recovered were placed in distilled water to relax the specimens for 10–12 h at 4 °C. Specimens were subsequently pre- served in 100% ethanol, and stored at 4 °C. For taxonomic identification, some specimenswere stainedwithMayer's paracarmine, dehydrated in a graded ethanol series, cleared withmethyl salicylate, andmounted on permanent slides in Canada balsam. These specimenswere deposited in the Colección Nacional de Helmintos (CNHE), Instituto de Biología, Universidad Nacional Autónoma de México, Mexico City. The acantho- cephalans collected in this study were assigned to the genus and subgenus Neoechinorhynchus and were compared with type- specimens of other congeners, deposited at the CNHE as follows: N. (N.) chimalapasensis holotype CNHE-5018, allotype CNHE-5019, 12 paratypes CNHE-5020; N. (N.) golvani CNHE-0603, holotype CNHE- 601, paratypes CNHE-603, and CNHE-604, 606, 631, 632, 650, 652, 663, and 655; N. (N.) roseum holotype CNHE-633, paratype CNHE-634; N. (N.) brentnickoli holotype CNHE-7537, allotype CNHE-7538, paratypes CNHE-7539–7540; N. (N.) mamesi holotype CNHE: No. 8180, allotype CNHE: No. 8181, paratypes CNHE: Nos. 8182–8184 and N. (N.) panucencis holotype CNHE-8378, allotype CNHE-8379, and paratypes CNHE-8380–8381. Measurements of the trunk, proboscis hooks, proboscis receptacle, lemnisci, uterine bell, vagina, testes, and cement gland were taken from sexually mature specimens with the use of a light microscope. Measurements are given in micrometers (μm); for all morphological traits of the new species, ranges are given, followed in parentheses by mean values ± standard deviation, and sample size (n). Measurements and drawings of eggs were made from mature eggs measured in situ through the body wall of female worms. Specimens were illustrated with the aid of a microscope drawing tube. 2.2. Amplification and sequencing of DNA The acanthocephalanswere digested overnight at 56 °C in a solution containing 10 mM Tris–HCl (pH 7.6), 20 mM NaCl, 100 mM Na2 EDTA (pH 8.0), 1% Sarkosyl, and 0.1 mg/ml proteinase K. Following digestion, DNAwas extracted from the supernatant using DNAzol reagent (Molec- ular Research Center, Cincinnati, Ohio) according to the manufacturer's instructions. The ITS regionwas amplified using the forward primer BD1 5′-GTCGTAACAAGGTTTCCGTA-3′ and the reverse primer BD2 5′-ATCT AGACCGGACTAGGCTGTG-3′ [12]. The D2 + D3 domains of the large subunit (LSU) from ribosomal DNA (rDNA) were amplified using the forward primer 5′ CAAGTACCGTGAGGGAAAGTTGC-3′ and the reverse primer 5′ GTCGATAGGACTCCCTTTG-3′ [13]. PCR reactions (25 μl) consisted of 10 μM of each primer, 2.5 μl of 10X PCR Rxn buffer, 2 mM MgCl2, and 1 U of Taq DNA polymerase (Platinum Taq, Invitrogen Corporation, São Paulo, Brazil). PCR cycling parameters for rDNA ampli- fications included denaturation at 94 °C for 1min, followed by 35 cycles of 94 °C for 1 min, annealing at 50 °C for 1 min, and extension at 72 °C for 1 min, followed by a post-amplification incubation at 72 °C for 10 min. Sequencing reactions were performed using ABI Big Dye (Ap- plied Biosystems, Boston,Massachusetts) terminator sequencing chem- istry. The reactions were reading using an ABI 3730 capillary DNA sequencer. Forward and reverse sequences were assembled using Codoncode Aligner version 3.5.4 (Codoncode Corporation, Dedham, Massachusetts). Sequences were deposited in GenBank (Table 1). 2.3. Alignments and phylogenetic analyses Sequences obtained in the current research from ITS and LSU rDNA were aligned separately with other congeneric species i.e., N. (N.) mamesi, N. (N.) brentnickoli, N. (N.) golvani, N. (N.) roseum, Neoechinorhynchus saginatus Van Cleave and Bangham, 1949, N. (N.) schmidti, and N. (N.) emyditoides, using the software Clustal W [14], with default parameter settings and adjusted manually with MacClade [15]. Maximum likelihood (ML) and Bayesian inference (BI) analyses were performed. The best model of substitution for both datasets was selected with jModeltest version 0.1.1 [16]. The model GTR + G was selected for LSU and the TPM2uf + I + G was selected for ITS, with the Akaike information criterion. The ML tree was inferred using RAxML 7.0.4 [17]. Maximum likelihood clade support was assessed by bootstrap resampling with 10,000 replicates. Additionally, Bayesian analysis was performed with the program MRBAYES version 3.1.2 [18]. The settings were 2 simultaneous runs with 4 Markov chains and 10 million MCMC generations, sampling every 200 generations, a heating parameter value of 0.2 and a ‘burn-in’ of 10%. Trees were drawn using the FigTree program version 1.3.1 [19]. The species Floridosentis mugilis Machado Filho, 1951 and Floridosentis pacifica Bravo Hollis, 1969 were chosen as outgroups for the analyses. 3. Results 3.1. Morphological description Class Eoacanthocephala Van Cleave, 1936. Order Neoechinorhynchida Southwell and Macfie, 1925. Family Neoechinorhynchidae (Ward, 1917) Van Cleave, 1928. Neoechinorhynchus (Neoechinorhynchus) mexicoensis sp. n. (Fig. 2). General: Neoechinorhynchidae,with characters ofNeoechinorhynchus, subgenus Neoechinorhynchus. Trunk is cylindrical and swollen in the anterior region, and slender in the posterior region. Trunk wall is thin dorsally and ventrally with 5 dorsal giant subcuticular nuclei and 1 ventral nucleus (Fig. 2A–B). Proboscis is short and globular with three circles with six hooks each. Proboscis hooks in all circles are with roots. Apical, middle, and posterior hooks are of similar size. Apical hooks are longer than other hooks and extend to the same level than the posterior hooks (Fig. 2D). Sensory papillae are small and present slightly posterior to the proboscis–neck junction. Neck is wider than longer. Proboscis receptacle is attached to the base of the proboscis. Ce- rebral ganglion is large, oval, and placed at base of the receptacle. Both lemnisci are uninucleate and one is slightly longer than the other. Both lemnisci with nuclei ovoid extend beyond the proboscis receptacle (Fig. 2C). Male: (based on 11mature specimens with sperm). Body 750–1850 (1156± 301, n=11) long by 200–510 (320±87, n=11)wide. Trunk 710–1800 (1105 ± 298, n = 11) long by 200–510 (320 ± 87, n = 11) wide. Proboscis 25–45 (35 ± 5, n= 11) long by 42–100 (57 ± 15, n = 11) wide. Proboscis hooks in the anterior circle, dorsal hooks 50–55 (53 ± 1, n = 11) long by 7–9 (7 ± 0.6, n = 11) wide at the base, root of dorsal hooks 16–20 (19 ± 1, n = 11) long by 5–7 (6 ± 0.9, n = 11) wide; lateral hooks 49–55 (52 ± 2, n = 11) long by 7–8 (7 ± 0. 5, n = 11) wide at the base, root of lateral hooks 16–20 (19 ± 1, n = 11) long by 5–7 (6 ± 0.9, n = 11) wide; ventral hooks 50–55 (52 ± 2, n = 11) long by 7 (7 ± 0, n = 11) wide at the base, root of ventral hooks 16–20 (19 ± 1, n = 11) long by 5–7 (6 ± 0.9, n = 11) wide. Hooks of the middle circle 10–15 (12 ± 1, n = 11) long by 3–4 (3 ± 0.5, n = 11) wide; posterior circle 14–16 (12 ± 3, n = 11) long by 4 (4 ± 0, n = 11) wide. Neck 12–20 (15 ± 2, n =11) long by 40–55 (47 ± 4, n = 11) wide. Proboscis receptacle 150–225 (188 ± 21, n = 11) long by 37–62 (51 ± 7, n = 11) wide. Longer lemniscus 212–387 (278 ± 50, n = 11) long by 25–65 (39 ± 11, n =11) wide; shorter lemniscus 107–287 (222 ± 51, n = 11) long by 25–60 (38 ± 10, n = 11) wide. Reproductive system almost fully occupies the posterior 2/3 of body length, 420–1350 (823 ± 257, n = 11) long. Testes are oval or circular, tandem, and overlapping the cement gland (Fig. 2A). Efferent ducts connect each testis with the seminal vesicle. Anterior testis 125–480 (223 ± 101, n = 11) long by 764 C.D. Pinacho-Pinacho et al. / Parasitology International 63 (2014) 763–771 65 Table 1 Specimen information, collection sites (CS), sample number, species analyzed, number of specimens analyzed (N), host species, locality name, geographical coordinates, GenBank accession number, and catalog number (CNHE) for specimens studied in this work. Sequences marked with an asterisk were obtained in the current study. Nd = not determined. The sample number for each locality corresponds with the same number in Fig. 1. Coordinates GenBank Specimens deposited (CNHE) CS Sample Species n Host Locality North West LSU ITSs 1 4 N. (N.) mamesi 4 Dormitator latifrons Rion Pijijiapan Lagoon, Chiapas/June, 2010 15° 31′ 54.3″ 93° 09′ 39.4″ JN830763–JN830765 KC004185–KC004188* 8180, 8181, 8182 2 5–9 N. (N.) mamesi 5 Dormitator latifrons La Conquista Lagoon, Chiapas/June, 2010 15° 40′ 00.20″ 93° 24′ 51.61″ JN830766–JN830769 KC004194–KC004198* 8184 3 10–14 N. (N.) mamesi 5 Dormitator latifrons Joaquin Amaro Estuary, Chiapas/June, 2010 15° 46′ 16.19″ 93° 24′ 30.11″ JN830770–JN830774 KC004189–KC004193* 8183 4 15–24 N. (N.) brentnickoli 10 Dormitator latifrons Tres Palos Lagoon,Guerrero/September, 2008 16° 48′ 00″ 99° 47′ 00″ FJ968156–FJ968159 FJ388991 KC004146–KC004150* FJ968116 FJ968115 FJ388972 FJ968114 FJ968117 KC004180–KC004184* 8178 5 25 N. (N.) roseum 1 Citharichthys gilberti Tovara Estuary, Nayarit/October, 2007 21° 31′ 37″ 105° 29′ 14″ FJ389000 FJ388981 6763 6 26 N. (N.) roseum 1 Achirus mazatlanus Caimanero Estuary, Sinaloa/June, 2007 25° 36′ 30″ 108° 26′ 25″ FJ388999 FJ388980 6762 7 27–28 N. (N.) emyditoides 2 Trachemys scripta Papaloapan River, Tlacotalpan, Veracruz/ 18° 42′ 13.4″ 95° 45′ 27.9″ HQ634783 HQ634784 KC004174* KC004175* 6695 8 29–39 N. (N.) golvani 11 Paraneetroplus fenestratus Catemaco Lake, Veracruz/June, 2006 18° 25′ 95° 07′ FJ388986 FJ968145 FJ968146 KC004138–KC004145* FJ968112 FJ388967 FJ968113 KC004219–KC004224* 601, 603, 604, 606, 631, 632 9 40–41 N. (N.) schmidti 2 Trachemys scripta Centla Swamp, Tabasco 18° 28′ 18.9″ 92° 39′ 14.9″ HQ634786 HQ634785 KC004172* KC004173* 6764 10 42–47 N. (N.) mexicoensis sp. n. 6 Dormitator maculatus Papaloapan River, Tlacotalpan, Veracruz/December, 2011 18° 36′ 95° 39′ FJ388985 FJ968152–FJ968155 KC004171* FJ388966 FJ968108 FJ968110 FJ968109 FJ968111 KC004199* 8331, 8332, 8333 11 48–52 N. (N.) mexicoensis sp. n. 5 Dormitator maculatus Tamiahua Lagoon, Veracruz/December, 2011 18° 06.6′ 24″ 94° 27′ 24.9″ KC004161–KC004165* KC004209–KC004213* 8334 12 53–57 N. (N.) mexicoensis sp. n. 5 Dormitator maculatus Sontecomapan Lagoon, Veracruz/December 2011 18° 30′ 28″ 95° 01′ 58″ KC004151–KC004155* KC004200–KC004204* 8335 13 58–62 N. (N.) mexicoensis sp. n. 5 Dormitator maculatus Coatzacoalcos River, Veracruz/December, 2011 18° 06′ 35″ 94° 30′ 03.9″ KC004166–KC004170* KC004205–KC004208* 8336 14 63–67 N. (N.) mexicoensis sp. n. 5 Dormitator maculatus Espino River, Tabasco/December, 2011 18° 14′ 47″ 92° 49′ 57″ KC004156–KC004160* KC004214–KC004218* 15 68 N. saginatus 1 Nd Nd Nd Nd AY829091 FJ388984 7 6 5 C .D .P in a ch o-Pin a ch o et a l./ P arasitology In tern a tion al 6 3 (2 0 1 4 ) 7 6 3 – 7 7 1 66 65–300 (160 ± 69, n = 11) wide. Posterior testis 125–300 (194 ± 55, n = 11) long by 70–380 (189 ± 88, n = 11) wide. Cement gland large 75–650 (279 ± 156, n = 11) long by 82–750 (226 ± 190, n = 11) wide. Single cement gland with 8 unfragmented nuclei. The reservoir of the cement gland is located behind the cement gland. Saefftingen's pouch 440–540 (510 ± 38, n = 11) long by 58–120 (88 ± 18, n = 11) wide, located immediately posterior to the cement gland. Seminal vesicle oval, possessing an ejaculatory duct, 37–187 (107 ± 38, n = 11) long by 30–650 (107 ± 18, n = 11) wide. Copulatory bursa opens terminally 60–120 (98 ± 30, n = 11) long by 55–115 (80 ± 25, n = 11) wide (Fig. 2A). Female: (based on 11 gravid specimens). Body 1440–2550 (1652 ± 321, n = 11) long by 380–740 (482 ± 99, n = 11) wide. Trunk 1260– 2482 (1541 ± 326, n = 11) long by 380–740 (482 ± 99, n = 11) wide. Proboscis 40–50 (43 ± 3, n = 11) long by 45–65 (57 ± 5, n = 11) wide. Proboscis hooks in the anterior circle, dorsal hooks 50–58 (54 ± 2, n = 11) long by 7–10 (7 ± 0.9, n = 11) wide at the base, root of dorsal hooks 20–22 (20 ± 0.6, n = 11) long by 6–8 (7 ± 0.6, n = 11) wide; lateral hooks 49–58 (53 ± 3, n = 11) long by 8 (8 ±0, n = 11) wide at the base, root of lateral hooks 20–22 (20 ± 0.6, n = 11) long by 6–8 (7 ± 0.6, n = 11) wide; ventral hooks 49–58 (53 ± 3, n=11) long by 7–9 (8±0.4, n=11)wide at the base, root of ventral hooks 20–22 (20 ± 0.6, n = 11) long by 6–8 (7 ± 0.6, n = 11) wide. Hooks of the middle circle 12–15 (13 ± 0.9, n = 11) long by 4 (4 ± 0, n = 11) wide; posterior circle 13–14 (13 ± 0.4, n = 11) long by 4–5 (4 ± 0.3, n = 11) wide. Neck 15–27 (20 ± 3, n = 11) long by 40–70 (52 ± 6, n = 11) wide. Proboscis receptacle 150–242 (214 ± 28, n = 11) long by 50–62 (56 ± 4, n = 11) wide. Longer lemniscus 300–425 (358 ± 39, n = 11) long by 30–62 (47 ±8, n = 11) wide; shorter lem- niscus 275–375 (326 ± 31, n = 11) long by 30–60 (47 ± 8, n = 11) wide. Total length of the reproductive system from the anterior margin of the uterine bell to the subterminal genital pore 225–450 (297 ± 65, n = 11) long. Uterine bell 112–175 (158 ± 18, n = 11) long by 42–90 (62±12, n=11)wide. Uterine bell is narrow at anterior opening; vagina elongates, wide at the posterior end (Fig. 2E). Uterus 80–137 (101 ± 17, n = 11) long by 20–37 (24 ± 5, n = 11) wide. Va- gina 15–25 (21±3, n=11) long by 25–35 (27±3, n=11)wide. Eggs are mature, and elliptical with no polar prolongation observed, 41–47 (44 ± 5.8, n = 11) long by 10–15 (11 ± 1.64, n = 11) wide (Fig. 2F). 3.1.1. Taxonomic summary Type host: D. maculatus (Bloch, 1792) (Perciformes: Eleotridae). Type locality: Papaloapan River, Tlacotalpan, Veracruz, Mexico (18°36′N, 95°39′W). Other localities: Tamiahua Lagoon, Veracruz (18°06.6′24″N, 94°27′24.9″W), Sontecomapan Lagoon, Veracruz (18°30′28″N, 95°01′58″W), Coatzacoalcos River, Veracruz (18°06′35″N, 94°30′03.9″ W), and Espino River, Tabasco, Mexico (18°14′47″N, 92°49′57″W). Site of infection: Intestine. Infection parameters from type locality: Four out of 4 fishes (preva- lence 100%). A total of 59 acanthocephalans were collected in the Papaloapan River, Tlacotalpan, Veracruz, Mexico. Type-material: holotype CNHE: No. 8673; allotype CNHE: No. 8332; paratype CNHE: Nos. 8333−8336. Etymology: The new species is named for Mexico, the country where the specimens were collected. 3.1.2. Remarks To date, 33 species of Neoechinorhynchus (Neoechinorhynchus) have been described from the Americas associated with freshwater, marine and brackish fishes [5–9]. In North America 19 species have a long trunk up to 3000 μm, which is longer than N. (N.) mexicoensis sp. n., (male: 710–1800; female: 1260–2482). N. (N.) mexicoensis is distin- guished from all other 19 North America species by having smaller middle and posterior hooks (middle hook: male: 10–15, female: 12– 15; posterior hooks:male: 14–16, female: 13–14) (see Table 2). Another 14 species of Neoechinorhynchus (Neoechinorhynchus) have been described from freshwater, marine and brackish fishes in Central and South America: Neoechinorhynchus (Neoechinorhynchus) buttnerae Golvan, 1956; Neoechinorhynchus (Neoechinorhynchus) paraguayensis Machado Filho, 1959; Neoechinorhynchus (Neoechinorhynchus) pterodoridis Thatcher, 1981; Neoechinorhynchus (Neoechinorhynchus) pimelodi Brasil-Sato and Pavanelli, 1998; Neoechinorhynchus (Neoechinorhynchus) curemai Noronha, 1973; Neoechinorhynchus (Neoechinorhynchus) prochilodorum Nickol and Thatcher, 1971; Neoechinorhynchus (Neoechinorhynchus) villoldoi Vizcaino, 1992; Neoechinorhynchus (Neoechinorhynchus) macronucleatus Machado Filho, 1954; N. (N.) roseum; N. (N.) chimalapasensis; N. (N.) brentnickoli; 6 7 8 9 10 11 12 13 14 90°0'0"W95°0'0"W100°0'0"W105°0'0"W110°0'0"W 30°0'0"N 25°0'0"N 20°0'0"N 15°0'0"N 800 0 800400 Kilometers N. (N.) emyditoides (7) N. (N.) golvani (8) N.(N.) schimidti (9) N. (N.) mamesi (1-3) N. (N.) brentnickoli (4) N. (N.) roseum (5-6) N. (N.) mexicoensis sp. n. (10-14) 1 23 4 5 Fig. 1. Sampling sites of specimens ofNeoechinorhynchus (Neoechinorhynchus)mexicoensis sp. n., and the other 6 congeneric species reported fromMexico. Collection sites are numbered according to Table 1. 766 C.D. Pinacho-Pinacho et al. / Parasitology International 63 (2014) 763–771 67 N. (N.)mamesi;N. (N.) golvani andN. (N.) panucensis.N. (N.)mexicoensis sp. n. is distinguished from all other Central and South America species by having apical hooks that extend to the same level as the posterior hooks. Salgado-Maldonado [9] and Amin [5] provided keys to Neoechinorhynchus from Central and South America. Following these two keys, N. (N.) mexicoensis can be distinguished from N. (N.) buttnerae;N. (N.) paraguayensis;N. (N.) pterodoridis andN. (N.) pimelodi by having smaller anterior hooks; 49–55 (52) in males and 49–59 (53) in females in N. (N.) mexicoensis versus 100–135 in N. (N.) buttnerae; 82–94 (87) in males and 120–130 (125) in females in N. (N.) paraguayensis; 142–145 (143) in males and 130–148 (139) in females in N. (N.) pterodoridis; 100–112 (105) in males and 102–142 (129) in females in N. (N.) pimelodi. Also N. (N.) mexicoensis is distinguished from N. (N.) curemai; N. (N.) prochilodorum and N. (N.) villoldoi by having middle and posterior hooks considerably shorter; middle 10– 15 (12) and posterior 14–16 (12) in males, and middle 12–15 (13) and posterior 13–14 (13) in females in N. (N.) mexicoensis versus 38– 45 (41) and 30–38 (33) in N. (N.) curemai; middle 38–46 (41) and posterior 26–36 (30) in N. (N.) prochilodorum; middle 24–28 (26) and posterior 19–23 (21) in males, and middle 23–28 (25) and posterior 19–30 (21) in females inN. (N.) villoldoi. Of the other speciesmentioned above, N. (N.) mexicoensis can be distinguished from N. (N.) macronucleatus by the number of giant nuclei in the body wall (5 dorsal and 1 ventral versus 5 and 0, respectively). Of the fourteen Neoechinorhynchus species from Central and South America, six that are associated with freshwater, marine and brackish fishes have been described from Mexico. The new species N. (N.) mexicoensis can be readily distinguished from N. (N.) roseum and N. (N.) chimalapasensis by having longer anterior hooks, 49–55 (52) in males and 49–59 (53) in females in N. (N.) mexicoensis versus 36–41 in males and 41 in females in N. (N.) roseum; 33–35 (34.2) in males and 36–40 (38) in females in N. (N.) chimalapasensis. The new species can be easily distinguished from N. (N.) brentnickoli; N. (N.) mamesi; N. (N.) golvani and N. (N.) panucensis by having a small cylindrical pro- boscis, with apical hooks that are much larger than the other hooks and extend to the same level as the posterior hooks, 1 giant nucleus in the ventral bodywall, and femaleswith longer eggs than other species [5,9]. 3.2. Base composition, genetic divergence and phylogenetic analyses DNA fragments of the LSU and ITS were amplified and sequenced for individuals representing 8 species of the genus Neoechinorhynchus: Fig. 2. Neoechinorhynchus (Neoechinorhynchus) mexicoensis sp. n., from Dormitator maculatus. (A) Male (holotype); (B) female (allotype); (C) anterior region of the male (holotype); (D) proboscis of the female (allotype); (E) posterior region of the female (allotype); (F) eggs (allotype). 767C.D. Pinacho-Pinacho et al. / Parasitology International 63 (2014) 763–771 68 N. (N.) mexicoensis sp. n., N. (N.) mamesi, N. (N.) brentnickoli, N. (N.) golvani, N. (N.) roseum, N. saginatus, N. (N.) schmidti and N. (N.) emyditoides. PCR products varied from 815 to 824 bp for LSU and from 700 to 749 bp for ITS. The interspecific genetic divergence of LSU esti- mated for N. (N.) mexicoensis, and the other congeneric species ranged from 1.65 to 32.9%; intraspecific divergence for Neoechinorhynchus Table 2 Comparative measurements for 19 species of Neoechinorhynchus from North America. Sizes are given as average (minimum–maximum). Apical hook Middle hook Posterior hook Length–width of the trunk N. (N.) australis Male (88–90) (47–59) (23–35) (3400–6500) (380–420) Female (88–90) (47–59) (23–35) (3600–10,700) (340–670) N. (N.) carpiodi Male 68 (65–75) 48 (44–51) 28 (26–35) 26,440 (21,200–33,520) 777 (600–868) Female 70 (67–71) 48 (44–53) 29 (25–36) 34,850 (25,500–48,100) 806 (660–906) N. (N.) crassus Male (71–100) (60–83) (40–71) (4000–7000) Female (88–105) (73–90) (40–71) (6000–9000) N. (N.) cristatus Male 48 (45–51) 28 (26–33) 25 (23–26) 3000 (2550–3555) 350 (300–400) Female 50 (45–59) 33 (29–38) 26 (24–32) 4750 (3850–8750) 430 (320–700) N. (N.) cylindratus Male (79–97) 37 (21–25) (4500–8500) Female (79–97) 37 (21–25) (10,000–15,000) N. (N.) distractus Male 59 41 23–29 (5900–7300) (350–380) Female 59 41 23–29 (8400–19,600) (380–670) N. (N.) limi Male 33 (29–37) 20 (17–24) 16 (13–19) (1060–2630) Female 35 (30–39) 22 (19–27) 18 (16–20) (1670–3800) N. (N.) notemigoni Male 26 (24–28) 23 (18–31) 19 (15–23) 3429 (2830–3700) 494 (396–576) Female 30 (26–39) 24 (20–29) 19 (17–24) 4917 (3300–6200) 555 (443–679) N. (N.) prolixoides Male 55–58 31–36 34–45 (4000–9000) Female 55–65 31–38 34–46 (6000–15,000) N. (N.) prolixus Male (42–56) 28 28 (5000–11,000) Female (42–56) 28 28 (7000–16,000) N. (N.) robertbaueri Male 55 (51–61) 44 (42–48) 33 (29–23) 2950 (2400–4000) 445 (280–560) Female 65 (61–67) 49 (45–54) 37 (35–42) 6600 (4480–8880) 690 (520–960) N. (N.) rutili Male (45–82) (26–44) (19–34) (2000–6000) Female (52–84) (29–46) (22–34) (5000–10,000) N. (N.) salmonis Male (49–64) (29–36) (20–26) 5600 (4500–7800) 800 (600–1100) Female (56–71) (28–40) (22–34) 8700 (5800–14,500) N. (N.) strigosus Male Hooks slightly smaller than in females. Hooks slightly smaller than in females Hooks slightly smaller than in females (3700–5500) Female 58 (53–64) 41 (32–53) (29–38) (9000–14,100) N. (N.) tenellus Male (90–110) 38 27 (2000–8000) Female (90–110) 38 27 (3500–13,000) (0.6) N. (N.) tumidus Male (69–84) (67–79) (40–53) (3000–5000) Female (75–84) (67–79) (45–53) (4000–12,000) N. (N.) venustus Male 48 (40–57) 50 (45–55) 34 (29–38) 5200 (2500–6400) Female 51 (45–57) 51 (49–57) 38 (35–41) 9150 (7750–12,750) 690 (550–1000) N. saginatus Male (58–67) (31–38) (27–32) (8000) (700–1400) Female (58–67) (31–38) (27–32) (20,000) (1250–2100) N. (N.) buckneri Male 38 (31–42) 33 (27–37) 25 (20–30) 7680 (5920–9730) 400 (320–500) Female 42 (37–48) 34 (27–42) 25 (22–30) 16,350 (12,500–23,750) 590 (500–800) 768 C.D. Pinacho-Pinacho et al. / Parasitology International 63 (2014) 763–771 69 ranged from 0 to 3.6% (Table 3). The interspecific genetic divergence of ITS forN. (N.)mexicoensis and the other congeneric species ranged from 7.34 to 44% and intraspecific divergence for Neoechinorhynchus ranged from 0 to 4.89%. The LSU dataset included 70 taxa, with 755 aligned characters. Max- imum likelihood (ML) analysis yielded a tree with a − ln likelihood = 4668.033. This tree is identical to the Bayesian inference (BI) consensus tree. Both trees show 8 major clades corresponding to 8 species N. (N.) Table 3 Genetic divergence estimated among 8 clades (species) and intraclade,with the LSU gene (LSU; uppermatrix) and ITS region (ITS; lowermatrix). Uncorrected P distances are expressed as percentages. ITS\LSU N.(N.) roseum N. saginatus N. (N.) schmidti N.(N.) emyditoides N. (N.) golvani N. (N.) brentnickoli N. (N.) mamesi N.(N.) mexicoensis sp. n. Intraclade LSU ITS N. (N.) roseus – 28.49–28.67 29.04–29.41 29.77–29.96 29.41–29.77 31.06–31.46 28.67–28.86 28.67–30.51 0.1 1.65 N. saginatus 43.06–43.46 – 9.55 9.07–9.37 29.59–29.77 32.72–32.90 29.96 30.33–30.16 0 0 N. (N.) schmidti 43.26 23.46 – 3.67 28.67–29.04 30.69–31.06 29.04–29.22 29.04–31.06 0.3 0 N. (N.) emyditoides 43.87–44.04 23.47–23.67 9.59–10.00 – 27.77–28.12 30.33–30.69 28.86 28.86–30.69 0.3 0.4 N. (N.) golvani 41.02–42.44 41.02–41.42 35.71–36.12 37.34–38.36 – 16.91–17.46 17.09–17.46 17.83–19.85 0–0.7 0.4–1.80 N. (N.) brentnickoli 40.40–41.02 38.77 38.57–38.77 37.55–37.95 29.59–30.81 – 7.72–7.90 8.08–9.74 0–0.1 0–0.20 N. (N.) mamesi 38.16–39.79 39.59–41.02 37.34–38.97 38.77–40.61 27.75–29.79 – 1.65–3.49 0 0–0.40 N. (N.) mexicoensis n. sp. 38.77–40.40 40.61–42.24 39.79–40.61 40.20–41.12 26.93–28.77 14.48–16.12 7.34–10.40 – 0–3.6 0–4.89 100/1 100/1 100/1 100/1 93/0.97 100/1 100/1 95/1 100/1 100/1 100/1 100/1 97/0.97 98/0.97 99/1 98/0.97 0.1 N. (N.) golvani F J388986 F. pacifica JQ436533 F. pacifica JQ436531 F. mugilis JQ436497 F. mugilis JQ436495 N. (N.) roseum FJ388999 N. (N.) roseum FJ389000 N. saginatus AY829091 N. (N.) schmidti HQ634786 N. (N.) schmidti HQ634785 N. (N.) emyditoides HQ634783 N. (N.) emyditoides HQ634784 N. (N.) golvani KC004138 N. (N.) golvani KC004139 N. (N.) golvani FJ968145 N. (N.) golvani KC004140 N. (N.) golvani KC004142 N. (N.) golvani FJ968146 N. (N.) golvani KC004141 N. (N.) golvani KC004144 N. (N.) golvani KC004143 N. (N.) golvani KC004145 N. (N.) brentnickoli FJ968159 N. (N.) brentnickoli FJ968156 N. (N.) brentnickoli KC004150 N. (N.) brentnickoli KC004146 N. (N.) brentnickoli KC004147 N. (N.) brentnickoli KC004148 N. (N.) brentnickoli FJ968157 N. (N.) brentnickoli KC004149 N. (N.) brentnickoli FJ968158 N. (N.) brentnickoli FJ388991 N. (N.) mamesi JN830771 N. (N.) mamesi JN830766 N. (N.) mamesi JN830763 N. (N.) mamesi JN830767 N. (N.) mamesi JN830769 N. (N.) mamesi JN830765 N. (N.) mamesi JN830772 N. (N.) mamesi JN830768 N. (N.) mamesi JN830773 N. (N.) mamesi JN830770 N. (N.) mamesi JN830774 N. (N.) mamesi JN830764 N. (N.) mexicoensis sp. n. KC004156 N. (N.) mexicoensis sp. n. KC004157 N. (N.) mexicoensis sp. n. KC004158 N. (N.) mexicoensis sp. n. KC004160 N. (N.) mexicoensis sp. n. KC004161 N. (N.) mexicoensis sp. n. KC004162 N. (N.) mexicoensis sp. n. KC004163 N. (N.) mexicoensis sp. n. KC004164 N. (N.) mexicoensis sp. n. KC004165 N. (N.) mexicoensis sp. n. KC004167 N. (N.) mexicoensis sp. n. KC004168 N. (N.) mexicoensis sp. n. KC004152 N. (N.) mexicoensis sp. n. KC004151 N. (N.) mexicoensis sp. n. KC004159 N. (N.) mexicoensis sp. n. KC004170 N. (N.) mexicoensis sp. n. FJ968154 N. (N.) mexicoensis sp. n. FJ388985 N. (N.) mexicoensis sp. n. FJ968155 N. (N.) mexicoensis sp. n. KC004171 N. (N.) mexicoensis sp. n. FJ968153 N. (N.) mexicoensis sp. n. KC004153 N. (N.) mexicoensis sp. n. KC004154 N. (N.) mexicoensis sp. n. KC004155 N. (N.) mexicoensis sp. n. FJ968152 N. (N.) mexicoensis sp. n. KC004169 N. (N.) mexicoensis sp. n. KC004166 100/1 Fig. 3. Maximum likelihood tree and consensus Bayesian inference trees inferred with LSU dataset. Numbers near internal nodes show ML bootstrap clade frequencies and posterior probabilities (BI). 769C.D. Pinacho-Pinacho et al. / Parasitology International 63 (2014) 763–771 70 mexicoensis, N. (N.) mamesi, N. (N.) brentnickoli, N. (N.) golvani, N. (N.) roseum, N. saginatus, N. (N.) schmidti and N. (N.) emyditoides. In both ML and BI phylogenetic trees, N. (N.) mexicoensis is sister to N. (N.) mamesi (Fig. 3). The ITS dataset included 69 taxa and 748 characters. Maximum like- lihood analysis yielded a tree with a − ln likelihood = 8242.136636. This tree is similar to the Bayesian inference tree. Both trees show eight clades, which are recognized as eight species. The 25 specimens from five localities along the Gulf of Mexico form a monophyletic group with 92% bootstrap support. The Bayesian tree also showed the same branch pattern as the ML tree and was well supported with posterior probability values. Our phylogenetic trees indicted that the new species is sister to N. (N.) mamesi with 99% bootstrap support and 1.0 of Bayesian posterior probability (Fig. 4). 4. Discussion N. (N.) mexicoensis represents the ninth species of the genus from Mexico and 17th from Central and South America. The phylogenetic trees inferred in the current study showed that the 8 species of Neoechinorhynchus represent independent clades. Both phylogenetic trees supported the sister relationship of the new species with N. (N.) mamesi. Morphologically N. (N.)mexicoensis differs from N. (N.)mamesi in the presence of a single giant nucleus in the ventral body wall of N. (N.) mexicoensis versus 2 nuclei in N. (N.) mamesi and in the egg length (41–47 in N. (N.)mexicoensis), versus (22–25 in N. (N.)mamesi). The genetic divergence found between N. (N.) mexicoensis, and N. (N.) mamesi ranged from 7.34 to 10.40% for ITS. These ranges are lower than for other species of neoechinorhynchids reported here (see Table 3). With respect to the LSU genetic divergence ranged from 1.65 to 3.49% and also is lower than other congeneric species (see Table 3). The level of genetic divergence between these species in the ITS region confirms that the ITS evolves faster than the LSU and that it is highly informative for distinguishing closely related species of neoechinorhynchids. Neoechinorhynchus is one of the most speciose genera within Acanthocephala and apparently North America is a hotspot of diversity for the genus [5]. Our results suggest that diversification of Neoechinorhynchus in Dormitator lineages is the result of codivergence i.e., N. (N.) mexicoensis is associated with D. maculatus restricted to the 100/1 100/1 100/1 100/1 100/1 100/1 71/0.5 100/1 100/1 100/0.86 99/1 100/1 99/1 100/1 92/1 0.2 F. mugilis KC004179 F. mugilis KC004178 F. mugilis KC004177 F. mugilis KC004176 N. (N.) schmidti KC004172 N. (N.) schmidti KC004173 N. (N.) emyditoides KC004174 N. (N.) emyditoides KC004175 N. (N.) roseum FJ388981 N. (N.) roseum FJ388980 N. (N.) golvani KC004219 N. (N.) golvani KC004221 N. (N.) golvani KC004222 N. (N.) golvani KC004224 N. (N.) golvani KC004220 N. (N.) golvani FJ968112 N. (N.) golvani FJ388967 N. (N.) golvani KC004223 N. (N.) golvani FJ968113 N. (N.) brentnickoli FJ968116 N. (N.) brentnickoli KC004180 N. (N.) brentnickoli KC004181 N. (N.) brentnickoli FJ968115 N. (N.) brentnickoli KC004182 N. (N.) brentnickoli FJ388972 N. (N.) brentnickoli KC004183 N. (N.) brentnickoli KC004184 N. (N.) brentnickoli FJ968114 N. (N.) brentnickoli FJ968117 N. (N.) mamesi KC004187 N. (N.) mamesi KC004188 N. (N.) mamesi KC004194 N. (N.) mamesi KC004197 N. (N.) mamesi KC004185 N. (N.) mamesi KC004186 N. (N.) mamesi KC004193 N. (N.) mamesi KC004196 N. (N.) mamesi KC004191 N. (N.) mamesi KC004190 N. (N.) mamesi KC004195 N. (N.) mamesi KC004192 N. (N.) mamesi KC004189 N. (N.) mamesi KC004198 N. (N.) mexicoensis sp. n. FJ388966 N. (N.) mexicoensis sp. n. KC004199 N. (N.) mexicoensis sp. n. FJ968108 N. (N.) mexicoensis sp. n. KC004200 N. (N.) mexicoensis sp. n. KC004201 N. (N.) mexicoensis sp. n. KC004205 N. (N.) mexicoensis sp. n. KC004208 N. (N.) mexicoensis sp. n. KC004215 N. (N.) mexicoensis sp. n. KC004207 N. (N.) mexicoensis sp. n. FJ968110 N. (N.) mexicoensis sp. n. FJ968109 N. (N.) mexicoensis sp. n. FJ968111 N. (N.) mexicoensis sp. n. KC004204 N. (N.) mexicoensis sp. n. KC004202 N. (N.) mexicoensis sp. n. KC004217 N. (N.) mexicoensis sp. n. KC004216 N. (N.) mexicoensis sp. n. KC004214 N. (N.) mexicoensis sp. n. KC004218 N. (N.) mexicoensis sp. n. KC004206 N. (N.) mexicoensis sp. n. KC004212 N. (N.) mexicoensis sp. n. KC004210 N. (N.) mexicoensis sp. n. KC004213 N. (N.) mexicoensis sp. n. KC004211 N. (N.) mexicoensis sp. n. KC004209 N. (N.) mexicoensis sp. n. KC004203 N. saginatus FJ388984 Fig. 4. Maximum likelihood tree and consensus Bayesian inference trees inferred with ITS dataset. Numbers near internal nodes show ML bootstrap clade frequencies and posterior probabilities (BI). 770 C.D. Pinacho-Pinacho et al. / Parasitology International 63 (2014) 763–771 71 Atlantic Ocean, whereas 2 other species of Neoechinorhynchus are asso- ciated with Dormitator latifrons (Richardson, 1844) from the Pacific Ocean; N. (N.) brentnickoli is distributed from the North Pacific Ocean slopes to the Isthmus of Tehuantepec, Oaxaca, Mexico, whereas N. (N.) mamesi is distributed from south of the Isthmus of Tehuantepec to the Chiapas coast of Mexico [8]. The divergence time of D. maculatus and D. latifrons was estimated between 5.6 and 7.9 mya [20]. The tectonic evolution of the Gulf of Mexico, Caribbean and northern South America in the last 200 my is very complex [21], and the complete closure of the Isthmus of Panama, which occurred at approximately 3.5–3.1 mya [22], could have played a major role in the diversification of the definitive hosts (D. maculatus and D. latifrons) and their parasites. Based on this evidence the probability of finding new species of Neoechinorhynchus associated with fish in the genus Dormitator in Central and South America is probable. To test this hypothesis, future studies should be performed using mitochondrial and nuclear genes of specimens from these biogeographical regions. 5. Conclusions The morphological data, in combination with the high genetic divergence estimated for each molecular marker (LSU and ITS) and the reciprocal monophyly of the 25 specimens collected in 5 localities from the Gulf of Mexico, in the phylogenetic trees clearly demonstrate that the specimens associated with fat sleeper fish represent a new taxon, which is named N. (N.) mexicoensis. Acknowledgments We are grateful to Luis García Prieto for providing specimens of Neoechinorhynchus from the CNHE, Laura Marquez for her help with the use of the DNA sequencer, and David Ivan Guadalupe Hernández Mena for his support during field work. This research was supported by grants from the Programa de Apoyo a Proyectos de Investigación e Inovación Tecnológica (PAPIIT No. IN207213) and the Consejo Nacional de Ciencia y Tecnología (No. 179048). CDPP thanks CONACyT for the scholarship and the Posgrado en Ciencias Biológicas, Universidad Nacional Autónoma de México. References [1] Miller RR, Minckley WL, Norris SM. Freshwater fishes of Mexico. Chicago, Illinois: The University of Chicago Press; 2005 [559 pp.]. [2] Franco LJ, Chávez R, Peláez E, Bedia C. Riqueza ictiofaunística del sistema lagunar de Alvarado, Veracruz. Rev Zool 1996;2:17–32. [3] Amin OM. Classification of the Acanthocephala. Folia Parasitol 2013;60:273–305. [4] Smales LR. A review of the genus Neoechinorhynchus (Acanthocephala: Neoechinorhynchidae) from Australia with the description of two new species. J Parasitol 2013;99:1106–12. [5] Amin OM. Revision of Neoechinorhynchus Stiles and Hassall, 1905 (Acanthocephala: Neoechinorhynchidae) with keys to 88 species in two subgenera. Syst Parasitol 2002;53:1–18. [6] Barger MA, Thatcher EV, Nickol BB. A new species of Neoechinorhynchus (Acanthocephala: Neoechinorhynchidae) from a red-eared slider (Trachemys scripta elegans) in Mexico. Comp Parasitol 2004;71:1–3. [7] Amin OM, Heckmann R. Description of Neoechinorhynchus (Neoechinorhynchus) buckneri n. sp. from the blacktailed redhorseMoxostoma poecilurum (Catostomidae) in the Tchoutacabouffa River, Mississippi, with a key to species ofNeoechinorhynchus with different dorsoventral body wall thickness. Comp Parasitol 2009;76:154–61. [8] Pinacho-Pinacho CD, Pérez-Ponce De León G, García-Varela M. Description of a new species of Neoechinorhynchus (Acanthocephala: Neoechinorhynchidae) a parasite of Dormitator latifrons from Southwestern Mexico based on morphological and molecular characters. Parasitol Int 2012;61:634–44. [9] Salgado-Maldonado G. Redescription of Neoechinorhynchus (Neoechinorhynchus) golvani Salgado-Maldonado, 1978 (Acanthocephala: Neoechinorhynchidae) and description of a new species from freshwater cichlids (Teleostei: Cichlidae) in Mexico. Parasitol Res 2013;112:1891–901. [10] García-Prieto L, García-Varela M, Mendoza-Garfias B, Pérez-Ponce De León G. Checklist of the Acanthocephala in wildlife vertebrates of Mexico. Zootaxa 2010; 2419:1–50. [11] Monks S, Pulido-Flores G, Violante-González J. A new species of Neoechinorhynchus (Acanthocephala: Neoechinorhynchidae) in Dormitator latifrons (Perciformes: Eleotridae) from the Pacific Coast of Mexico. Comp Parasitol 2011;78:21–8. [12] Bowles J, Blair D, McManus DP. A molecular phylogeny of the human schistosomes. Mol Phylogenet Evol 1995;4:103–9. [13] García-Varela M, Nadler SA. Phylogenetic relationships of Palaeacanthocephala (Acanthocephala) inferred from SSU and LSU rDNA gene sequences. J Parasitol 2005;91:1401–9. [14] Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG. The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res 1997;25:4876–82. [15] Maddison DR, Maddison WP. MacClade version 4.0. Sunderland, Massachusetts: Sinauer Associates; 2002. [16] Posada D. jModelTest: phylogenetic model averaging. Mol Biol Evol 2008; 25:1253–6. [17] Stamatakis A. RAxML-VI-HPC: maximum likelihood-based phylogenetic analyses with thousands of taxa and mixed models. Bioinformatics 2006;22:2688–90. [18] Huelsenbeck JP, Ronquist F. MRBAYES: Bayesian inference of phylogenetic trees. Bioinformatics 2001;17:754–5. [19] Rambaut A. FigTree v1.3.1. Institute of Evolutionary Biology. University of Edinburgh; 2006. [20] Thacker CE, Hardman MA. Molecular phylogeny of basal gobioid fishes: Rhyacichthyidae, Odontobutidae, Xenisthmidae, Eleotridae (Teleostei: Perciformes: Gobioidei). Mol Phylogenet Evol 2005;37:858–71. [21] James KH, Lorente MA, Pindell JL. The origin and evolution of the Caribbean Plate. The Geological Society London, special publication; 2009 [328 pp.]. [22] Coates AG, Obando JA. The geologic evolution of the Central American Isthmus. In: Jackson JBC, Budd AF, Coates AG, editors. Evolution and environment in tropical America. Chicago, Illinois: The University of Chicago Press; 1996. p. 21–56. 771C.D. Pinacho-Pinacho et al. / Parasitology International 63 (2014) 763–771 72         3. 3. Artículo III Checklist of the species of Neoechinorhynchus (Acanthocephala: Neoechinorhynchidae) in fishes and turtles in Middle-America, and their delimitation based on sequences of the 28S rDNA Carlos Daniel Pinacho-Pinacho, Ana L. Sereno-Uribe, Gerardo Pérez- Ponce de León, Martín García-Varela Zootaxa (2015) 3985: 098–116 Magnolia Press 73 98 Accepted by S. Monks: 15 Jun. 2015; published: 9 Jul. 2015 ZOOTAXA ISSN 1175-5326 (print edition) ISSN 1175-5334 (online edition)Copyright © 2015 Magnolia Press Zootaxa 3985 (1): 098–116 www.mapress.com/zootaxa/ Article http://dx.doi.org/10.11646/zootaxa.3985.1.5 http://zoobank.org/urn:lsid:zoobank.org:pub:E6FF2FAB-4C99-4E4A-8E56-8D9B5A161474 Checklist of the species of Neoechinorhynchus (Acanthocephala: Neoechinorhynchidae) in fishes and turtles in Middle-America, and their delimitation based on sequences of the 28S rDNA CARLOS DANIEL PINACHO-PINACHO1, ANA L. SERENO-URIBE2, GERARDO PÉREZ-PONCE DE LEÓN2 & MARTÍN GARCÍA-VARELA2,3 1Posgrado en Ciencias Biológicas, Instituto de Biología, Universidad Nacional Autónoma de México, A. P. 70-153, C. P. 04510, Méx- ico D. F., México 2Departamento de Zoología, Instituto de Biología, Universidad Nacional Autónoma de México, A. P. 70-153, C.P. 04510. México. D.F. México 3Corresponding author. E-mail: garciav@ib.unam.mx Abstract Among the acanthocephalans, Neoechinorhynchus is one of the most speciose genera, with 116 described species distrib- uted worldwide. The adults of Neoechinorhynchus are found in the intestine of freshwater and brackish water fish, as well as in freshwater turtles. In this study, a checklist of the congeneric species of Neoechinorhynchus occurring in Middle- American fish and turtles is presented. The checklist contains the records established in all published accounts, as well as novel data from survey work conducted in the region comprising Neotropical areas of Mexico, as well as some localities in Central America. The species delimitation criteria used to discriminate among species is based on molecular data. In the last years, a large database derived from sequences of the D2 + D3 domains of the large subunit of rDNA (28S) was generated for 262 specimens corresponding to nine species of Neoechinorhynchus. This molecular marker has shown to be useful in establishing species limits within Neoechinorhynchus and in resolving phylogenetic relationships at species level. Based on our results, the domains D2 + D3 of the 28S rDNA could be considered as potential DNA barcodes to complement mitochondrial DNA to discriminate among acanthocephalan species. Key words: Acanthocephala, Neoechinorhynchus, 28S rDNA, species delimitation, Middle-America Introduction Middle-America is one of the most complex biogeographical areas in the world (Contreras-Balderas & Lozano- Vilano 1996; Morrone 2002; Zaldivar-Riveron et al. 2004; Huidobro et al. 2006). This complexity reflects the confluence of Neotropical and Nearctic biotas with a long history of geological activity (Iturralde-Vinent & MacPhee 1999; Guzman-Speziale et al. 2005); such activity created barriers and land-bridges that have affected the distribution of freshwater fishes (Bermingham & Martin 1998; Martin & Bermingham 1998; Mateos 2005). Also, it has been postulated that during the Pliocene (~3.3 Mya) took place the closure of the Panama Isthmus, resulting in faunal exchange between the Neartic and Neotropical biogeographical regions and in a barrier that separated the Pacific Ocean and Atlantic Ocean (Bussing 1985). Species of Neoechinorhynchus Hamann 1892 are endoparasites of freshwater and brackish water fish, and freshwater turtles, with approximately 116 described species divided into two subgenera: Neoechinorhynchus and Hebesoma Van Cleave 1928, both distributed worldwide (Amin 2013; Smales 2013). A total of 49 species have been described from the Americas, 33 from North America and 16 from Central and South America (Amin 2002; Barger et al. 2004; Amin & Heckmann 2009; Pinacho-Pinacho et al. 2012, 2014). Some morphological traits such as the proboscis shape, number and size of hooks, proboscis receptacle shape and in the shape of anterior region of the trunk, have been traditionally used to diagnose and delimit congeneric species. However, the identification of various species of the genus Neoechinorhynchus is rather difficult due to the morphological variability exhibited by some of these traits, resulting in a problematic species differentiation. 74 Zootaxa 3985 (1) © 2015 Magnolia Press · 99NEOECHYNORHYNCHUS FROM MIDDLE AMERICA Recently, the advantage of using molecular tools to establish a more robust species delimitation has been demonstrated, as well as to recognize the existence of cryptic species (Nolan & Cribb 2005; Pérez-Ponce de León & Nadler 2010; Nadler & Pérez-Ponce de León 2011). Ribosomal genes and their related spacer are among the most useful molecular markers for phylogenetic analyses in acanthocephalans (Steinauer et al. 2007; Martínez- Aquino et al. 2009; García-Varela et al. 2011; Rosas-Valdez et al. 2012; Pinacho-Pinacho et al. 2012; Malyarchuck et al. 2014; García-Varela & Pérez-Ponce de León 2015). The large subunit from ribosomal DNA (LSU), which is a mosaic of several variable and conservative fragments, is often regarded as a phylogenetic marker. Particularly the domains (D2 + D3) from LSU have been widely used for delimitation of species within acanthocephalans with well results (Martínez-Aquino et al. 2009; Garcia-Varela et al. 2011; Rosas-Valdez et al. 2012; Pinacho-Pinacho et al. 2012). If recent studies are any indication, it is likely that only a part of the actual Middle-American diversity of species of Neoechinorhynchus has been described. In the current study, nine species of Neoechinorhynchus are included: two of these occur in freshwater turtles, N. (N.) schmidti Barger, Thatcher & Nickol, 2004 and N. (N.) emyditoides Fisher, 1960), and the other seven species occur in marine, brackish and freshwater fishes, N. (N.) roseum Salgado-Maldonado 1978; N. (N.) golvani, Salgado-Maldonado 1978; N. (N.) chimalapasensis Salgado- Maldonado, Caspeta-Mandujano & Martínez-Ramírez, 2010; N. (N.) brentnickoli Monks, Pulido-Flores & Violante-González, 2011; N. (N.) mamesi Pinacho-Pinacho, Peréz-Ponce de Léon & García-Varela, 2012; N. (N.) panucensis Salgado-Maldonado 2013, and N. (N.) mexicoensis Pinacho-Pinacho, Sereno-Uribe & García-Varela 2014 (Aguirre-Macedo et al. 2001; García-Prieto et al. 2010; Monks et al. 2011; Pinacho-Pinacho et al. 2012; Salgado-Maldonado 2013; Pinacho-Pinacho et al. 2014). In this study, a checklist of species of the genus Neoechinorhynchus occurring in brackish and freshwater fishes, and freshwater turtles in Middle-America is presented. The delimitation among species included in this checklist was validated through an analysis of the DNA sequences of the 28S rDNA gene, and the potential use of this molecular marker as a DNA barcode is briefly discussed. Material and methods Parasite-host list. The species list we present herein consist of all the published records of Neoechinorhynchus made up to November 2014. Information was obtained from two main sources: 1) a retrospective bibliographic search in databases such as CAB abstracts, Biological Abstract, Zoological Record, Helminthological Abstract, and ISI Web of Knowledge. This search guarantee we retrieved all possible published accounts; and 2) a search of the database of the Colección Nacional de Helmintos CNHE, Instituto de Biología, UNAM, Mexico City, Mexico) which also contain the records of congeneric species deposited in foreign parasite collections such as the Harold W. Manter Laboratory of Parasitology HWML, University of Nebraska-Lincoln, and the National Museum of Natural History (NMNH) at the Department of Invertebrate Zoology Collections, Smithsonian Institution, Washington, D.C. (formerly, United States National Parasite Collection, USNPC), both in the U.S.A., and those deposited in the British Museum on Natural History (BMNH), London, U.K. In addition, we provide information of the specimens of Neoechinorhynchus of fishes and freshwater turtles from several localities of Mexico, Guatemala, Honduras and Costa Rica that were collected in the last two years as a result of our ongoing research programs describing parasite biodiversity. The checklist is presented in alphabetical order, by species of Neoechinorhynchus. Each species is followed by the authority name and publication year in bold. Since most records correspond to localities within Mexican territory, information of each record is organized alphabetically by state of the Mexican Republic (in capital letters), and each record includes the locality name, geographical coordinates for each locality, the host (s) species, followed by the bibliographic reference. For localities of Central American countries, each locality is presented within a section containing the name of the country, followed by the particular locality name, their geographical coordinates, host (s) species, and bibliographic reference. When we present original records derived from our survey work, instead of reference we include the term "this study", in bold. At the end of each acanthocephalan species record, the accession numbers of the specimens to parasite collections is presented following the acronym. Sample collection. Fishes were captured with seine nets and electrofishing whereas freshwater turtles were captures with seine nets. Hosts were maintained alive and transported to laboratory, and studied for helminths a few 75 PINACHO-PINACHO ET AL. 100 · Zootaxa 3985 (1) © 2015 Magnolia Press hours after their capture; individual hosts were killed by pithing and and the intestine was examined for parasites under a dissecting microscope. The worms relax in distilled water for 10–12 h at 4°C. Later, all the specimens were preserved in 100% ethanol, and stored at 4°C. For taxonomic identification, some specimens were stained with Mayers paracarmine, dehydrated in a graded ethanol series, cleared with methyl salicylate, and mounted on permanent slides with Canada balsam, and were deposited in the Colección Nacional de Helmintos (CNHE), Instituto de Biología, Universidad Nacional Autónoma de México. Each species was identified following the keys of Amin (2002) and Salgado-Maldonado (2013) and using the original descriptions to each species (see Pinacho- Pinacho et al. 2012, 2014). Specimens of nine species of Neoechinorhynchus were collected from the intestines of their definitive hosts in 46 localities across of Mexico, one locality in Guatemala, and four localities in Costa Rica (Fig. 1; Table 1). In some cases, we collected new samples from the type localities, since original descriptions of some acanthocephalans (e.g., Salgado-Maldonado et al. 2010; Salgado-Maldonado 2013), did not include other sources of information other than morphology based on light microscopy. However, in the current study a combination of morphological data plus DNA sequences, were generated and it is a common practice in the modern taxonomic studies of this group of parasites. FIGURE 1. Map showing the localities of Neoechinorhynchus spp. Numbers of localities correspond with the numbers presented in Table 1. DNA from specimens from localities 1-51 (CS in Table 1) was analyzed for this study. DNA extraction, amplification and sequencing. Adult acanthocephalans were digested overnight at 56°C in a solution containing 10 mM Tris-HCl (pH=7.6), 20 mM NaCl, 100 mM Na 2 EDTA (pH=8.0), 1% Sarkosyl and 0.1 mg/ml proteinase K. Following digestion, we extracted DNA from the supernatant using the DNAzol reagent (Molecular Research Center, Cincinnati, OH, USA) according to the manufacturer’s instructions. The 5’ end the 28S rDNA gene containing the domains D2 + D3 were amplified using forward primer 502 (5’- CAAGTACCGTGAGGGAAAGTTGC-3’) with the reverse primer 536 (5’-GTCGATAGGACTCCCTTTG-3’) (García-Varela & Nadler 2005). PCR reactions (25 µl) consisted of 10 µM of each primers, 2.5 µl of 10x buffer, 2 mM MgCl 2 and 1 U of Taq DNA polymerase (Platinum Taq, Invitrogen Corporation, São Paulo, Brazil). PCR amplification consisted of an initial denaturation step at 94°C for 1 min, followed by 35 cycles of denaturation at 94°C for 1 min, annealing at 50°C for 1 min, and extension at 72°C for 1 min, followed by a post-amplification 76 Zootaxa 3985 (1) © 2015 Magnolia Press · 101NEOECHYNORHYNCHUS FROM MIDDLE AMERICA incubation at 72°C for 10 min. Sequencing reactions were performed using ABI Big Dye (Applied Biosystems, Boston, MA) terminator sequencing chemistry, and reaction products were separated and detected using ABI 3730 capillary DNA sequencer. Sequences were edited using CodonCode Aligner Version 3.5.4 (CodonCode corporation, Dedham, MA). GenBank accession numbers for all sequences are given in Table 1. Alignment, phylogenetic analysis and genetic divergence. Sequences obtained in the current research from 28S rDNA were aligned with ClustalW (Thompson et al. 1994) using default parameters. Alignment length was 806 base pairs (bp). The best model was identified with the Akaike Information Criterion (AIC) implemented with the jModelTest v0.1.1 program (Posada 2008). We constructed phylogenetic trees using both maximum likelihood (ML) and Bayesian analyses. For ML analyses, the program MEGA version 5 (Tamura et al. 2011) was used. A GTR+G+I substitution model was used for ML analyses, and 1000 bootstrap replicates were run to assess nodal support. We estimated gene trees using MrBayes 3.1.2 (Huelsenbeck & Ronquist 2001), with two runs and four chains (one cold, three heated) per run. The Metropolis-coupled Markov chain Monte Carlo (MC3) were run for 5 million generations, sampled every 1000 generations, and the firs 1, 250 samples were discarded as burn-in (25%). The outputs of MrBayes were examined with Tracer v1.4 (Rambaut & Drummond 2007) to check for convergence of different parameters, determine the approximate number of generation at which log likelihood values stabilized, identify the effective sample size (EES) for each parameter, and the estimated magnitude of model parameters in individual and combined runs. Topological convergence in the two independent MCMC runs was checked with the compare plot in AWTY (Wilgenbusch et al. 2004). The initial 25% of MCMC was verified to include all the generations before stationary was archived. Posterior probabilities (PP) of clade were obtained from the 50% majority rule consensus of sample trees after excluding the initial 25% as burn-in. Sequences of Floridosentis pacifica (JQ36533, JQ436531) and F. mugilis (JQ436497, JQ436495) were used as the outgroup for all phylogenetic analyses. The intra and interspecific genetic variation of Neoechinorhynchus was determined using the Kimura 2-parameter distance (K2P) with the program MEGA version 5 (Tamura et al. 2011), with analytical method and with a nucleotide substitution (transitions+transversions) and uniform rate. Results Parasite-host list. The Checklist contains information for nine species of Neoechinorhynchus , which were found in 55 species of fish, and one species of freshwater turtles. The records were made in 87 localities comprising five countries, including Mexico, Guatemala, Nicaragua, Honduras, and Costa Rica. Particularly in Mexico, the list contains records pertaining to 17 of the 32 states of the Mexican Republic. Acronyms CNHE Colección Nacional de Helmintos, Instituto de Biología, UNAM, Mexico City, Mexico. HWML Harold W. Manter Laboratory of Parasitology, University of Nebraska-Lincoln, Nebraska United States. USNPC United States National Parasite Collection, U.S. Department of Agriculture, Beltsville, Maryland, United States. Neoechinorhynchus (Neoechinorhynchus) brentnickoli Monks, Pulido-Flores & Violante-González, 2011 (Fig. 2a) Mexico: BAJA CALIFORNIA SUR: Oasis San José del Cabo (23°3’32’’N 109°41’28.8’’W; 23°3’30.8’’N 109°41’28.1’’W); Dormitator latifrons, Eleotris picta (Méndez et al. 2010). Todos los Santos (23°26’14.3’’N 110°14’22.7’’W); Dormitator latifrons (this study). COLIMA: Laguna de Cuyutlán (19°2’58.6’’N 104°15’58.2’’W); Dormitator latifrons (Pinacho-Pinacho et al. 2012). GUERRERO: Laguna de Tres Palos (16°41’0’’N 99°37’00’’W; 16°48’0’’N 99°47’0’’W; 16°47’47’’N 99°44’30’’W; 16°47’00’’N 99°39’00’’W); Dormitator latifrons (Garrido-Olvera et al. 2004; Violante-González et al. 2007; Martínez-Aquino et al. 2009; Monks et al. 2011; García-Varela et al. 2011; Pinacho-Pinacho et al. 2012); Centropomus nigrescens, Centropomus 77 PINACHO-PINACHO ET AL. 102 · Zootaxa 3985 (1) © 2015 Magnolia Press robalito, Diapterus peruvianus, Cichlasoma trimaculatum, Gobiomorus maculatus, Eleotris picta, Ctenogobius sagittula and Lutjanus argentiventris (Violante-González et al. 2007). Laguna de Coyuca (16°57’0’’N 100°2’0’’W); Dormitator latifrons (Violante-González & Aguirre-Macedo 2007; Pinacho-Pinacho et al. 2012); Centropomus nigrescens, Cichlasoma trimaculatum, Eleotris picta, Gobiomorus maculatus and Lutjanus argentiventris (Violante-González & Aguirre-Macedo 2007). Río Tamarindo, Chautengo (16°38’7.5’’N 99°8’26.4’’W); Dormitator latifrons (Pinacho-Pinacho et al. 2012). JALISCO: Río Cuitzmala (19°23’27’’N 104°58’28’’W); Dormitator latifrons (Martínez-Aquino et al. 2009); Agonostomus monticola (Mayén-Peña 2003). Estero Chamela (19°31’20’’N 104°4’53’’W; 19°31’0’’N 105°6’0’’W); Dormitator latifrons (Martínez-Aquino et al. 2009; Monks et al. 2011). Marismas de Chalacatepec; Dormitator latifrons (Mayén-Peña 2003). Río San Nicolás; Dormitator latifrons (Mayén-Peña 2003). MICHOACAN: Estero Barra de Pichi (17°58’41.5’’N 102°19’30’’W); Dormitator latifrons (Pinacho-Pinacho et al. 2012). Estero Mexcalhuacan (18°3’21.5’’N 102°39’29.8’’W); Dormitator latifrons (Pinacho-Pinacho et al. 2012). Estero Huahua (18°10’39.7’’N 103°0’26.3’’W); Dormitator latifrons (Pinacho-Pinacho et al. 2012). Estero Boca de Apiza (18°41’14.46’’N 103°44’4.96’’W); Dormitator latifrons (Pinacho-Pinacho et al. 2012). NAYARIT: Nuevo Vallarta (20°40’54.8’’N 105°16’46.1’’W); Dormitator latifrons (this study). SINALOA: El Huizache (23°6’47.2’’N 106°13’45’’W); Dormitator latifrons (this study). Vía Ferrea, Escuinapa (22°49’50.1’’N 104°48’19.4’’W); Dormitator latifrons (this study). Mazatlán (23°13’0’’N 106°25’0’’W); Dormitator latifrons (Monks et al. 2011). Topolobampo (25°36’10’’N 109°1’13’’W); Dormitator latifrons (this study). Specimens deposited. CNHE (8586, 8178, 8175, 8179, 8589, 8174, 8173, 8177, 8176, 8587, 8588, 7540, 7537, 7188, 7142, 7141, 6819, 6817, 6816, 6766, 6121, 6120, 6119, 6118, 6077, 6073, 5989, 4920, 4347). Notes. This species was originally recognized as a cryptic species of N. (N.) golvani by Martínez-Aquino et al. (2009) as a parasite of eleotrid fishes in coastal waters of the Mexican Pacific Ocean, and later described on morphological grounds by Monks et al. (2011). Neoechinorhynchus (Neoechinorhynchus) chimalapasensis Salgado-Maldonado, Caspeta-Mandujano & Martínez-Ramírez, 2010 (Fig. 2b) Mexico: OAXACA: Río Negro, Santa María Chimalapas (16°53’54.7’’N 94°41’37.3’’W); Awaous banana (Salgado-Maldonado et al. 2010) and (this study). Río Grande, Vistahermosa (16°47’29.76’’N 95°01’01.17’’W); Awaous banana (this study). Specimens deposited. CNHE (5018, 5019, 5020) Notes. This species was originally described solely based on morphology by Salgado-Maldonado et al. (2010), and not DNA sequences were generated. Neoechinorhynchus (Neoechinorhynchus) emyditoides Fisher, 1960 (Fig. 2c) Mexico: NUEVO LEÓN: Presa la Herradura (25°54’15’’N 98°52’6’’W); Trachemys scripta (García-Varela et al. 2011). VERACRUZ: Lago de Catemaco (18°25’0’’N 95°7’0’’W); Trachemys scripta (García-Varela et al. 2011). Laguna de Alvarado; (18°45’0’’N 95°45’0’’W) Trachemys scripta (Barger 2004). Río Papaloapan, Tlacotalpan (18°42’13.4’’N 95°45’27.9’’W); Trachemys scripta (García-Varela et al. 2011). Specimens deposited. CNHE (6695-6696, 6737), HWML (45557), HWML (45560), HWML (45557), HWML (45558), USNPC (832354). Notes. This species was described from Trachemys scripta in Arkansas and Mississippi USA by Fisher (1960). Later this species was recorded in several localities of North America (Barger 2004). In Mexico the first record of N. (N.) emyditoides was made by Bravo-Hollis in 1946, however it was described as N. (N.) emydis. Later Barger (2004), Barger et al. (2004), mentioned that N. (N.) emydis is restricted the eastern half of the upper Mississippi river. 78 Zootaxa 3985 (1) © 2015 Magnolia Press · 103NEOECHYNORHYNCHUS FROM MIDDLE AMERICA FIGURE 2. Males of species of Neoechinorhynchus known from Middle-America. a) N. (N.) brentnickoli Monks, Pulido- Flores & Violante-González, 2011. b) N. (N.) chimalapasensis Salgado-Maldonado, Caspeta-Mandujano & Martínez-Ramírez, 2010. c) N. (N.) emyditoides Fisher, 1960. d) N. (N.) golvani Salgado-Maldonado, 1978. e) N. (N.) mamesi Pinacho-Pinacho, Pérez-Ponce de León & García-Varela 2012. f) N. (N.) mexicoensis Pinacho-Pinacho, Sereno-Uribe & García-Varela, 2014. g) N. (N.) panucensis Salgado-Maldonado, 2013. h) N. (N.) roseum Salgado-Maldonado, 1978. i) N. (N.) schmidti Barger, Thatcher & Nickol, 2004. Scale bars = 1.0 mm Neoechinorhynchus (Neoechinorhynchus) golvani Salgado-Maldonado, 1978 (Fig. 2d) Mexico: CAMPECHE: Hool (19°30’51.82’’N 90°26’55.13’’W); Thorichthys meeki (this study). Lago el Centenario (18°37’50’’N 91°56’21’’W); Amphilophus robertsoni, Cichlasoma rectangulare, Cichlasoma urophthalmum, Parachromis managuensis and Petenia splendida (Salgado-Maldonado et al. 1997); Herichthys pearsei and Vieja synspila (Vidal-Martínez 1995). Laguna El Vapor (18°18’38’’N 91°50’9’’W); Cichlasoma geddesi, Cichlasoma urophthalmum, Herichthys pearsei, Parachromis managuensis and Petenia splendida (Pineda-López 1994; Salgado-Maldonado et al. 1997); Cichlasoma urophthalmum (Vidal-Martínez 1995; Salgado- Maldonado & Kennedy 1997); Petenia splendida (Vidal-Martínez 1995). Laguna de Términos, Río Palizada 79 PINACHO-PINACHO ET AL. 104 · Zootaxa 3985 (1) © 2015 Magnolia Press (18°17’16’’N 91°56’52’’W); Cichlasoma urophthalmum (Salgado-Maldonado & Kennedy 1997; Salgado- Maldonado et al. 1997). Laguna de Términos, el Cayo (18°30’10’’N 91°41’20’’W); Cichlasoma urophthalmum (Salgado-Maldonado & Kennedy 1997; Salgado-Maldonado et al. 1997). Laguna de Términos, Santa Gertrudis (18°26’51’’N 91°49’38’’W); Cichlasoma urophthalmum (Salgado-Maldonado et al. 1997). Lago Atasta (18°37’8’’N 92°6’15’’W); Cichlasoma urophthalmum and Paraneetroplus synspilus (Vidal-Martínez 1995; Salgado-Maldonado et al. 1997). Río Champotón (19°21’0’’N 90°40’0’’W); Cichlasoma urophthalmum (Salgado- Maldonado et al. 1997); Thorichthys helleri (Salgado-Maldonado 2013). Laguna de Términos, Llanuras (18°19’13’’N 91°44’36’’W); Paraneetroplus synspilus (Vidal-Martínez & Kennedy 2000). Silvituc (18°37’0’’N 91°56’0’’W); Amphilophus robertsoni, Paraneetroplus synspilus and Paraneetroplus bifasciatus (Salgado- Maldonado 2013). CHIAPAS: Presa Chicoasen (16°56’2’’N 93°5’16’’W); Vieja pearsei (Martínez-Aquino et al. 2009; García-Varela et al. 2011; Pinacho-Pinacho et al. 2012). Presa Nezahualcoyolt (17°10’49’’N 93°36’49’’W); Vieja pearsei (Martínez-Aquino et al. 2009; Pinacho-Pinacho et al. 2012). Río Lacantún, el Remolino (16°14’46’’N 90°50’8’’W); Cichlasoma urophthalmum and Thorichthys helleri (Salgado-Maldonado et al. 2011). Río San Pedro, Tzendales (16°17’54’’N 90°53’13’’W); Petenia splendida (Salgado-Maldonado et al. 2011). Río la Urbina (15°46’27’’N 93°15’21’’W); Gobiomorus maculatus (Salgado-Maldonado et al. 2011). GUERRERO: Presa Tepecoacuilco (18°18’1’’N 99°28’16’’W); Cichlasoma istlanum (Salgado-Maldonado et al. 2001a; Salgado- Maldonado 2013); Amphilophus macracanthus (Salgado-Maldonado 2013). HIDALGO: Río Tempoal, Atlapexco (20°55’16’’N 98°17’27’’W); Amatitlania nigrofasciata, Herichthys cyanoguttatus and Herichthys labridens (Salgado-Maldonado et al. 2004); Herichthys labridens (Salgado-Maldonado 2013). NAYARIT: Río Santiago, Presa Aguamilpa (21°46’42’’N 104°55’36’’W); Cichlasoma beani (Salgado-Maldonado et al. 2001b; Salgado- Maldonado 2013). OAXACA: Temascal (18°14’13’’N 96°25’0.27’’W); Cichlasoma urophthalmum, Cichlasoma salvini (this study); Petenia splendida (Morales-Sosa 2008; Salgado-Maldonado 2013). San Juan Evangelista; Rocio octofasciata, Thorichthys ellioti (Salgado-Maldonado 2013). TABASCO: Río Carrizal (18°1’45’’N 92°55’0’’W); Cichlasoma urophthalmum (Martínez-Aquino et al. 2009; Pinacho-Pinacho et al. 2012; García- Varela et al. 2011). Lago Canitzan, Tenosique (17°28’57’’N 91°25’27’’W); Parachromis friedrichstalii (Martínez- Aquino et al. 2009; Pinacho-Pinacho et al. 2012). Laguna las Ilusiones (17°59’46’’N 92°56’17’’W); Cichlasoma urophthalmum (Pérez-Ponce de León et al. 1996; Martínez-Aquino et al. 2009; Pinacho-Pinacho et al. 2012); Cichlasoma salvini (Vidal-Martínez et al. 2001); Thorichthys helleri, Thorichthys pasionis and Paraneetroplus synspilus (Ramírez-Jiménez 1993; García-Magaña 1990; Pineda-López 1994; Salgado-Maldonado et al. 1997). Lago el Rosario (17°50’0’’N 93°45’0’’W); Ariopsis felis, Cathorops melanopus, Paraneetroplus synspilus and Hyporhamphus mexicanus (Fucugauchi-Suárez del Real et al. 1988); Strongylura sp. (Fucugauchi-Suárez del Real et al. 1988; Vidal-Martínez 1995); Cichlasoma geddesi (Pineda-López 1994); Thorichthys helleri (Fucugauchi- Suárez del Real et al. 1988; Pineda-López 1994; Vidal-Martínez 1995). Lago Santa Anita (18°22’15’’N 92°53’10’’W); Cichlasoma geddesi, Cichlasoma rectangulare, Cichlasoma urophthalmum, Cichlasoma pearsei, Petenia splendida, Paraneetroplus fenestratus and Paraneetroplus synspilus (Pineda-López et al. 1985; Pineda- López 1994; Salgado-Maldonado et al. 1997). Estanque Tucta (18°10’40’’N 92°56’1’’W); Cichlasoma geddesi, Cichlasoma urophthalmum, Parachromis friedrichstahlii, Thorichthys pasionis and Paraneetroplus synspilus (Salgado-Maldonado et al. 1997). Lago el Chiribital (17°59’24’’N 93°4’22’’W; 17°59’0’’N 93°4’0’’W); Cichlasoma rectangulare, Cichlasoma urophthalmum, Cichlasoma pearsei, Petenia splendida, Thorichthys meeki, Thorichthys pasionis, Paraneetroplus fenestratus, and Ictalurus furcatus (Salgado-Maldonado 1985); Cichlasoma sp., Cichlasoma urophthalmum, Petenia splendida, Thorichthys meeki and Thorichthys pasionis (Osorio-Sarabia et al. 1987); Cichlasoma urophthalmum, Thorichthys meeki and Thorichthys pasionis (Salgado-Maldonado 2013). Lago el Espino (18°14’57’’N 92°49’59’’W); Cichlasoma rectangulare, Cichlasoma urophthalmum, Cichlasoma pearsei, Petenia splendida, Thorichthys meeki, Thorichthys pasionis, Paraneetroplus fenestratus and Ictalurus furcatus (Salgado-Maldonado 1985); Cichlasoma sp., Cichlasoma urophthalmum, Petenia splendida and Thorichthys meeki (Osorio-Sarabia et al. 1987); Cichlasoma urophthalmum and Thorichthys helleri (Pineda-López 1994); Parachromis motaguensis, Thorichthys helleri, and Thorichthys pasionis (Vidal-Martínez et al. 2001); Paraneetroplus synspilus (Pérez-Ponce de León et al. 1996). Río San Pedro (17°45’0’’N 91°23’0’’W); Cichlasoma rectangulare, Cichlasoma urophthalmum, Cichlasoma pearsei, Petenia splendida, Thorichthys meeki, Thorichthys pasionis, Paraneetroplus fenestratus and Ictalurus furcatus (Salgado-Maldonado 1985); Petenia splendida (Salgado-Maldonado 2013). Rio Vicente Guerrero (18°24’20’’N 92°54’35’’W); Cichlasoma rectangulare, Cichlasoma urophthalmum, Cichlasoma pearsei, Petenia splendida, Thorichthys meeki, Thorichthys pasionis, 80 Zootaxa 3985 (1) © 2015 Magnolia Press · 105NEOECHYNORHYNCHUS FROM MIDDLE AMERICA Paraneetroplus fenestratus and Ictalurus furcatus (Salgado-Maldonado 1985); Cichlasoma urophthalmum, Parachromis fenestratus and Cichlasoma rectangulare (Salgado-Maldonado 2013). Río Usumacinta, Emiliano Zapata (17°45’0’’N 91°46’0’’W); Cichlasoma urophthalmum, Parachromis managuensis and Petenia splendida (Pineda-López et al. 1985). Río Usumacinta, El Corozal (17°44’0’’N 91°35’33’’W); Cichlasoma urophthalmum and Parachromis managuensis (Pineda-López 1994; Salgado-Maldonado et al. 1997). Aguada Santa Elena; Cichlasoma urophthalmum (Salgado-Maldonado et al. 1997). Pantanos de Centla (17°57’0’’N 92°6’0’’W); Cichlasoma urophthalmum (López-Jiménez 2001); Parachromis managuensis (Salgado-Maldonado et al. 2005a; Salgado-Maldonado 2013); Petenia splendida (Salgado-Maldonado 2013). Lago el Manguito (18°12’50’’N 92°50’5’’W); Parachromis managuensis (Salgado-Maldonado et al. 2005a). Lago el Pozo (18°0’35’’N 92°48’11’’W); Parachromis managuensis (Salgado-Maldonado et al. 2005a); Thorichthys pasionis (Vidal- Martínez et al. 2001). Río Usumacinta, Balancán (17°45’8’’N 91°32’45’’W); Parachromis managuensis (Salgado- Maldonado et al. 2005a). Camellones Chontales (17°45’8’’N 92°35’10’’W); Thorichthys pasionis (Vidal-Martínez 1995). VERACRUZ: Lago de Catemaco (18°25’0’’N 95°7’0’’W); Paraneetroplus fenestratus (Salgado- Maldonado 1978; Salgado-Maldonado et al. 1992; Jiménez-García 1993; Salgado-Maldonado et al. 2005b; Martínez-Aquino et al. 2009; Pinacho-Pinacho et al. 2012). Arrollo San Juan Evangelista; Rocio octofasciata and Thorichthys ellioti (Salgado-Maldonado et al. 2005b). Río Tecolutla (20°26’0’’N 97°10’0’’W); Gobiomorus dormitor (Páez-Rodríguez et al. 2002). Río la Antigua (19°20’0’’N 96°23’0’’W); Gobiomorus dormitor (Páez- Rodríguez et al. 2002). YUCATAN: Cenote Chen-há (20°41’24’’N 89°52’36’’W); Cichlasoma urophthalmum (Scholz et al. 1996). Ría Celestun (20°45’0’’N 90°15’0’’W); Cichlasoma urophthalmum (Salgado-Maldonado & Kennedy 1997; Salgado-Maldonado et al. 1997; Salgado-Maldonado 2013). Mitza (21°26’36’’N 89°41’50’’W); Cichlasoma urophthalmum (Vidal-Martínez 1995; Vidal-Martínez et al. 1998). Costa Rica: Quebrada Puercos (10°51’0’’N 85°34’0’’W); Amatitlania nigrofasciata (Martínez-Aquino et al. 2009). Lago Jalapa (10°31’52’’N 84°1’50’’W); Parachromis managuensis, Parachromis loisellei, Amphilophus longinamus, Heterotilapia multiespinosa and Archocentrus centrarchus (this study). Nicaragua: Loonku creek (11°59’5’’N 83°46’48’’W); Amphilophus alfari and Heterotilapia multiespinosa (Aguirre-Macedo et al. 2001). Puente Chino (12°0’30’’N 83°46’13’’W); Parachromis managuensis and Heterotilapia multiespinosa (Aguirre-Macedo et al. 2001). Caño Negro (12°0’55’’N 84°1’10’’W); Parachromis managuensis) (Aguirre-Macedo et al. 2001). Specimens deposited. CNHE (8592, 6757, 6755, 6756, 6767, 6754, 601, 603, 604, 606, 631, 632, 6783, 8593, 8594, 6758, 8595, 8404, 8398, 8397, 8391, 8396, 8395, 8394, 8392, 8390, 8389, 8388, 8387, 8386, 8385, 8384, 8383, 8382, 8370, 6783, 5623, 650, 652-57, 660). Note. This species was described from juvenile specimens in the Lago de Catemaco, Veracruz, Mexico from Paraneetroplus fenestratus (Salgado-Maldonado 1978), which was taxonomically incorrect, the same author four decades later described features, such as the size and shape of adult of male and female as well as the structure of the eggs (Salgado-Maldonado 2013). Neoechinorhynchus (Neoechinorhynchus) mamesi Pinacho-Pinacho, Pérez-Ponce de León & García- Varela 2012 (Fig. 2e) Mexico: CHIAPAS: Laguna Rion Pijijiapan (15°31’54.3’’N 93°9’39.4’’W); Dormitator latifrons (Pinacho- Pinacho et al. 2012). Laguna Conquista (15°40’0.2’’N 93°24’51.61’’W); Dormitator latifrons (Pinacho-Pinacho et al. 2012). Estero Joaquin Amaro (15°46’16.19’’N 93°24’30.11’’W); Dormitator latifrons (Pinacho-Pinacho et al. 2012). OAXACA: Puente Manialtepec (15°57’35.29’’N 97°15’00.97’’W); Dormitator latifrons (this study). Guatemala: Las lisas (13°49’22.23’’N 90°15’49.19’’W); Dormitator latifrons (this study). Honduras: Las brisas de Chamalecon, Puerto Cortés (15°53’13.’’N 87°2’48.37’’W); Dormitator maculatus (this study). Costa Rica: Quebrada Ganados (9°31’55’’N 84°28’10’’W); Dormitator latifrons (this study). Playa Grande (9°38’15’’N 82°40’56’’W); Dormitator maculatus (this study). Specimens deposited. CNHE (8180, 8181, 8182, 8184, 8183, 8590, 8191). 81 PINACHO-PINACHO ET AL. 106 · Zootaxa 3985 (1) © 2015 Magnolia Press Neoechinorhynchus (Neoechinorhynchus) mexicoensis Pinacho-Pinacho, Sereno-Uribe & García- Varela, 2014 (Fig. 2f) Mexico: CAMPECHE: El Milagro (18°52’25.37’’N 91°24’39.62’’W ); Dormitator maculatus (this study). TABASCO: Río el Espino (18°14’47’’N 92°49’57’’W); Dormitator maculatus (Pinacho-Pinacho et al. 2014); Petenia splendida (this study). VERACRUZ: Laguna de Tamiahua (18°6.6’24’’N 94°27’24.9’’W); Dormitator maculatus (Pinacho-Pinacho et al. 2014). Río Papaloapan, Tlacotalpan (18°36’0’’N 95°39’0’’W); Dormitator maculatus (Salgado-Maldonado et al. 2005b; Pinacho-Pinacho et al. 2014); Cichlasoma urophthalmum (Salgado- Maldonado et al. 2005b; Martínez-Aquino et al. 2009); Gobiomorus dormitor (Velázquez-Silvestre 1994; Salgado- Maldonado et al. 2005b), Rhamdia guatemalensis (Salgado-Maldonado et al. 2005b). Laguna de Alvarado (18°45’0’’N 95°45’0’’W); Dormitator maculatus (Chávez-López et al. 1996; Montoya-Mendoza et al. 2004a, b; Martínez-Aquino et al. 2009; García-Varela et al. 2011); Centropomus parallelus, Cichlasoma urophthalmum (Trujillo-Álvarez 1995). Laguna de Sontecomapa (18°30’28’’N 95°1’58’’W); Dormitator maculatus (Pinacho- Pinacho et al. 2014). Río Coatzacoalcos (18°6’35’’N 94°30’3.9’’W); Dormitator maculatus (Pinacho-Pinacho et al. 2014). Río la palma (18°33’44.88’’N 95°2’59.39’’W); Dormitator maculatus (this study). Río Tesechoacán (18°36’0’’N 95°39’0’’W); Cichlasoma urophthalmum (Salgado-Maldonado 2013). Specimens deposited. CNHE (8599, 8334, 8673, 8332, 8333, 6759, 6760, 8597, 8598, 8596, 3077, 8393). Notes. This species was erroneously identified as N. (N.) golvani by Salgado-Maldonado et al. (2005b). Martínez-Aquino et al. (2009) recognized the specimens from eleotrif fishes in coastal lagoons across the Gulf of Mexico slope as independent lineages. The species was finally described using both, molecular and morphological characteres by Pinacho-Pinacho et al. 2014). Neoechinorhynchus (Neoechinorhynchus) panucensis Salgado-Maldonado, 2013 (Fig. 2g) Mexico: HIDALGO: Río Atlapexco (21°0’53’’N 98°20’24’’W); Herichthys labridens, Amatitlania nigrofasciata and Herichthys cyanoguttatus (Salgado-Maldonado 2013). SAN LUIS POTOSÍ: Axtlan de Terrazas (21°26’1’’N 98°52’28’’W); Herichthys cyanoguttatus (Martínez-Aquino et al. 2009). VERACRUZ: Río Pantepec (20°53’35.8’’N 97°47’18.8’’W); Herichthys sp. (this study). Specimens deposited. CNHE (8378, 8379, 8380). Notes. This species was erroneously identified as N. (N.) golvani by Salgado-Maldonado (2006). Martínez- Aquino et al. (2009) recognized the specimens from cichlids fishes from Pánuco river as independent lineages and based on this phylogenetic framework Salgado-Maldonado (2013), described these specimens as a new species. Neoechinorhynchus (Neoechinorhynchus) roseum Salgado-Maldonado, 1978 (Fig. 2h) Mexico: NAYARIT: Estero La Tovara (21°31’37’’N 105°14’29’’W); Citharichthys gilberti (Martínez-Aquino et al. 2009; García-Varela et al. 2011; Pinacho-Pinacho et al. 2012). SINALOA: Laguna de Caimanero (25°36’30’’N 108°26’26’’W); Achirus mazatlanus (Salgado-Maldonado 1978; Martínez-Aquino et al. 2009; García-Varela et al. 2011; Pinacho-Pinacho et al. 2012). Specimens deposited. CNHE (633, 634,663-664, 6762-6763). Neoechinorhynchus (Neoechinorhynchus) schmidti Barger, Thatcher & Nickol, 2004 (Fig. 2i) Mexico: TABASCO: 24 km to S of Villahermosa; Trachemys venusta (Barger 2004; Barger et al. 2004). Pantanos de Centla (18°28’18.9’’N 92°39’14.9’’W). Trachemys scripta (Martínez-Aquino et al. 2009; García-Varela et al. 2011). 82 Zootaxa 3985 (1) © 2015 Magnolia Press · 107NEOECHYNORHYNCHUS FROM MIDDLE AMERICA Specimens deposited. CNHE (6764), HWML (17667), USNPC (92883). Species delimitation through phylogenetic analysis and genetic divergence. To demonstrate the species boundaries among the species reported in this checklist, we sequenced a total of 269 individuals of the species: N. (N.) brentnickoli (81 individuals from 16 localities); N. (N.) roseum (two individuals from two localities); N. (N.) mamesi (22 individuals from seven localities); N. (N.) golvani (80 individuals from 11 localities); N. (N.) mexicoensis (47 individuals from eight localities); N. (N.) schmidti (five individuals from one locality); N. (N.) emyditoides (26 individuals from three localities); N. (N.) panucensis (four individuals from two localities); and N. (N.) chimalapasensis (two individuals from one locality). Additionally sequence of N. saginata plus Floridosentis mugilis and Floridosentis pacifica were aligned together, composing a data set of 806 bp with 274 terminals. Nucleotide frequencies for 28S rDNA data set were 0.246 (A), 0.178 (C), 0.276 (G), and 0.298 (T). Phylogenetic analyses of the available sequences for the genus Neoechinorhynchus through the Bayesian consensus tree yielded the same branch pattern as the ML tree (Fig. 3). Both trees yielded that the ten species of Neoechinorhynchus are monophyletic with strong nodal support ranging from 72 to 100 % of bootstrap, and 1.0 of posterior probability (Fig. 3). Both trees yielded three major clades. The first clade contained four species N. (N.) roseum, N. saginata, N. (N.) schmidti and N. (N.) emyditoides. The second clade was composed of two species N. (N.) golvani and N. (N.) panucensis and had 100 % bootstrap support and 1.0 posterior probability. The third clade was composed of four species N. (N.) chimalapasensis, N. (N.) brentnickoli, N. (N.) mamesi and N. (N.) mexicoensis and received reliable bootstrap support and high values of posterior probability (Fig. 3). FIGURE 3. Phylogenetic tree obtained with Bayesian (consensus) and Maximum Likelihood methods. Parenthesis after terminals indicates number of sequences for each species. Numbers above branches represent bootstrap support values ML analysis/posterior probabilities of BY inference. 83 P IN A C H O -P IN A C H O E T A L . 1 0 8 · Z o o ta xa 3 9 8 5 (1 ) © 2 0 1 5 M ag n o lia P ress TABLE 1. Specimens information: collection sites (CS), samples analyzed for DNA, species analyzed, specimens examined (N), host species, localities, GenBank accession number and catalog number (CNHE) for specimens studied in this work. Sequences marked with an asterisk (*) were obtained in the current study. CS Samples (DNA) Species N Host Locality GenBank Specimens deposited CNHE 1 1-3 N. (N.) brentnickoli 3 Dormitator latifrons Todos los Santos, Baja California Sur, México KR086167-KR086169* 2 4-8 N. (N.) brentnickoli 5 D. latifrons Oasis San José del Cabo, Baja California Sur, México KR086170-KR086174* 8586 3 9-12 N. (N.) brentnickoli 4 D. latifrons Topolobampo, Sinaloa, México KR086175-KR086178* 4 13-17 N. (N.) brentnickoli 5 D. latifrons El Huizache, Sinaloa, México KR086179-KR086183* 8587 5 18-22 N. (N.) brentnickoli 5 D. latifrons Vía Ferrea, Escuinapa, Sinaloa, México KR086184-KR086188* 8588 6 23-27 N. (N.) brentnickoli 5 D. latifrons Nuevo Vallarta, Nayarit, México KR086189-KR086193* 7 28-33 N. (N.) brentnickoli 6 D. latifrons Estero Chamela, Jalisco, México FJ388990, KR086194-KR086198* 8589 8 34 N. (N.) brentnickoli 1 D. latifrons Río Cuitzmala, Jalisco, México FJ388989 9 35-39 N. (N.) brentnickoli 5 D. latifrons Laguna de Cuyutlan, Colima, México KR086199-KR086203* 10 40-49 N. (N.) brentnickoli 10 D. latifrons Estero Boca de Apiza, Michoacán, México JN830782-JN830786, KR086204-KR086208* 8176 11 50-54 N. (N.) brentnickoli 5 D. latifrons Estero Huahua, Michoacán, México KR086209-KR086213* 8177 12 55-59 N. (N.) brentnickoli 5 D. latifrons Estero Mexcalhuacan, Michoacán, México JN830777- JN830781 8173 13 60-64 N. (N.) brentnickoli 5 D. latifrons Estero Barra de Pichi, Michoacán, México KR086214-KR086218* 8174 14 65-66 N. (N.) brentnickoli 2 D. latifrons Laguna de Coyuca, Guerrero, México JN830775, JN830776 8175 15 67-76 N. (N.) brentnickoli 10 D. latifrons Laguna de Tres Palos, Guerrero, México FJ388991, FJ968156- FJ968159, KR086219- KR086223* 8178 16 77-81 N. (N.) brentnickoli 5 D. latifrons Río Tamarindo, Chautengo, Guerrero, México KR086224-KR086228* 8179 17 82 N. (N.) roseum 1 Achirus mazatlanus Laguna el Caimanero, Sinaloa, México FJ388999 6762, 633, 634 18 83 N. (N.) roseum 1 Citharichthys gilberti Estero La Tovara, Nayarit, México FJ389000 6763 19 84-86 N. (N.) mamesi 3 D. latifrons Puente Manialtepec, Oaxaca KR086229-KR086231* ......continued on the next page 8 4 Z o o ta xa 3 9 8 5 (1 ) © 2 0 1 5 M ag n o lia P ress · 1 0 9 N E O E C H Y N O R H Y N C H U S F R O M M ID D L E A M E R IC A TABLE 1. (Continued) CS Samples (DNA) Species N Host Locality GenBank Specimens deposited CNHE 20 87-91 N. (N.) mamesi 5 D. latifrons Estero Joaquin Amaro, Chiapas, México JN830770- JN830774 8183 21 92-95 N. (N.) mamesi 4 D. latifrons Laguna la Conquista, Chiapas, México JN830766- JN830769 8184 22 96-98 N. (N.) mamesi 3 D. latifrons Laguna Rion Pijijiapan, Chiapas, México JN830763- JN830765 8180, 8181, 8182 23 99-100 N. (N.) mamesi 2 D. latifrons Quebrada Ganados, Costa Rica KR086232*, KR086233* 8590 24 101-102 N. (N.) mamesi 2 D. maculatus Playa Grande, Costa Rica KR086234*, KR086235* 8191 25 103-105 N. (N.) mamesi 3 D. latifrons Las lisas , Guatemala KR086236-KR086238* 26 106-107 N. (N.) golvani 1 Parachromis managuensis Lago Jalapa, Costa Rica KR086239* 108-109 N. (N.) golvani 2 Parachromis loisellei Lago Jalapa, Costa Rica KR086240*, KR086241* 110-111 N. (N.) golvani 2 Amphilophus longimanus Lago Jalapa, Costa Rica KR086242*, KR086243* 8592 112 N. (N.) golvani 1 Heterotilapia multiespinosa Lago Jalapa, Costa Rica KR086244* 113-114 N. (N.) golvani 2 Archocentrus centrarchus Lago Jalapa, Costa Rica KR086245*, KR086246* 27 115-116 N. (N.) golvani 2 Amatitlania nigrofasciata Quebrada Puercos, Costa Rica FJ388998, KR086247* 6757 28 117-127 N. (N.) golvani 11 Vieja pearsei Presa Chicoasen, Chiapas, México FJ388995, FJ968136- FJ968138, KR086248-KR086254* 6755 29 128-132 N. (N.) golvani 5 V. pearsei Presa Nezahualcoyolt, Chiapas, México FJ388996, FJ968141, FJ968142, KR086255*, KR086256* 6756 30 133-143 N. (N.) golvani 11 Parachromis friedrichstalii Lago Canitzan, Tenosique, Tabasco, México FJ388994, FJ968139, FJ968140, KR086257-KR086264* 6767 31 144-153 N. (N.) golvani 10 Cichlasoma urophthalmum Río Carrizal, Tabasco, México FJ388993, FJ968134, FJ968135, KR086265-KR086271* 6754 32 154-156 N. (N.) golvani 3 C. urophthalmum Lago las Ilusiones, Tabasco, México FJ388992- FJ968144 33 157-167 N. (N.) golvani 11 Paraneetroplus fenestratus Lago de Catemaco, Veracruz, México FJ388986, FJ968145, FJ968146, KR086272-KR086279* 601, 603, 604, 606, 631, 632, 6783 34 168-172 N. (N.) golvani 5 C. urophthalmum Presa Temascal, Oaxaca, México KR086280-KR086284* 8593 ......continued on the next page 8 5 P IN A C H O -P IN A C H O E T A L . 1 1 0 · Z o o ta xa 3 9 8 5 (1 ) © 2 0 1 5 M ag n o lia P ress TABLE 1. (Continued) CS Samples (DNA) Species N Host Locality GenBank Specimens deposited CNHE 173-177 N. (N.) golvani 5 Cichlasoma salvini Presa Temascal, Oaxaca, México KR086285-KR086289* 8594 35 178-182 N. (N.) golvani 5 C. urophthalmum Emiliano Zapata, Tabasco, México KR086290-KR086294* 8595 36 183-186 N. (N.) golvani 4 Thorichthys meeki Hool, Campeche, México KR086295-KR086298* 37 187-191 N. (N.) mexicoensis 5 Dormitator maculatus Laguna de Tamiahua, Veracruz, México KC004161–KC004165 8334 38 192-197 N. (N.) mexicoensis 6 D. maculatus Laguna de Alvarado, Veracruz, México FJ388985, FJ968152- FJ968155, KC004171 6760 39 198-200 N. (N.) mexicoensis 3 D. maculatus Río Papaloapan, Tlacotalpan, Veracruz, México KR086299-KR086301* 8673, 8332, 8333 201-206 N. (N.) mexicoensis 6 C. urophthalmum Río Papaloapan, Tlacotalpan, Veracruz, México FJ388987, FJ388988, FJ968149- FJ968151, KR086302* 6759 40 207-209 N. (N.) mexicoensis 3 D. maculatus Río la palma, Veracruz, México KR086303-KR086305* 8596 41 210-214 N. (N.) mexicoensis 5 D. maculatus Laguna de Sontecomapa, Veracruz, México KC004151–KC004155 8597 42 215-219 N. (N.) mexicoensis 5 D. maculatus Río Coatzacoalcos, Veracruz, México KC004166–KC004170 8598 43 220-224 N. (N.) mexicoensis 5 D. maculatus Río Espino, Tabasco, México KC004156–KC004160 225-228 N. (N.) mexicoensis 4 Petenia splendida Río Espino, Tabasco, México KR086306-KR086309* 44 229-233 N. (N.) mexicoensis 5 D. maculatus El Milagro, Campeche, México KR086310-KR086314* 8599 45 234-238 N. (N.) schmidti 5 Trachemys scripta Pantanos de Centla, Tabasco, México FJ389001, HQ634785- HQ634788 6764 46 239-247 N. (N.) emyditoides 9 T. scripta Lago de Catemaco, Veracruz, México HQ634781, HQ634782, KR086315- KR086321* 6737 47 248-256 N. (N.) emyditoides 9 T. scripta Río Papaloapan, Tlacotalpan, Veracruz, México HQ634784, HQ634783, KR086322-KR086328* 6695 48 257-264 N. (N.) emyditoides 8 T. scripta Presa la Herradura, Monterrey, México HQ634780, HQ634779, KR086329-KR086334* 6696 49 265 N. (N.) panucensis 1 Herichthys sp. Río Pantepec, Veracruz, México KR086335* 50 266-268 N. (N.) panucensis 3 Herichthys cyanoguttatus Axtlan de Terrazas, San Luis Potosí, México FJ389002, FJ968147, FJ968148 6758 51 269 N. (N.) chimalapasensis 2 Awaous banana Río Negro, Santa María Chimalapa, Oaxaca, México KR086336*, KR086337* 5018, 5019, 5020 8 6 Zootaxa 3985 (1) © 2015 Magnolia Press · 111NEOECHYNORHYNCHUS FROM MIDDLE AMERICA The sequence divergence estimated among the nine species herein considered, plus an additional sequence available for a species that occurs in freshwater fishes in North America (N. saginata) ranged from 3.2% to 48.7% (Table 2). Instead, the intraspecific genetic divergence varied markedly among all the isolates sequenced for each acanthocephalan species and it was never higher than 3% for all intraspecific comparisons. For instance, the divergence among 81 specimens of N. (N.) brentnickoli obtained from a wide geographic range, in 16 localities (localities 1-16 in Fig. 1) across the Pacific coast of northwestern Mexico, varied from 0 to 0.7% (Table 2). In other example, N. (N.) roseum corresponding to two individuals of two localities 1) Laguna el Caimanero, Sinaloa and 2) Estero La Tovara, Nayarit (localities 17-18), had genetic divergence from 0 to 0.04%. The species N. (N.) mamesi comprises 22 individuals from seven localities from Mexico, one of Guatemala and two from Costa Rica (localities 19-25 in Fig. 1), showing a genetic divergence from 0 to 1.3 %. N. (N.) golvani shows genetic divergence from 0 to 1.5% among 80 specimens from 11 localities (see localities 26-36). The species N. (N.) mexicoensis corresponding to 47 individuals from eight localities (localities 37-44) from Gulf of Mexico shows a genetic divergence ranged from 0 to 3%. N. (N.) schmidti shows low genetic divergence ranged from 0-0.02% of specimens analyzed from the same locality. The species N. (N.) emyditoides corresponding three localities: 1) Lago de Catemaco, Veracruz, 2) Río Papaloapan, Tlacotalpan, Veracruz and 3) Presa la Herradura, Monterrey (localities 46-48), showed a genetic divergence from 0 to1.3%. The specimens of N. (N.) panucensis are from Axtlan de Terrazas, San Luis Potosí, and Río Pantepec, Veracruz (localities 49-50), both localities are near of the type locality of N. (N.) panucensis. The genetic divergence among four isolates of N. (N.) panucensis ranged from 0.02–0.05%. Finally, the two specimens of N. (N.) chimalapasensis showed a genetic divergence equal to zero (locality 51). TABLE 2. Pair-wise percentage sequence divergence (p) within and between Neoechinorhynchus spp., derived from 28S rDNA; ranges are given. Number of specimens examined = (n). continued. 1 2 3 4 5 1. N. (N.) brentnickoli (n = 81) 0–0.7 42–43 8.1–9.8 21.9–23.7 7.3–10 2. N. (N.) roseum (n = 2) 0–0.04 40.9–42.9 41.1–43.1 39.7–43.2 3. N. (N.) mamesi (n = 22) 0–1.3 21–23.6 2.40–5.50 4. N. (N.) golvani (n = 80) 0–1.5 21.0–24.6 5. N. (N.) mexicoensis (n = 47) 0–3.0 6. N. (N.) schmidti (n = 5) 7. N. (N.) emyditoides (n = 26) 8. N. (N.) panucensis (n = 4) 9. N. (N.) chimalapasensis (n = 2) 10. N. saginata (n =1) 6 7 8 9 10 1. N. (N.) brentnickoli (n = 81) 39.3–39.7 38.8–39.5 23.2–24.5 20.3–21.0 39.2–39.6 2. N. (N.) roseum (n = 2) 31.3–31.6 32.8–33.2 42.8–43.8 48.4–48.7 38.7–38.8 3. N. (N.) mamesi (n = 22) 38.2–40.5 37.0–39.6 23.0–25.1 16.8–18.1 38.0–39.5 4. N. (N.) golvani (n = 80) 36.1–38.3 34.8–37.7 4.70–6.30 27.1–28.8 33.3–34.8 5. N. (N.) mexicoensis (n = 47) 37.1–39.1 35.5–38.2 23.0–26.1 18.2–20.6 37.4–39.9 6. N. (N.) schmidti (n = 5) 0–0.02 3.2–4.1 38.2–38.8 43.5–43.9 20.9 7. N. (N.) emyditoides (n = 26) 0–1.3 38.3–39.9 42.4–42.8 21.1–21.4 8. N. (N.) panucensis (n = 4) 0.02–0.05 28.6–28.9 35.9–36.5 9. N. (N.) chimalapasensis (n = 2) 0 41.19 10. N. saginata (n =1) 0 87 PINACHO-PINACHO ET AL. 112 · Zootaxa 3985 (1) © 2015 Magnolia Press Discussion The checklist presented herein includes information for nine species of Neoechinorhynchus distributed in Middle- America, two of them occurs in freshwater turtles (N. (N.) schmidti and N. (N.) emyditoides) from Gulf of Mexico, whereas N. (N.) roseum, N. (N.) brentnickoli, N. (N.) mamesi, and N. (N.) mexicoensis occur in marine and brackish fishes from both shoreline coasts of Mexico and other three species occur in freshwater fishes i. e., (N. (N.) golvani, N. (N.) chimalapasensis and N. (N.) panucensis) (see Pinacho-Pinacho et al. 2014). These species of the genus Neoechinorhynchus were found as adults in 55 species of fish, and one species of freshwater turtles in 87 localities comprising five countries: Mexico, Guatemala, Nicaragua, Honduras, and Costa Rica. The acanthocephalan N. (N.) golvani and N. (N.) panucensis were found in cichlids and these parasites are considered as a component of the helminth fauna of this family of fishes (see Pérez-Ponce de León & Choudhury 2005). The distribution area of N. (N.) golvani extends from southeastern Mexico to Costa Rica, whereas N. (N.) panucensis is restricted to Panuco river on the Gulf of Mexico and it could be explained as a result of the contemporary and historical biogeography of their cichlid hosts (Concheiro-Pérez et al. 2007). The species N. (N.) brentnickoli, N. (N.) mamesi and N. (N.) mexicoensis were found in eleotrid fishes and are considered as a component of the helminth fauna of this family of fishes. The area of distribution of N. (N.) brentnickoli extends from the Isthmus of Tehuantepec northwards to the Sea of Cortez, associated to D. latifrons, whereas that N. (N.) mamesi is distributed from the Isthmus of Tehuantepec, in Chiapas, Mexico southwards to Costa Rican Pacific coast in Central America, associated to D. latifrons and D. maculatus. Whereas, N. (N.) mexicoensis is distributed in Gulf of Mexico associated to D. maculatus (Pinacho-Pinacho et al. 2014). The species N. (N.) emyditoides and N. (N.) schmidti were found in freshwater turtles of the genus Trachemys distributed in Gulf of Mexico (see García- Varela et al. 2011). N. (N.) emyditoides was recorded previously in several localities of North America (Barger 2004). The Bayesian and ML analyses inferred with the LSU dataset that include 274 taxa show that Neoechinorhynchus is divided into 10 clades representing the 10 species analyzed herein. The genetic divergence estimated among species ranged from 3.2% to 48.7%. These ranges of genetic divergence are similar to those reported by Martínez-Aquino et al. (2009); Rosas-Valdez et al. (2012); Pinacho-Pinacho et al. (2014) who identified species of the genera Neoechinorhychus and Floridosentis from Neoechinorhynchidae. In the present study the large subunit of the ribosomal gene (LSU) was used as molecular marker to determinate differences/ similarities among species of Neoechinorhynchus. This gene has faster rate of evolution than small subunit of the ribosomal gene (SSU) and was useful to recognize species of Neoechinorhynchus and also has been used for population studies or to detect species complex in acanthocephalans and therefore this gene could be used as an efficient supplement for classical DNA barcoding that use the cytochrome oxidase subunit I (cox 1) ( Martínez- Aquino et al. 2009; Rosas Valdez et al. 2012; García-Varela & Pérez Ponce de León 2015). Acknowledgments We are grateful to David Hernández, Rogelio Rosas, Mirza Olivares, Arturo Angulo, Carlos Garita, Omar Dominguez, Eloísa Torres, Chavo RG, Angeles Pérez Ruíz, Edgar Sandoval, Gina Palacios, Adriana Andrade, Julio Herrera, Leopoldo Andrade, and Eduardo Hernández for their help during field work. We also thank Luis García Prieto for providing specimens deposited at the CNHE. This research was supported by grants from the Programa de Apoyo a Proyectos de Investigación e Innovación Tecnológica (PAPIIT) IN207213 to MGV and IN219904 to GPPL, and the Consejo Nacional de Ciencia y Tecnológia (CONACYT) 179048 to MGV. Carlos Daniel Pinacho- Pinacho thanks the support of the Programa de Posgrado en Ciencias Biológicas, Universidad Nacional Autónoma de México to complete his Ph.D. degree, and to CONACYT for granting a scholarship. References Aguirre-Macedo, M.L., Scholz, T., González-Solís, D., Vidal-Martínez V.M., Posel, P., Arjona-Torres, G., Dumailo, S. & Siu- Estrada, E. (2001) Some adult endohelminths parasitizing freshwater fishes from the Atlantic drainages of Nicaragua. Comparative Parasitology, 68 (2), 190–195. 88 Zootaxa 3985 (1) © 2015 Magnolia Press · 113NEOECHYNORHYNCHUS FROM MIDDLE AMERICA Amin, O.M. (2002) Revision of Neoechinorhynchus Stiles and Hassall, 1905 (Acanthocephala: Neoechinorhynchidae) with keys to 88 species in two subgenera. Systematic Parasitology, 53 (1), 1–18. http://dx.doi.org/10.1023/A:1019953421835 Amin, O.M. (2013) Classification of the Acanthocephala. Folia Parasitologica, 60 (4), 273–305. http://dx.doi.org/10.14411/fp.2013.031 Amin, O.M. & Heckmann, R. (2009) Description of Neoechinorhynchus (Neoechinorhynchus) buckneri n. sp. from the blacktailed redhorse Moxostoma poecilurum (Catostomidae) in the Tchoutacabouffa River, Mississippi, with a key to species of Neoechinorhynchus with different dorsoventral body wall thickness. Comparative Parasitology, 76 (2), 154– 161. http://dx.doi.org/10.1654/4392.1 Barger, M.A. (2004) The Neoechinorhynchus of turtles: specimen base, distribution, and host use. Comparative Parasitology, 71 (2), 118–129. http://dx.doi.org/10.1654/4145 Barger, M.A., Thatcher, E.V. & Nickol, B.B. (2004) A new species of Neoechinorhynchus (Acanthocephala: Neoechinorhynchidae) from a red-eared slider (Trachemys scripta elegans) in Mexico. Comparative Parasitology, 71 (1), 1–3. http://dx.doi.org/10.1654/4099 Bermingham, E. & Martin, A.P. (1998) Comparative mtDNA phylogeography of neotropical freshwater fishes: testing shared history to infer the evolutionary landscape of lower Central America. Molecular Ecology, 7 (4), 499–517. http://dx.doi.org/10.1046/j.1365-294x.1998.00358.x Bravo-Hollis, M. (1946) Neoechinorhynchus emydis (Leidy, 1852) van Cleave, 1913, parásito del intestino de Chrysemys ornata. Anales del Instituto de Biología Universidad Nacional Autónoma de México, 17, 187–192. Bussing, W.A. (1985) Patterns of distribution of the Central American ichthyofauna. In: Stehli, F.G. & Webb, S.D. (Eds.), The Great American Biotic Interchange. New York Plenum Press, New York, pp. 453–473. Chávez-López, R., Montoya-Mendoza, J., Franco-López, J., Barrera-Escorcia, H. & Morán-Silva, A. (1996) Parásitos de peces colectados en la Laguna de Alvarado, Veracruz. Revista Zoológica, 2 (2), 35–56. Concheiro-Pérez, G.A., Rican, O., Ortí, G., Bermingham, E., Doadrio, I. & Zardoya, R. (2007) Phylogeny and biogeography of 91 species of heroine cichlids (Teleostei: Cichlidae) based on sequences of the cytochrome b gene. Molecular Phylogenetics and Evolution, 43 (1), 91–110. http://dx.doi.org/10.1016/j.ympev.2006.08.012 Contreras-Balderas, S., Obregon, S.H. & Lourdes-Lozano, M.L. (1996) Punta de Morro, an interesting barrier for distributional patterns of Continental fishes in North and Central Veracruz, Mexico. Acta Biologica Venezuelica, 16 (4), 37–42. Fisher, F.M. (1960) On Acanthocephala of turtles, with the description of Neoechinorhynchus emyditoides n. sp. Journal of Parasitology, 46, 257–266. Fucugauchi-Suarez del Real, M.G., García-Magaña, L. & Brito-Arjona, B. del R. (1988) Análisis previo de la parasitofauna de peces de la Laguna del Rosario, Huimanguillo, Tabasco. Divulgación Científica, 1, 319–335. García-Magaña, L. (1990) Variación estacional de los helmintos endoparásitos de Cichlasoma synspilum en la Laguna de las Ilusiones, Tabasco, México. B.S. Thesis, División Académica de Ciencias Biologicas, Universidad Juárez Autónoma de Tabasco, Villahermosa, Tabasco, 123 pp. García-Prieto, L., García-Varela, M., Mendoza-Garfias, B., Pérez-Ponce de León, G. (2010) Checklist of the Acanthocephala in wildlife vertebrates of Mexico. Zootaxa, 2419, 1–50. García-Varela, M., García-Prieto, L. & Pérez Rodríguez, R. (2011) Molecular identification and first description of the male of Neoechinorhynchus schmidti (Acanthocephala: Neoechinorhynchidae), a parasite of Trachemys scripta (Testudines) in México. Parasitology International, 60 (4), 433–439. http://dx.doi.org/10.1016/j.parint.2011.07.005 García-Varela, M. & Nadler, S.A. (2005) Phylogenetic relationships of Palaeacanthocephala (Acanthocephala) inferred from SSU and LSU rDNA gene sequences. Journal of Parasitology, 91 (6), 1401–1409. http://dx.doi.org/10.1645/GE-523R.1 García-Varela, M. & Pérez-Ponce de León, G. (2015) Advances in the classification of acanthocephalans: evolutionary history and evolution of the parasitism. In: Parasite diversity and diversification: evolutionary ecology meets phylogenetics. Cambridge, University Press, Cambridge, pp. 182–201. Garrido-Olvera, L., García-Prieto, L. & Mendoza-Garfias, B. (2004) Helminth parasites of the Pacific fat sleeper, Dormitator latifrons (Richardson, 1844) (Osteichthyes: Eleotridae) from Tres Palos Lagoon, Guerrero, Mexico. American Midland Naturalist, 15 (1), 165–169. http://dx.doi.org/10.1674/0003-0031(2004)151[0165:HPOTPF]2.0.CO;2 Guzman-Speziale, M., Valdes-Gonzalez, C., Molina, E. & Gomez, J.M. (2005) Seismic activity along the Central America Volcanic Arc: is it related to subduction of the Cocos plate?. Tectonophysics, 400, 241–254. http://dx.doi.org/10.1016/j.tecto.2005.03.006 Huelsenbeck, J.P. & Ronquist, F. (2001) MrBayes: Bayesian inference of phylogenetic trees. Bioinformatics, 17 (8), 754–755. http://dx.doi.org/10.1093/bioinformatics/17.8.754 Huidobro, L., Morrone, J.J., Villalobos, J.L. & Alvarez, F. (2006) Distributional patterns of freshwater taxa (fishes, crustaceans 89 PINACHO-PINACHO ET AL. 114 · Zootaxa 3985 (1) © 2015 Magnolia Press and plants) from the Mexican Transition Zone. Journal of Biogeography, 33 (4), 731–741. http://dx.doi.org/10.1111/j.1365-2699.2005.01400.x Iturralde-Vinent, M.A. & MacPhee, R.D.E. (1999) Paleogeography of the Caribbean region: Implications for cenozoic biogeography. Bulletin of the American Museum of Natural History, 238, 1–95. Jiménez-García, M.I. (1993) Fauna helmintológica de Cichlasoma fenestratum (Pisces: Cichlidae) del Lago de Catemaco, Veracruz, México. Anales del Instituto de Biología, Universidad Nacional Autónoma de México, 64 (1), 75–78. López-Jiménez, S. (2001) Estudio parasitológico de los peces de aguas dulces del estado de Tabasco. Gaceta Sigolfo: Sistema de Investigación del Golfo de México, 3, 8–10. Malyarchuk, B., Derenko, M., Mikhailova, E. & Denisova, G. (2014) Phylogenetic relationships among Neoechinorhynchus species (Acanthocephala: Neoechinorhynchidae) from North-East Asia based on molecular data. Parasitology International, 63 (1), 100–107. http://dx.doi.org/10.1016/j.parint.2013.09.012 Martin, A.P. & Bermingham, E. (1998) Systematics and evolution of lower Central American cichlids inferred from analysis of cytochrome b gene sequences. Molecular Phylogenetic and Evolution, 9 (2), 192–203. http://dx.doi.org/10.1006/mpev.1997.0461 Martínez-Aquino, A., Reyna-Fabián, M.E., Rosas-Valdez, R., Razo-Mendivil, U., Pérez-Ponce de León, G. & García-Varela, M. (2009) Detecting a complex of cryptic species within Neoechinorhynchus golvani (Acanthocephala: Neoechinorhynchidae) inferred from ITSs and LSU rDNA gene sequences. Journal of Parasitolology, 95 (5), 1040–1047. http://dx.doi.org/10.1645/GE-1926.1 Mateos, M. (2005) Comparative phylogeography of livebearing fishes in the genera Poeciliopsis and Poecilia (Poeciliidae : Cyprinodontiformes) in central Mexico. Journal of Biogeography, 32 (5), 775–780. http://dx.doi.org/10.1111/j.1365-2699.2005.01236.x Mayén-Peña, E. (2003) Distribución intestinal de helmintos parásitos de los peces Agonostomus monticola (Pisces: Mugilidae) y Dormitator latifrons (Eleotridae) en tres localidades del Estado de Jalisco, México. M. Sc. Thesis, Facultad de Ciencias, Universidad Nacional Autónoma de México, Mexico, 98 pp. Méndez, O., Salgado-Maldonado, G., Caspeta-Mandujano, J.M. & Cabañas-Carranza G. (2010) Helminth parasites of some freshwater fishes from Baja California Sur, Mexico. Zootaxa, 2327, 44–50. Monks, S., Pulido-Flores, G. & Violante-González, J. (2011) A new species of Neoechinorhynchus (Acanthocephala: Neoechinorhynchidae) in Dormitator latifrons (Perciformes: Eleotridae) from the Pacific Coast of Mexico. Comparative Parasitology, 78 (1), 21–8. http://dx.doi.org/10.1654/4462.1 Montoya-Mendoza, J., Chávez-López, R. & Franco-López, J. (2004a) Helminths from Dormitator maculatus (Pisces: Eleotridae) in Alvarado Lagoon, Veracruz, Mexico, and supplemental data for Clinostomum complanatum Rudolphi, 1814 from Egretta caerulea (Aves: Ardeidae). Gulf and Caribbean Research, 16, 115–127. Montoya-Mendoza, J., Osorio-Sarabia, D., Chávez-López, R. & Franco-López, J. (2004b) Helmintos del pez Dormitator maculatus (Osteichthyes: Eleotridae) de Alvarado, Veracruz, México. Revista de Biología Tropical, 52 (2), 393–396. http://dx.doi.org/10.15517/rbt.v52i2.15255 Morales-Sosa, A. (2008) Helmintofauna de Petenia splendida (Osteichthyes: Cichlidae) en algunas localidades dulceacuícolas de México. B. S. Thesis, Facultad de Ciencias, Universidad Nacional Autónoma de México, Mexico City, 105 pp. Morrone, J.J. (2002) Biogeographical regions under track and cladistic scrutiny. Journal of Biogeography, 29 (2), 149–152. http://dx.doi.org/10.1046/j.1365-2699.2002.00662.x Nadler, S.A. & Pérez-Ponce de León, G. (2011) Integrating molecular and morphological approaches for characterizing parasite cryptic species: implications for parasitology. Parasitology, 138 (13), 1688–1709. http://dx.doi.org/10.1017/S003118201000168X Nolan, M.J. & Cribb, T.H. (2005) The use and implications of ribosomal DNA sequencing for the discrimination of digenean species. Advances in Parasitology, 60, 101–163. http://dx.doi.org/10.1016/S0065-308X(05)60002-4 Osorio-Sarabia, D., Pineda-López, R. & Salgado-Maldonado, G. (1987) Fauna helmintológica de peces dulceacuícolas de Tabasco. Estudio Preliminar. Universidad y Ciencia, 4, 5–31. Páez-Rodríguez, M., Páez-Bistraín, R., Campos-Pérez, J.J. & Velázquez-Silvestre, M.G. (2002) Parásitos en peces comerciales. In: Guzmán-Amaya, P., Quiroga-Brahams, C., Díaz-Luna, C., Fuentes-Castellanos, D., Contreras, C.M. & Silva-López, G. (Eds.), La pesca en Veracruz y sus perspectivas de desarrollo. Secretaría de Agricultura, Ganadería, Desarrollo Rural, Pesca y Alimentación, Instituto Nacional de la Pesca y Universidad Veracruzana, Xalapa, pp. 127–144. Pérez-Ponce de León, G. & Choudhury, A. (2005) Biogeography of helminth parasites of freshwater fishes in Mexico: the search for patterns and processes. Journal of Biogeography, 32, 645–659. http://dx.doi.org/10.1111/j.1365-2699.2005.01218.x Pérez-Ponce de León, G. & Nadler S.A. (2010) What we don’t recognize can hurt us: a plea for awareness about cryptic species. Journal of Parasitology, 96 (2), 453–464. http://dx.doi.org/10.1645/GE-2260 Pérez-Ponce de León, G., García-Prieto, L., Osorio-Sarabia, D. & León-Règagnon, V. (1996) Listados Faunísticos de México VI. Helmintos parásitos de peces de aguas continentales de México. Instituto de Biología, Universidad Nacional 90 Zootaxa 3985 (1) © 2015 Magnolia Press · 115NEOECHYNORHYNCHUS FROM MIDDLE AMERICA Autónoma de México, Mexico, pp. 100. Pinacho-Pinacho, C.D., Pérez-Ponce de León, G. & García-Varela, M. (2012) Description of a new species of Neoechinorhynchus (Acanthocephala: Neoechinorhynchidae) a parasite of Dormitator latifrons from Southwestern Mexico based on morphological and molecular characters. Parasitology International, 61 (4), 634–644. http://dx.doi.org/10.1016/j.parint.2012.06.006 Pinacho-Pinacho, C.D., Sereno-Uribe, A.L. & García-Varela, M. (2014) Morphological and molecular data reveal a new species of Neoechinorhynchus (Acanthocephala: Neoechinorhynchidae) from Dormitator maculatus in the Gulf of Mexico. Parasitology International, 63 (6), 763–771. http://dx.doi.org/10.1016/j.parint.2014.07.003 Pineda-López, R. (1994) Ecology of the helminth communities of cichlid fish in the flood plains of Southeastern Mexico. Ph. D. Thesis. University of Exeter, Exeter, 237 pp. Pineda-López, R., Carballo-Cruz, V., Fukugauchi-Suárez de Real, M.G. & García-Magaña L (1985) Metazoarios parásitos de peces de importancia comercial de la región de Los Ríos, Tabasco, México. In: Gobierno del Estado de Tabasco, Usumacinta, Investigación Cientifica en la Cuenca del Usumacinta, 1 (1), pp. 197–270. Posada, D. (2008) jModelTest: Phylogenetic model averaging. Molecular Biology and Evolution, 25 (7), 1253–1256. http://dx.doi.org/ 10.1093/molbev/msn083 Rambaut, A. & Drummond, A.J. (2007) Tracer v1.4, Available from: http://beast.bio.ed.ac.uk/Tracer (accessed 16 June 2016) Ramírez-Jiménez, P.D. (1993) Caracterización de la helmintofauna de Cichlasoma pasionis Rivas, 1962 y Cichlasoma helleri Steindachner, en la Laguna de las Ilusiones, Tabasco, México. B. S. Thesis, Escuela de Biología, Instituto de Artes y Ciencias de Chiapas, Tuxtla-Gutiérrez, Chiapas, 156 pp. Rosas-Valdez, R., Morrone, J.J. & García-Varela, M. (2012) Molecular phylogenetics of Floridosentis ward, 1953 (Acanthocephala: Neoechinorhynchidae) parasites of mullets (Osteichthyes) from Mexico, using 28S rDNA sequences. Journal of Parasitology, 98 (4), 855–862. http://dx.doi.org/10.1645/GE-2963.1 Salgado-Maldonado, G. (1978) Acantocéfalos de peces IV. Descripción de dos especies nuevas de Neoechinorhynchus Hamann, 1892 (Acanthocephala: Neoechinorhynchidae) y algunas consideraciones sobre este género. Anales del Instituto de Biología, Universidad Nacional Autónoma de México, 49 (1), 35–48. Salgado-Maldonado, G. (1985) Crecimiento alométrico y consideraciones taxonómicas sobre Neoechinorhynchus golvani Salgado-Maldonado, 1978 (Acanthocephala: Neoechinorhynchidae) parásito de peces dulceacuícolas en Tabasco, México. Universidad y Ciencia, 2, 57–66. Salgado-Maldonado, G. (2013) Redescription of Neoechinorhynchus (Neoechinorhynchus) golvani Salgado-Maldonado, 1978 (Acanthocephala: Neoechinorhynchidae) and description of a new species from freshwater cichlids (Teleostei: Cichlidae) in Mexico. Parasitology Research, 112 (5), 1891–1901. http://dx.doi.org/10.1007/s00436-013-3374-7 Salgado-Maldonado, G., Aguilar-Aguilar, R., Cabañas-Carranza, G., Soto-Galera, E. & Mendoza- Palmero, C. (2005b) Helminth parasites in freshwater fish from the Papaloapan river basin, Mexico. Parasitology Research, 96 (2), 69–89. http://dx.doi.org/10.1007/s00436-005-1315-9 Salgado-Maldonado, G., Cabañas-Carranza, G., Caspeta-Mandujano, J.M., Soto-Galera, E., Mayén-Peña, E., Brailovsky, D. & Báez-Valé, R. (2001a) Helminth parasites of freshwater fishes of the Balsas River Drainage Basin of Southwestern Mexico. Comparative Parasitology, 68, 196–203. Salgado-Maldonado, G., Cabañas-Carranza, G., Soto-Galera, E., Caspeta-Mandujano, J.M., Moreno-Navarrete, G., Sánchez- Nava, P. & Aguilar-Aguilar, R. (2001b) A Checklist of helminth parasites of freshwater fishes from the Lerma-Santiago River Basin, Mexico. Comparative Parasitology, 68, 204–218. Salgado-Maldonado, G., Caspeta-Mandujano, J.M. & Martínez-Ramírez, E. (2010) Neoechinorhynchus (Neoechinorhynchus) chimalapasensis n. sp. (Acanthocephala: Neoechinorhynchidae) from the freshwater fish Awaous banana (Valenciennes) (Gobiidae) in Mexico. Systematic Parasitology, 75 (3), 231–237. http://dx.doi.org/10.1007/s11230-009-9218-2 Salgado-Maldonado, G., Caspeta-Mandujano, J.M., Moravec, F., Soto-Galera, E., Rodiles-Hernández, R., Cabañas-Carranza, G. & Montoya-Mendoza, J. (2011) Helminth parasites of freshwater fish in Chiapas, Mexico. Parasitology Research, 108 (1), 31–59. http://dx.doi.org/ 10.1007/s00436-010-2035-3 Salgado-Maldonado, G., Jiménez-García, I. & León-Règagnon, V. (1992) Presence of Octospiniferoides chandleri Bullock, 1957, in Heterandria bimaculata from Catemaco, Veracruz, and considerations about the acanthocephalans of fresh water fishes of Mexico. Memorias do Instituto Oswaldo Cruz, 87 (1), 239–240. http://dx.doi.org/10.1590/S0074-02761992000500044 Salgado-Maldonado, G. & Kennedy, C.R. (1997) Richness and similarity of helminth communities in the tropical cichlid fish Cichlasoma urophthalmus from the Yucatan Peninsula, Mexico. Parasitology, 114 (6), 581–590. Salgado-Maldonado, G., Mercado-Silva, N., Cabañas-Carranza, G., Caspeta-Mandujano, J.M., Aguilar-Aguilar, R. & Iñiguez- Dávalos, L.I. (2004) Helminth parasites of freshwater fishes of the Ayuquila River, Sierra de Manantlán Biosphere Reserve, west Central Mexico. Comparative Parasitology, 71, 67–72. http://dx.doi.org/10.1654/4067 91 PINACHO-PINACHO ET AL. 116 · Zootaxa 3985 (1) © 2015 Magnolia Press Salgado-Maldonado, G., Pineda-López, R., García-Magaña, L., López-Jiménez, S., Vidal-Martínez, V.M. & Aguirre- Macedo, L. (2005a) Helmintos parásitos de peces dulceacuícolas. In: Bueno, J., Álvarez, F. & Santiago, S. (Eds.), Biodiversidad del Estado de Tabasco. Instituto de Biología, Universidad Nacional Autónoma de México and Comisión Nacional para el Conocimiento y Uso de la Biodiversidad, Mexico, pp. 145–166. Salgado-Maldonado, G., Pineda-López, R., Vidal-Martínez, V.M. & Kennedy, C.R. (1997) A checklist of metazoan parasites of cichlid fish from Mexico. Journal of the Helminthological Society of Washington, 64 (2), 195–207. Scholz, T., Vargas-Vázquez, J., Moravec, F., Vivas-Rodríguez, C. & Mendoza-Franco, E. (1996) Cestoda and Acanthocephala of fishes from cenotes (= sinkholes) of Yucatan, Mexico. Folia Parasitologica, 43, 141–152. Smales, L.R. (2013) A review of the genus Neoechinorhynchus (Acanthocephala: Neoechinorhynchidae) from Australia with the description of two new species. Journal of Parasitology, 99 (6), 1106–1112. http://dx.doi.org/10.1645/13-184.1 Steinauer, M.L., Nickol, B.B. & Ortí, G. (2007) Cryptic speciation and patterns of phenotypic variation of variable acanthocephalan parasite. Molecular Ecology, 16 (19), 4097–4109. http://dx.doi.org/10.1111/j.1365-294X.2007.03462.x Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M. & Kumar, S. (2011) MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Molecular Biology and Evolution, 28 (10), 2731–2739. http://dx.doi.org/10.1093/molbev/msr121 Thompson, J., Higgins, D. & Gibson, T. (1994) CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Research, 22 (22), 4673–4680. http://dx.doi.org/10.1093/nar/22.22.4673 Trujillo-Álvarez, R. (1995) Fauna helmintológica de la “mojarra” Cichlasoma urophthalmus (Günther, 1862) en el sistema lagunar de Alvarado, Veracruz, México. B.S. Thesis, Facultad de Biología, Universidad Veracruzana, Jalapa, Veracruz, 60 pp. Velázquez-Silvestre, M.G. (1994) Comparación de la fauna helmintológica de Gobiomorus dormitor (Lacepede: 1800) en tres localidades del Estado de Veracruz, México. B.S. Thesis, Facultad de Biología, Universidad Veracruzana, Jalapa, Veracruz, 92 pp. Vidal-Martínez, V.M. (1995) Processes structuring the helminth communities of native cichlid fishes from southern Mexico. Ph. D. Thesis, Faculty of Science, University of Exeter, Exeter, 164 pp. Vidal-Martínez, V.M., Aguirre-Macedo, M.L., Scholz, T., González-Solís, D. & Mendoza-Franco, E.F. (2001) Atlas of the helminth parasites of cichlid fish of Mexico. Academia, Praha, 165 pp. Vidal-Martínez, V.M. & Kennedy, C.R. (2000) Potential interactions between the intestinal helminths of the cichlid fish Cichlasoma synspilum from Southeastern Mexico. Journal of Parasitology, 86 (4), 691–695. http://dx.doi.org/10.1645/0022-3395(2000)086[0691:PIBTIH]2.0.CO;2 Vidal-Martínez, V.M., Kennedy, C.R. & Aguirre-Macedo, M.L. (1998) The structuring process of the macroparasite community of an experimental population of Cichlasoma urophthalmus through time. Journal of Helminthology, 72 (3), 199–207. http://dx.doi.org/10.1017/S0022149X00016448 Violante-González, J. & Aguirre-Macedo, L. (2007) Metazoan parasites of fishes from Coyuca Lagoon, Guerrero, Mexico. Zootaxa, 1531, 39–48. Violante-González, J., Aguirre-Macedo, L. & Mendoza-Franco, E. (2007) A checklist of metazoan parasites of fish from Tres Palos Lagoon, Guerrero, Mexico. Parasitology Research, 102 (1), 151–161. http://dx.doi.org/10.1007/s00436-007-0733-2 Wilgenbusch, J.C., Warren, D.L. & Swofford, D.L. (2004) AWTY: A system for graphical exploration of MCMC convergence in Bayesian phylogenetic inference. Available from: http://ceb.csit.fsu.edu/awty (accessed 16 June 2015) Zaldivar-Riveron, A., Leon-Regagnon, V. & de Oca, A.N.M. (2004) Phylogeny of the Mexican coastal leopard frogs of the Rana berlandieri group based on mtDNA sequences. Molecular Phylogenetic and Evolution, 30 (1), 38–49. http://dx.doi.org/10.1016/S1055-7903(03)00141-6 92 4. DISCUSIÓN GENERAL 93 El grupo de endoparásitos del género Neoechinorhynchus representan un modelo excelente para explorar y probar diferentes hipótesis dirigidas a la delimitación de especies de helmintos parásitos en peces dulceacuícolas, marinos y estuarinos de la región de Centroamérica. Estos organismos se encuentran distribuidos en sus huéspedes definitivos, en sistemas hidrológicos particulares como ríos, lagos, lagunas, esteros, presas y arroyos, los cuales pueden actuar como barreras geográficas y a su vez restringen su dispersión impidiendo el flujo génico entre huéspedes (Pinacho-Pinacho et al. 2015). Por estas características se espera recuperar una alta diversidad de especies en Neoechinorhynchus, las cuales serían el reflejo tanto de los sistemas hidrológicos donde se distribuyen más la propia historia evolutiva de sus huéspedes. Por lo tanto, el objetivo central de este estudio fue inferir los límites entre especies del género Neoechinorhynchus, un grupo de parásitos ampliamente distribuidos en Centroamérica, parasitando una alta diversidad de huéspedes. Relaciones filogenéticas y delimitación de especies en Neoechinorhynchus Con base en caracteres morfológicos y moleculares, y particularmente de los análisis filogenéticos de secuencias de ADN se determinaron y describieron dos nuevas especies para la ciencia, Neoechinorhynchus (Neoechinorhynchus) mamesi Pinacho- Pinacho, Pérez-Ponce de León y García-Varela 2012, asociada a Dormitator latifrons en tres lagunas costeras del estado de Chiapas, México (Pinacho-Pinacho et al. 2012). La segunda especie descrita fue Neoechinorhynchus (Neoechinorhynchus) mexicoensis Pinacho-Pinacho, Sereno-Uribe y García-Varela 2014, la cual se describió de organismos recuperados del intestino de Dormitator maculatus en lagunas y ríos del Golfo de México (Pinacho-Pinacho et al. 2014). Con la descripción de estas dos nuevas 94 especies en Centroamérica, la diversidad de especies se incrementó a nueve (Pinacho- Pinacho et al. 2015). La importancia de este hallazgo se centra en la utilidad de caracteres moleculares y morfológicos para poder delimitar estos dos linajes en un grupo altamente diverso de acantocéfalos. Con base en la revisión de ejemplares depositados en la Colección Nacional de Helmintos (CNHE) y ejemplares recolectados en este estudio se elaboró un listado taxonómico de todas las especies de Neoechinorhynchus en Centroamérica (Pinacho- Pinacho et al. 2015). Este listado de especies fue la herramienta base para enfocar el estudio de la delimitación de especies. Como resultado de este listado se incluye información de nueve especies de Neoechinorhynchus encontrados en 55 especies de peces, una especie de tortuga, para 87 localidades a lo largo de cinco países (México, Guatemala, Nicaragua, Honduras y Costa Rica). Adicionalmente a las nueve especies de Neoechinorhynchus formalmente descritas en Centroamérica, en este estudio basado en el análisis de reconstrucción filogenética y de diferentes métodos para delimitar especies como lo son, General Mixed Yule-Coalescent model (GMYC) y en distancias genéticas con el método Automatic Barcode Gap Discovery (ABGD), y análisis de árboles de especies Species Tree by Multispecies Coalescent (*BEAST), encontramos que Neoechinorhynchus representa un complejo de especies crípticas que comprende al menos 10 linajes con evolución independiente, estrechamente relacionadas a los sistemas hidrológicos y a los huéspedes que parasitan. El linaje 1 está restringido a la Península de Baja California asociado al pez estuarino Dormitator latifrons. El linaje 2, asociado al mismo pez que el linaje 1 pero distribuido en la parte continental de México, desde Topolobampo, Sinaloa hasta el Río Cuitzmala, Jalisco. El linaje 3, distribuido en el Río Coatzacoalcos y el Río Espino en el Golfo de México asociado a Dormitator maculatus. Los linajes 4 y 5, al igual que el 95 linaje 3 parasitan al mismo huésped, pero distribuidos en sistemas hidrológicos de la vertiente del atlántico en Costa Rica y Honduras respectivamente. Los linajes 6 y 7, se encontraron distribuidos en la vertiente del Océano Pacífico en el suroeste de México y sistemas hidrológicos de Guatemala asociados a Dormitator latifrons. El linaje 8, distribuido en sistemas hidrológicos dulceacuícolas de ambas vertientes de Costa Rica asociado a 6 especies de peces de la familia Cichlidae. El linaje 9, distribuido en dos presas del sistema hidrológico Grijalva-Usumacinta, asociado al cíclido Vieja pearsei. Finalmente el linaje 10 asociado a 5 especies de cíclidos dulceacuícolas distribuidos en el sureste de México. Escenario geográfico y distribución parásito-huésped Lo más interesante de este estudio se relaciona con la distribución de cada una de estas especies crípticas (linajes) y de sus huéspedes. El linaje 1 de este estudio fue registrado por primera vez como Neoechinorhynchus (Neoechinorhynchus) golvani por Méndez et al. (2010), en los oasis de Baja California Sur asociado a Dormitator latifrons. Interesantemente, este huésped es un pez estuarino que se distribuye en lagunas costeras del Océano Pacífico desde el Golfo de California hasta las Costas de Perú (Galván-Quesada et al. 2016). El linaje 2 se encontró asociado a este mismo huésped pero en la parte continental de México, en lagunas y ríos de los estados de Sinaloa, Nayarit y Jalisco. Recientemente, Monks et al. (2011) describieron a la especie Neoechinorhynchus (Neoechinorhynchus) brentnickoli en lagunas costeras de Guerrero y Sinaloa, sin embargo, con este estudio se determinó que esta especie solo esta distribuida entre los estados de Guerrero y Colima. Siguiendo sobre la distribución del mismo huésped, en este estudio encontramos el linaje 6 de una sola localidad en el 96 estado de Oaxaca. En un estudio previo Pinacho-Pinacho et al. (2012) describieron la especie Neoechinorhynchus (N.) mamesi en tres lagunas costeras de Chiapas del mismo huésped. Finalmente, en este estudio se encontró el linaje 7 del mismo huésped de una solo localidad en Guatemala. Con estos datos se demuestra que Dormitator latifrons distribuido en las costas del Océano Pacífico es parasitado por al menos 6 especies/y o linajes de Neoechinorhynchus, dos de estas formalmente descritas (Monks et al. 2011; Pinacho-Pinacho et al. 2012). Por otro lado, en un estudio previo de Dormitator latifrons a lo largo de su distribución geográfica mostró un solo linaje con bajos niveles de variación genética (Galván-Quesada et al. 2016). El linaje 3 se encontró asociado a Dormitator maculatus en lagunas y ríos de los estados de Veracruz y Tabasco. La distribución de este pez estuarino abarca lagunas costeras de la vertiente del Océano Atlántico desde la Florida en Estados Unidos hasta las costas de Brasil. Sin embargo, un estudio reciente demostró que este pez representa dos linajes, uno en el Golfo de México y el otro en el mar Caribe (Galván-Quesada et al. 2016). Pinacho-Pinacho et al. (2014) describieron a Neoechinorhynchus (N.) mexicoensis en el Río Papaloapan Veracruz del mismo huésped. El linaje 4 de este estudio se recolectó de una solo localidad en la costa atlántica de Costa Rica. Finalmente, el linaje 5 se recolectó de una solo localidad en Honduras. En contraste a Dormitator latifrons distribuido en las costas del Pacífico, Dormitator maculatus distribuido en las zonas costeras del Atlántico se encontró parasitado por al menos 4 especies/y o linajes de Neoechinorhynchus, estando solo una de estas formalmente descrita (Pinacho-Pinacho et al. 2014). Los linajes 8, 9 y 10 están estrechamente relacionados a sus huéspedes de la familia Cichlidae en Centroamérica. Teniendo en cuenta que existen mas de 120 especies de cíclidos y que la diversificación de este grupo es uno de los mas complejos 97 en todo Centroamérica (Concheiro-Pérez et al. 2007; Ř íčan et al. 2008). Existen diferentes escenarios posibles sobre la colonización de los cíclidos en Centroamérica dependiendo del autor, los cuales son: 1) varios autores han apoyado una colonización a mitad del Cenozoico (Concheiro Pérez et al. 2007; Hulsey et al. 2010, 2011); 2) una colonización masiva en el Cretácico-Paleoceno (Chakrabarty 2006), y 3) dos colonizaciones de Centroamérica, una hacia las Antillas mayores se produjo de Sudamérica dentro de un corto periodo de tiempo durante el Oligoceno y la otra colonización de Centroamérica se produjo en el Mioceno (inferior-medio). Centroamérica después se fragmentó en varias ocasiones durante la segunda mitad del Mioceno, lo que llevó a la formación de las actuales provincias ictiológicos, antes del cierre final del Istmo de Panamá (Říčan et al. 2013). Teniendo en cuenta esta información nos podemos plantear las siguientes preguntas; ¿cómo afecto este proceso de diversificación de los cíclidos a los parásitos del género Neoechinorhynchus?; ¿el ancestro común de los cíclidos que colonizaron Centroamérica ya tendrían su Neoechinorhynchus o estos parásitos los adquirieron después de la colonización?. Las respuestas a estas preguntas probablemente se podrían obtener a partir de las especies de Neoechinorhynchus asociados a cíclidos africanos y de Sudamérica. Adicionalmente a estos 3 linajes, Neoechinorhynchus (Neoechinorhynchus) panucensis y Neoechinorhynchus (Neoechinorhynchus) golvani son la fauna principal de los peces de la familia Cichlidae. Por lo tanto, con este estudio se demuestra que los cíclidos son parasitados por al menos 5 especies /y o linajes en Centroamérica. De manera general se puede observar que la distribución geográfica de cada especie /y o linaje de Neoechinorhynchus están asociadas con diferentes barreras biogeográficas que fragmentaron los diferentes sistemas hidrológicos en Centroamérica y que en algunas ocasiones también influenciaron en la distribución de sus huéspedes 98 por eventos de vicarianza. Por ejemplo, la separación del linaje 1 está asociada con el evento geológico que separó la Península de Baja California del resto del continente. Otro ejemplo es la divergencia entre Neoechinorhynchus (Neoechinorhynchus) panucensis y Neoechinorhynchus (Neoechinorhynchus) golvani, linajes 8, 9 y 10, la cual está estrechamente relaciona al surgimiento del eje neovolcánico y la separación del clado Herhycthys del resto de los cíclidos de Centroamérica. Literatura citada Concheiro-Pérez G. A., O. Rican, G. Ortí, E. Bermingham, I. Doadrio y R. Zardoya. 2007. Phylogeny and biogeography of 91 species of heroine cichlids (Teleostei: Cichlidae) based on sequences of the cytochrome b gene. Molecular Phylogenetics and Evolution, 43: 91–110. Chakrabarty P. 2006. Systematics and historical biogeography of Greater Antillean Cichlidae. Molecular Phylogenetics and Evolution, 39: 619–627. Galván-Quesada S., I. Doadrio, F. Alda, A. Perdices, R. G. Reina, M. García Varela, N. Hernández, A. Campos Mendoza, E. Bermingham y O. Domínguez- Domínguez. 2016. Molecular phylogeny and biogeography of the amphidromous fish genus Dormitator Gill 1861 (Teleostei: Eleotridae). PLOSONE DOI: 10.1371/journal.pone.0153538. Hulsey C. D., B. P. KecK y P. R. J.r. Hollingsworth. 2011. Species tree estimation and the historical biogeography of heroine cichlids. Molecular Phylogenetics and Evolution, 58: 124–131. Hulsey C. D., P. R. Jr. Hollingsworth y J.A. Fordyce. 2010. Temporal diversification of Central American cichlids. BMC Evolutionary Biology, 10: 279. 99 Méndez O., G. Salgado-Maldonado, J. M. Caspeta-Mandujano y G. Cabañas-Carranza. 2010. Helminth parasites of some freshwater fishes from Baja California Sur, Mexico. Zootaxa, 2327: 44–50. Monks S., G. Pulido-Flores y J. Violante-González. 2011. A new species of Neoechinorhynchus (Acanthocephala: Neoechinorhynchidae) in Dormitator latifrons (Perciformes: Eleotridae) from the Pacific Coast of Mexico. Comparative Parasitology, 78: 21–8. Pinacho-Pinacho C. D., A. L. Sereno-Uribe y García-Varela M. 2014. Morphological and molecular data reveal a new species of Neoechinorhynchus (Acanthocephala: Neoechinorhynchidae) from Dormitator maculatus in the Gulf of Mexico. Parasitology International, 63: 763–771. Pinacho-Pinacho C. D., A. L. Sereno-Uribe, G. Pérez-Ponce de León y M. García- Varela. 2015. Checklist of the species of Neoechinorhynchus (Acanthocephala: Neoechinorhynchidae) in fishes and turtles in Middle-America, and their delimitation based on sequences of the 28S rDNA. Zootaxa, 3985: 098–116. Pinacho-Pinacho C. D., G. Pérez-Ponce De León y M. García-Varela. 2012. Description of a new species of Neoechinorhynchus (Acanthocephala: Neoechinorhynchidae) a parasite of Dormitator latifrons from Southwestern Mexico based on morphological and molecular characters. Parasitology International, 61: 634–644. Říčan O., I. Piálek, R. Zardoya, I. Doadrio y J Zrzavý. 2013. Biogeography of the Mesoamerican Cichlidae (Teleostei: Heroini): colonization through the GAARlandia land bridge and early diversifcation. Journal of Biogeography, 40: 579–593. 100 Říčan O., R. Zardoya y I. Doadrio. 2008. Phylogenetic relationships of Middle American cichlids (Cichlidae, Heroini) based on combined evidence from nuclear genes, mtDNA, and morphology. Molecular Phylogenetics and Evolution, 49: 941–957. 101                                     5. CONCLUSIONES GENERALES 102 • El género Neoechinorhynchus es el grupo más diverso de acantocéfalos con más de 116 especies con una distribución cosmopolita, en este estudio para una pequeña área como Centroamérica la diversidad fue inesperada encontrándose al menos 10 especies putativas (linajes), duplicándose en número las nueve especies descritas previamente para esta región. • De las nueve especies formalmente reconocidas en Centroamérica, Neoechinorhynchus (Neoechinorhynchus) mamesi Pinacho-Pinacho, Pérez-Ponce de León y García-Varela 2012 y Neoechinorhynchus (Neoechinorhynchus) mexicoensis Pinacho-Pinacho, Sereno-Uribe y García-Varela 2014, fueron descritas como parte de esta tesis doctoral. • Neoechinorhynchus representa un complejo de especies crípticas que comprende 10 linajes con evolución independiente, estrechamente relacionadas a los sistemas hidrológicos y a las especies de huéspedes que parasitan. • El pez estuarino Dormitator latifrons se distribuye en lagunas costeras del Océano Pacífico desde el Golfo de California hasta las Costas de Perú, en este estudio se encontró que este pez es parasitado por Neoechinorhynchus (N.) brentnickoli y Neoechinorhynchus (N.) mamesi y por al menos otras cuatro especies crípticas (linajes 1, 2, 6 y 7). • Dormitator maculatus es otro pez estuarino que se distribuye en las lagunas costeras de la vertiente del Océano Atlántico desde la Florida en Estados Unidos hasta las costas de Brasil, con este estudio se demuestra que esta especie de pez es parasitada por Neoechinorhynchus (N.) mexicoensis y tres especies crípticas (linajes 3, 4 y 5). 103 • Peces de la familia Cichlidae es el grupo de mayor radiación en Centroamérica con más de 120 especies. Actualmente, Neoechinorhynchus (Neoechinorhynchus) panucensis y Neoechinorhynchus (N.) golvani son especies representativas de esta familia. En este estudio se encontraron al menos otras tres especies crípticas (linajes 8, 9 y 10), asociadas a estos peces dulceacuícolas. • De acuerdo a los patrones de distribución y los procesos de especiación en Neoechinorhynchus spp. pudimos observar que estos están estrechamente relacionados a los sistemas hidrológicos (cuencas hidrológicas, lagos cerrados, y lagunas costeras), a las especies de huéspedes definitivos como intermediarios (especies de peces, especies de ostrácodos) y a las características ecológicos (salinidad vs agua dulce). • Los procesos de variación morfológica en el género son conservados, ya que de los nueve linajes detectados, solo uno (linaje 8) fue morfológicamente diferente. 104                                                                             6. APÉNDICES 105           6. 1. Apéndice 1 Un enfoque coalescente en la delimitación de especies en endoparásitos con complejos ciclos de vida: Un ejemplo en un grupo hiper-diverso (Acanthocephala, Neoechinorhynchidae, Neoechinorhynchus) en Centroamérica Carlos Daniel Pinacho-Pinacho y Martín García-Varela En preparación 106 Un enfoque coalescente en la delimitación de especies en endoparásitos con complejos ciclos de vida: Un ejemplo en un grupo hiper-diverso (Acanthocephala, Neoechinorhynchidae, Neoechinorhynchus) en Centroamérica CARLOS DANIEL PINACHO-PINACHO1, 2, MARTÍN GARCÍA-VARELA2 1 Posgrado en Ciencias Biológicas, Universidad Nacional Autónoma de México; 2 Departamento de Zoología, Instituto de Biología, Universidad Nacional Autónoma de México, Ap. Postal 70-153, Ciudad Universitaria, México D.F., C.P. 04510, México RESUMEN La delimitación de especies es uno de los temas centrales en biología evolutiva para reconocer, describir y estimar la diversidad biológica del planeta. Con el avance en los métodos de delimitación de especies ha sido posible poner a prueba las hipótesis taxonómicas a fin de generar propuestas robustas. El presente estudio tiene como objetivo investigar la diversidad y los límites entre especies del género Neoechinorhynchus en Centroamérica, un grupo de endoparásitos ampliamente distribuidos en peces dulceacuícolas, marinos, estuarinos y tortugas dulceacuícolas. Se llevo a cabo el muestreo en una amplia diversidad de sistemas hidrológicos (ríos, lagos, lagunas, esteros y arroyos), los huéspedes fueron revisados para obtener tejidos de diferentes especies de Neoechinorhynchus. Se amplificaron y secuenciaron 351 especímenes para el gen citocromo oxidasa 1 (COI), 329 especímenes para los espaciadores transcritos internos (ITS1+5.8S+ITS2) y 277 especímenes para los dominios D2+D3 de la subunidad mayor (28S). La delimitación de especies se realizó mediante dos enfoques: como primer paso se 107 obtuvó un árbol guía para el gen citocromo oxidasa 1 de todos los ejemplares secuenciados (n=351), el cual fue evaluado por diferentes métodos de delimitación de especies (ABGD, GMYC), como segundo enfoque el alineamiento de COI fue recortada y combinada con las otras bases de datos (COI+ITS+28S) en 203 ejemplares para obtener un segundo árbol guía mediante un análisis de árbol de especies (species tree en *BEAST). La evaluación morfológica de los especímenes se realizó sobre la longitud de los ganchos apicales, medios y posteriores de la proboscis ya que estos son caracteres diagnósticos para diferenciar a las especies, se realizaron análisis multivariado de varianza (MANOVA) y componentes principales (PCA). Los resultados mostraron que adicionalmente a las nueve especies descritas morfológicamente en Centroamérica, otras 10 especies putativas (linajes) fueron diagnosticadas basadas en ambos arboles guía. Por lo tanto, se concluye que con datos basados en los métodos para la delimitación de especies más análisis estadísticos morfológicos mostraron que el género Neoechinorhynchus en Centroamérica es un grupo hiper-diverso conformado por varias especies crípticas. En este estudio se encontraron al menos nueve especies cripticas y una especie morfológicamente distinta (linaje 8) asociados a especies de peces estuarinos del género Dormitator y peces dulceacuícolas de la familia Cichlidae. INTRODUCCIÓN Los acantocéfalos del género Neoechinorhynchus Stiles y Hassall, 1905 son endoparásitos de peces dulceacuícolas, marinos y estuarinos, así como de anfibios y tortugas dulceacuícolas. Estos parásitos son considerados uno de los géneros más diversos dentro del phylum Acanthocephala con aproximadamente 116 especies descritas con una distribución cosmopolita (Amin 2013; Smales 2013). En total 49 especies se han descrito 108 para el continente americano, 33 especies para Norteamérica y 16 para Centro y Sudamérica (Amin 2002; Barger et al. 2004; Amin y Heckmann 2009; Pinacho-Pinacho et al. 2012; Salgado-Maldonado 2013). Particularmente, en México nueve especies del género Neoechinorhynchus se han descrito, dos de estas especies parasitan tortugas dulceacuícolas; N. (N.) schmidti Barger, Thatcher y Nickol, 2004 y N. (N.) emyditoides Fisher, 1960; y las otras siete ocurren en peces dulceacuícolas, marinos y estuarinos; N. (N.) roseum Salgado-Maldonado 1978; N. (N.) golvani, Salgado-Maldonado 1978; N. (N.) chimalapasensis Salgado-Maldonado, Caspeta-Mandujano y Martínez-Ramírez, 2010; N. (N.) brentnickoli Monks, Pulido-Flores y Violante-González, 2011; N. (N.) mamesi Pinacho-Pinacho, Peréz-Ponce de Léon y García-Varela, 2012, N. (N.) panucensis Salgado-Maldonado 2013, y N. (N.) mexicoensis Pinacho-Pinacho, Sereno-Uribe y García-Varela, 2015 (Pinacho-Pinacho et al. 2012; Salgado-Maldonado 2013). Probablemente en acantocéfalos el método más usado para delimitar especies es basado en distancias genéticas (distancias p), que corresponde con el porcentaje de diferencias genéticas pareadas entre grupos de especies, todo esto apoyado por análisis filogenéticos donde una especie es diagnosticada como un clado. Sin embargo, en la última década han surgido múltiples métodos para delimitar especies (ver Camargo y Sites 2013). Estos métodos de delimitación disponibles son poco explorados en la delimitación de especies de diferentes grupos de parásitos, aunque sobresalen solo algunos estudios en trematodos (Martínez-Aquino et al. 2013; Herrmann et al. 2014; Blasco-Costa et al. 2014; Locke et al. 2015a, b). En este estudio el objetivo es explorar los límites entre especies del 109 género Neoechinorhynchus, un grupo de acantocéfalos ampliamente distribuidos en Centroamérica. MATERIALES Y MÉTODOS Recolecta de las muestras Todos los huéspedes definitivos de acantocéfalos del género Neoechinorhynchus fueron capturados en México, Guatemala, Honduras y Costa Rica durante diversas salidas de campo en un periodo del 2012-2016. Peces y tortugas de 57 localidades fueron capturados con artes de pesca como chinchorro, atarraya, redes de enmalle y electropesca (Tabla 1). El material helmintológico se recolectó del intestinos de peces de la familia Eleotridae (principalmente de la especies Dormitator latifrons y D. maculatus) distribuidos en las vertiente del océano Pacífico y del océano Atlántico respectivamente. Adicionalmente se recolectaron parásitos del intestino de peces de las familias Cichlidae (principalmente especies de los géneros: Paraneetroplus spp., Cichlasoma spp., Parachromis spp., Herichthys spp., Vieja spp., Thorichthys spp.); Achiridae (Achirus mazatlanus); Gobiidae (Awaous banana) y de tortugas dulceacuícolas de la familia Emydidae (Trachemys scripta). A los huéspedes se les practicó una disección sobre la superficie ventral. Posteriormente se extrajo el intestino y se revisó bajo el microscopio estereoscópico en busca de acantocéfalos. Los acantocéfalos recuperados se fijaron de dos maneras: un grupo de ejemplares se colocaron en viales con agua destilada a 4°C durante 24 h, para posteriormente ser fijados en etanol al 70%. Otro grupo de parásitos se colocaron directamente en criotubos con etanol absoluto, método que permite la adecuada conservación del organismo y del material genético. Los parásitos fijados al 70% se usaron 110 para realizar preparaciones permanentes para su identificación morfológica. Para la identificación taxonómica, todas las muestras fueron teñidas con Paracarmín de Mayer, deshidratados en series graduales de etanol, aclarados con salicilato de metilo y se montaron en portaobjetos permanentes con bálsamo de Canadá. Las preparaciones permanentes de los ejemplares se depositaron en la Colección Nacional de Helmintos (CNHE) del Instituto de Biología, UNAM. 111 Tabla 1. Información de los especímenes: número de sitios de colecta (CS), especies de parásitos colectados, numero de organismo secuenciados (N), huéspedes registrados, localidades muestreadas (código), números de DNA secuenciados para el 28S, números de DNA secuenciados para ITSs, números de DNA secuenciados para COI, y números de especímenes depositados en la Colección Nacional de Helmintos (CNHE). CS Especies/Linaje de Parásitos N Huéspedes Localidades (código) LSU ITS COI CNHE 1 Linaje 1 3 Dormitator latifrons Todos los Santos, Baja California Sur, México (TLSB) 1025 1026 1027 1025 1026 1027 XX 2 Linaje 1 5 D. latifrons Oasis San José del Cabo, Baja California Sur, México (OBCS) 1020 1021 1022 1023 1024 1020 1021 1022 1023 1024 1020 1022 1023 8586 3 Linaje 2 4 D. latifrons Topolobampo, Sinaloa, México (TOSI) 660 661 662 663 660 661 662 663 660 661 662 663 4 Linaje 2 9 D. latifrons El Huizache, Sinaloa, México (WISI) 1015 1016 1017 1018 1019 1015 1016 1017 1018 1019 1015 1016 1017 1018 1019 1555 1556 1558 1559 8587 5 Linaje 2 9 D. latifrons Vía Ferrea, Escuinapa, Sinaloa, México (ESSI) 1010 1011 1012 1013 1014 1010 1011 1012 1013 1014 1010 1011 1012 1013 1014 1560 1561 1563 1564 8588 6 Linaje 2 8 D. latifrons Nuevo Vallarta, Nayarit, México (NVNA) 866 866 866 112 867 868 869 870 867 868 869 870 867 868 869 870 1551 1552 1554 7 Linaje 2 6 D. latifrons Estero Chamela, Jalisco, México (CHJA) 176 (FJ388990) 876 877 878 879 880 176 876 877 878 879 880 876 877 878 879 880 8589 8 Linaje 2 1 D. latifrons Río Cuitzmala, Jalisco, México (CUJA) 73 (FJ388989) 73 73 9 N. (N.) brentnickoli 10 D. latifrons Laguna de Cuyutlan, Colima, México (LCCO) 871 872 873 874 875 871 872 873 874 875 871 872 873 874 875 1546 1547 1548 1549 1550 10 N. (N.) brentnickoli 10 D. latifrons Boca de Apiza, Michoacán, México (BAMI) 694 695 696 697 698 699 700 701 702 703 694 695 696 698 699 700 701 702 703 694 695 696 697 698 699 700 701 702 703 8176 11 N. (N.) brentnickoli 10 D. latifrons Estero Huahua, Michoacán, México (EHMI) 674 675 676 677 678 674 675 676 677 678 674 675 676 677 678 679 680 681 682 683 8177 12 N. (N.) brentnickoli 10 D. latifrons Estero Mexcalhuacan, Michoacán, México (EMMI) 664 665 666 664 665 666 664 665 666 8173 113 667 668 667 668 667 668 669 670 671 672 673 13 N. (N.) brentnickoli 10 D. latifrons Estero Barra de Pichi, Michoacán, México (EBPM) 684 685 686 687 688 684 685 686 687 688 684 685 686 687 688 689 690 691 692 693 8174 14 N. (N.) brentnickoli 10 D. latifrons Laguna de Coyuca, Guerrero, México (LCGU) 650 651 652 653 654 655 656 657 658 659 651 654 655 656 657 658 650 651 652 653 654 655 656 657 658 659 8175 15 N. (N.) brentnickoli 10 D. latifrons Laguna de Tres Palos, Guerrero, México (LTGU) 71 274 275 276 278 279 280 281 282 283 71 274 275 276 278 279 280 281 282 283 71 274 275 276 278 279 280 281 282 283 8178 16 N. (N.) brentnickoli 10 D. latifrons Río Tamarindo, Chautengo, Guerrero, México (RTCG) 714 715 716 717 718 714 715 716 717 718 714 715 716 717 718 719 720 721 722 723 8179 114 17 N. (N.) roseum 3 Achirus mazatlanus Laguna el Caimanero, Sinaloa, México (LCSI) 212 (FJ388999) 212 1378 1379 212 6762 633 634 18 N. (N.) roseum 3 Citharichthys gilberti Estero La Tovara, Nayarit, México (ETSI) 211 (FJ389000) 211 1387 1388 211 6763 19 Linaje 6 11 D. latifrons Puente Manialtepec, Oaxaca, México (PMOA) 1989 1990 1991 1989 1990 2421 2422 2423 2424 2425 2426 2427 2428 2429 1990 1991 2420 2421 2422 2423 2424 2425 2426 20 N. (N.) mamesi 10 D. latifrons Estero Joaquin Amaro, Chiapas, México (EJCH) 762 763 768 769 770 762 763 768 769 770 762 763 764 765 766 767 768 769 770 771 8183 21 N. (N.) mamesi 10 D. latifrons Laguna la Conquista, Chiapas, México (LCCH) 752 753 755 756 752 753 754 755 756 752 753 754 755 756 757 758 759 760 761 8184 22 N. (N.) mamesi 9 D. latifrons Laguna Rion Pijijiapan, Chiapas, México (LRPC) 730 732 733 729 731 732 733 724 725 727 728 729 730 731 732 733 8180, 8181, 8182 115 23 N. (N.) mamesi 5 D. latifrons Quebrada Ganados, Costa Rica (QGCR) 1686 1687 1686 1687 1688 1689 1690 XX 8590 24 Linaje 4 12 D. maculatus Playa Grande, Costa Rica (PGCR) 1713 1714 1713 1714 1716 1717 2412 2413 2415 2416 2417 2418 2419 1713 1714 1716 1717 2412 2413 2414 2415 2416 2417 2418 2419 8191 25 Linaje 7 6 D. latifrons Las Lisas, Guatemala (LLGU) 2102 2103 2106 2101 2102 2103 2104 2105 2106 2101 2102 2103 2104 2105 2106 26 Linaje 5 6 D. maculatus Las Brisas del Chamalecon Honduras (LBCH) 2106 FALSO 2487 2488 2489 2490 2491 2488 2490 2491 27 Linaje 8 2 Parachromis managuensis Lago Jalapa, Costa Rica (LJCR) 1697 1696 1697 1697 Linaje 8 2 Parachromis loisellei Lago Jalapa, Costa Rica (LJCR) 1698 1699 1698 1699 1698 1699 Linaje 8 4 Amphilophus longimanus Lago Jalapa, Costa Rica (LJCR) 1700 1701 1700 1701 1702 1703 1700 1701 1702 1703 8592 Linaje 8 6 Heterotilapia multiespinosa Lago Jalapa, Costa Rica (LJCR) 1704 1704 1705 1706 1704 1705 1706 1707 1708 1709 Linaje 8 2 Archocentrus centrarchus Lago Jalapa, Costa Rica (LJCR) 1710 1711 1711 1712 1710 1711 1712 28 Linaje 8 2 Amatitlania nigrofasciata Quebrada Puercos, Costa Rica (QPCR) 72 (FJ388998) 786 72 72 786 6757 116 29 N. (N.) golvani 2 Cichlasoma trimaculatum Las Lisas, Guatemala (LLGU) XX XX 2400 2401 30 Linaje 10 5 Thorichthys meeki Hool, Campeche, Mexico (HOCM) 1785 1786 1787 1788 1784 1785 1786 1787 1788 1784 1785 1786 1787 1788 31 Linaje 10 3 Thorichthys helleri La Libertad, Campeche, Mexico (LLCM) XX 2377 2378 2379 2377 2378 2379 Linaje 10 3 Cichlasoma urophthalmum La Libertad, Campeche, Mexico XX 2374 2375 2373 2374 2375 Linaje 10 1 Petenia splendida La Libertad, Campeche, Mexico XX 2376 2376 32 Linaje 9 11 Vieja pearsei Presa Chicoasen, Chiapas, México (PCCH) 207 294 295 296 297 298 299 300 301 302 303 207 294 295 296 297 298 299 300 301 302 303 207 294 295 296 297 298 299 300 301 302 303 6755 33 Linaje 9 6 Vieja pearsei Presa Nezahualcoyolt, Chiapas, México (PNCH) 209 380 381 382 607 209 380 381 382 607 608 209 380 381 382 607 608 6756 34 Linaje 10 3 Petenia splendida Metzabok, Chiapas, Mexico (MZCM) XX 2364 2362 2363 2364 Linaje 10 3 Cichlasoma urophthalmum Metzabok, Chiapas, Mexico XX 2358 2359 2358 2359 2360 35 Linaje 10 3 Cichlasoma urophthalmum El Ocotalito, Chiapas, Mexico (EOCM) XX 2384 2383 2385 2384 2383 2385 Linaje 10 3 Petenia splendida El Ocotalito, Chiapas, Mexico XX 2380 2380 2381 2382 36 Linaje 10 3 Cichlasoma urophthalmum Naha, Chiapas, Mexico (NHCM) XX 2370 2368 2369 2370 2368 2369 117 Linaje 10 3 Paraneetroplus synspilus Naha, Chiapas, Mexico XX 2365 2366 2367 2365 2366 2367 Linaje 10 2 Petenia splendida Naha, Chiapas, Mexico XX 2371 2371 2372 37 N. (N.) golvani 5 Cichlasoma urophthalmum Presa Temascal, Oaxaca, Mexico (PTOM) 1318 1319 1320 1321 1322 1318 1320 1321 1321 1322 8593 N. (N.) golvani 5 Cichlasoma salvini Presa Temascal, Oaxaca, Mexico 1313 1314 1315 1316 1317 1315 1317 xx 8594 38 Linaje 10 11 Parachromis friedrichstalii Lago Canitzan, Tenosique, Tabasco, México (LCTT) 156 336 337 338 339 340 602 603 604 605 606 156 336 337 338 339 340 602 603 604 605 606 156 336 337 338 339 340 603 604 605 606 6767 39 Linaje 10 10 Cichlasoma urophthalmum Río Carrizal, Tabasco, México (RCTA) 121 304 305 306 307 308 309 310 316 317 121 304 305 306 307 309 310 316 317 121 304 305 306 307 308 309 310 316 317 6754 40 Linaje 10 4 Cichlasoma urophthalmum Lago las Ilusiones, Tabasco, México (LITA) 169 378 379 169 378 379 169 378 379 397 41 Linaje 10 5 Cichlasoma urophthalmum Emiliano Zapata, Tabasco, México (EMZT) 1778 1779 1780 1781 1782 1778 1779 1780 1781 1782 1778 1779 1780 1781 1782 8595 42 N. (N.) golvani 11 Paraneetroplus fenestratus Lago de Catemaco, Veracruz, México (LCAT) 70 284 70 284 70 284 601, 603, 604, 606, 118 285 286 287 288 289 290 291 292 293 285 287 288 289 290 291 293 285 286 287 288 289 290 291 292 293 631, 632 6783 N. (N.) golvani 5 Cichlasoma urophthalmum Lago de Catemaco, Veracruz, México XX XX 1323 1324 1325 1326 1327 N. (N.) golvani 4 Thorichthys ellioti Lago de Catemaco, Veracruz, México XX XX 1328 1329 1331 1332 43 N. (N.) panucensis 1 Herichthys sp. Río Pantepec, Veracruz, México (RPVE) 704 704 704 44 N. (N.) panucensis 3 Herichthys cyanoguttatus Axtlan de Terrazas, San Luis Potosí, México (ATVE) 213 383 384 213 383 384 XX 6758 45 N. (N.) mexicoensis 5 D. maculatus Laguna de Tamiahua, Veracruz, México (LTVE) 921 922 923 924 925 921 922 923 924 925 XX 8334 46 N. (N.) mexicoensis 6 D. maculatus Laguna de Alvarado, Veracruz, México (LAVE) 206 321 322 323 324 325 206 321 322 323 324 325 321 322 323 324 325 6760 47 N. (N.) mexicoensis 5 D. maculatus Río Papaloapan, Tlacotalpan, Veracruz, México (RPTL) 1363 1364 1365 1363 1364 1365 1366 1367 1363 1365 1366 1367 8673, 8332, 8333 N. (N.) mexicoensis 6 Cichlasoma urophthalmum Río Papaloapan, Tlacotalpan, Veracruz, México 155 174 311 312 313 314 155 174 311 312 313 314 311 312 313 314 6759 48 N. (N.) mexicoensis 5 D. maculatus Río la palma, Veracruz, México (RPVE) 1343 1344 1345 1343 1344 1345 XX 8596 119 1346 1347 49 N. (N.) mexicoensis 5 D. maculatus Laguna de Sontecomapa, Veracruz, México (LSVE) 1333 1334 1335 1336 1337 1333 1334 1335 1336 1337 XX 8597 50 Linaje 3 7 D. maculatus Río Coatzacoalcos, Veracruz, México (RCVE) 1353 1354 1355 1356 1357 1353 1354 1355 1356 1357 1353 1357 1358 1359 1360 1361 1362 8598 51 Linaje 3 5 D. maculatus Río Espino, Tabasco, México (RETA) 1368 1369 1370 1371 1372 1368 1369 1370 1371 1372 1372 1376 Linaje 3 4 Petenia splendida Río Espino, Tabasco, México 120 507 508 509 507 508 509 XX 52 Linaje 3 5 D. maculatus El Milagro, Campeche, México 1789 1790 1791 1792 1793 1789 1790 1791 1792 1793 XX 8599 53 N. (N.) schmidti 5 Trachemys scripta Pantanos de Centla, Tabasco, México 210 609 610 611 612 210 609 610 611 612 XX 6764 54 N. (N.) emyditoides 9 Trachemys scripta Lago de Catemaco, Veracruz, México 331 332 333 334 335 450 451 452 453 331 332 333 334 335 451 452 453 331 332 333 334 335 450 451 452 6737 55 N. (N.) emyditoides 9 Trachemys scripta Río Papaloapan, Tlacotalpan, Veracruz, México 326 326 326 6695 120 (RPVE) 327 328 329 330 439 440 441 442 327 328 329 330 439 440 441 442 446 327 328 329 330 439 440 441 442 446 56 N. (N.) emyditoides 9 Trachemys scripta Presa la Herradura, Monterrey, México (PHMN) 362 363 364 365 454 455 456 457 361 362 363 364 365 454 455 456 457 361 362 363 364 365 454 456 457 6696 57 N. (N.) chimalapasensis Awaous banana Río Negro, Santa María Chimalapa, Oaxaca, México (RNCH) 2187 2188 2187 2188 2187 2188 5018=1, 5019=1, 5020=12 121 Especies de parásitos muestreadas Los huéspedes fueron identificados utilizando las claves de Miller et al. (2005). Un espécimen de la especie Floridosentis mugilis Machado Filho 1951 fue utilizado como grupo externo en los análisis filogenéticos. Especies del género Neoechinorhynchus recolectadas durante esta investigación fueron identificadas siguiendo las claves de Amin (2002) y con las descripciones originales más recientes (por ejemplo, Pinacho-Pinacho et al. 2012; Salgado-Maldonado 2013). Amplificación y secuenciación de ADN Los gusanos colectados se incubaron a 56°C en una solución con 10 mM Tris-HCl (pH 7.6), 20 mM NaCl, 100 mM Na2 EDTA (pH 8.0), 1% Sarkosyl, y 0.1 mg/ml de proteinasa K. El DNA se extrajo del sobrenadante usando el reactivo DNAzol (Molecular Research Center, Cincinnati, Ohio, de acuerdo al protocolo proporcionado por el fabricante). Para un total de 351 organismos de Neoechinorhynchus spp., a lo largo de su distribución en México y partes de Centroamérica, parte del gen mitocondrial (COI) y de los espaciadores transcritos internos (ITS1, 5.8S, ITS2) y los dominios (D2+D3) del 28S ribosomal) fueron amplificados por medio de la reacción en cadena de la polimerasa (PCR). Un fragmento del gen mitocondrial, citocromo oxidasa subunidad 1 (COI) se amplificó utilizando el primer forward 5'-AGTTCTAATCATAA (R) GATAT (Y) GG-3' y el primer reverse 5'-TAAACTTCAGGGTGACCAAAAAATCA-3'. Sin embargo, primers específicos fueron diseñadas para algunas de las especies (Ver Pinacho-Pinacho et al. 2012). La región de los ITS se amplificó utilizando el primer forward BD1 5'- GTCGTAACAAGGTTTCCGTA-3' y el primer reverse BD2 5'- ATCTAGACCGGACTAGGCTGTG-3' (Bowles et al. 1995). Los dominios (D2 + D3) del 122 28S ribosomal fueron amplificados utilizando el primer forward 502 5' - CAAGTACCGTGAGGGAAAGTTGC-3' y el primer reverse 536 5'- GTCGATAGGACTCCCTTTG-3' (García-Varela y Nadler 2005). Las reacciones de PCR (25µl) consistieron en 10µM de cada primer, 2.5µl de buffer 10x, 2 mM de MgCl2, y 1U de Taq ADN polimerasa (Taq Platinum, Invitrogen Corporation, São Paulo, Brasil). Parámetros de los ciclos de la PCR para amplificaciones de los espaciadores transcritos internos (ITS1+5.8S+ITS2) y Dominios (D2+D3) del 28S ribosomal incluyeron desnaturalización a 94° C durante 1 min, seguido por 35 ciclos de 94° C durante 1 min, alineamiento a 50° C durante 1 min, y una extensión a 72° C durante 1 min, seguido de una incubación posterior a la amplificación en 72° C durante 10 min. Condiciones de la PCR para la amplificación del citocromo oxidasa subunidad 1 (COI) fueron desnaturalización a 94° C durante 5 min, seguido por 35 ciclos de 94° C durante 1 min, alineamiento a 40-50° C durante 1 min, (dependiendo de la especie de Neoechinorhynchus) y una extensión a 72° C durante 1 min, seguido de una incubación post-amplificación a 72º C durante 10 min. Los productos amplificados por PCR fueron separados y observados en un gel de agarosa, teñido con bromuro de etidio al 1% en un buffer de Tris-Boratos, para posteriormente ser purificados y secuenciados usando primer internos. Los electroferogramas derivados de las reacciones de secuenciación se exportarán al programa de cómputo Codoncode, en donde se evaluó cada uno de los picos del electroferogramas. Alineamiento de secuencias y análisis filogenéticos Las secuencias obtenidas para cada uno de los genes fueron ensambladas en una secuencia consenso con el programa CodonCode (http://www.codoncode.com/). Posteriormente las secuencias consenso fueron alineadas con el programa ClustalW 123 (Thompson et al., 1994) y editadas manualmente con el programa MacClade (Madison y Madison 2002). Para los análisis filogenéticos el primer paso fue estimar el mejor modelo de sustitución de nucleótidos para cada una de las base de datos de todos los genes, así como la distribución gamma y el parámetro de la tasa de heterogeneidad entre sitios, los cuales se calcularon con el programa jModeltest (Posada 2008) de acuerdo al criterio de información de Akaike (AIC). Se realizaron análisis filogenéticos con dos métodos, máxima verosimilitud (ML) con el programa RaxML (Stamatakis 2006) e inferencia bayesiana (IB) con el programa MrBayes (Huelsenbeck y Ronquist 2001). Para los análisis de máxima verosimilitud el programa RaxML se utilizó, el modelo generado a partir de programa jModeltest se implementó en RaxML para cada una de los alineamientos (modelos menos complejos que el GTR no es posible implementar en RAxML). El apoyo de los nodos fue evaluado mediante 10,000 réplicas de bootstrap. La estimación de árboles filogenéticos con inferencia bayesiana se realizó con el programa MrBayes 3.1.2 (Huelsenbeck y Ronquist 2001). Se realizaron dos corridas simultáneas con cuatro cadenas (una fría y tres calientes) para cada corrida. Metropolis- coupling Markov chain Monte Carlo (MCMCMC = MC 3 ) se corrieron para 100 millones de generaciones, con un muestreo cada 10000 generaciones, y árboles del inicio fueron eliminados por un burnin del 25%. Los archivos de salidas de MrBayes fueron examinados con el programa Tracer v1.4 (Rambaut y Drummond 2007) para evaluar si hubo convergencia de los diferentes parámetros, determinar el número aproximado de generaciones a la que los valores de probabilidad se estabilizaron, identificar el tamaño efectivo de la muestra (EES) para cada parámetro, y la magnitud estimada de los parámetros del modelo en las corridas individuales y combinados. El primer 25% de 124 MCMCs se verificó para incluir todas las generaciones donde las cadenas habían alcanzado un estado estacionario. Probabilidades posteriores (PP) de los clados se obtuvieron del 50% del consenso de mayoría en los árboles después de excluir el 25% como burnin. Delimitación de especies La delimitación de especies se realizó mediante dos estrategias: a) como primer paso se obtuvó un árbol guía del gen COI con todas las muestras (n=351). Este primer árbol (IB) fue sometido al modelo GMYC (Pons et al. 2006) el cual estima la transición de coalescencia en patrones de ramificación de la especiación en un árbol ultramétrico bayesiano. Resumiendo, el método identifica el punto más probable (umbral) donde hay una transición en las tasas de ramificación (dentro y entre las especies) y compara la probabilidad del modelo de GMYC con un modelo nulo asumiendo que todas las secuencias se derivan de una sola especie (Pons et al. 2006). Se utilizó el árbol obtenido del análisis de inferencia bayesiana (BI) del (COI) el cual fue transformado en un árbol ultrametrico, totalmente dicotómico (politomias se resolvieron utilizando ramas de longitud cero) utilizando Mesquite v 1.12 (Maddison y Maddison 2011). Se identificaron las especies putativas utilizando el modelo de un solo y múltiples umbrales GMYC, implementada por SPLITS en el programa R (Species’ Llmits by Threshold Statistics versión 2.10 (https://r-forge.r-project.org/ projects/splits/). Adicionalmente el alineamiento de COI fue sometido al método ABGD (Puillandre et al. 2012), el cual busca automáticamente la distancia a la que se produce un gap de código de barras y ordena las secuencias en especies putativas sobre la base de esta distancia (Puillandre et al. 2012). En otras palabras, el método deduce estadísticamente la diferencia de códigos de barras de los datos y particiones de los datos en consecuencia. 125 Alineamiento del (COI) fue subido a la página siguiente (http://wwwabi.snv.jussieu.fr/public/abgd/ abgdweb.html) y el método ABGD se ejecutó con la configuración predeterminada (Pmin = 0.001, Pmax = 0.1, Steps = 10, X (relative gag width) = 1.5, Nb bins= 20) y con distancias K2P. b) como segunda estrategia se obtuvó un segundo árbol guía. Para poder obtener este árbol el alineamiento de COI fue recortada al mismo número de especímenes secuenciados para ITS y 28S. Las base de datos de COI+ITS+28S fue de 203 especímenes y estas bases de datos fueron analizadas con el método (Species Tree Ancestral Reconstruction, por sus siglas en inglés) en cual fue implementado en el programa *BEAST v.1.6.1 (Drummond y Rambaut 2007). Este método fue usado para buscar congruencia entre las topologías de los arboles obtenidos del análisis de inferencia bayesiana (IB) de los marcadores genéticos usados, citocromo oxidasa subunidad 1 (COI) y de los espaciadores transcritos internos (ITS1,5.8S,ITS2) y los dominios (D2+D3) del 28S ribosomal. El análisis en *BEAST opera bajo un marco bayesiano, el cual co-estima la distribución posterior de las especies y los árboles de genes, utilizando un modelo coalescente. El método combina priors de eventos de especiación y de genética de poblaciones, lo que permite estimar polimorfismo intraespecifico y sorteo incompleto de linajes en una estimación filogenética (Heled y Drummond 2010). El análisis en *BEAST se corrió para 100 millones de generaciones con una frecuencia de muestreo de cada 10,000 generaciones. Se utilizó un reloj log normal, sin calibración de fósiles y una tasa media fija a 1. El prior de árbol Yule se utilizó para el análisis a nivel de especie y un modelo coalescente constante se utilizó para el análisis a nivel de población. Modelos de evolución de secuencias de ADN fueron asignadas a cada partición con base a los resultados obtenidos con jModeltest (Posada 2008) (mismos modelos de sustitución utilizados en 126 análisis bayesiano y de máxima verosimilitud). Valores por defecto se utilizaron para el resto de los priors. El árbol de especies *BEAST final fue un árbol de clados de máxima credibilidad, posteriormente un burnin de 25% fue quitado. Convergencia en los análisis se confirmó con el programa Tracer v 1.5 (Rambaut y Drummond 2007), con el árbol de especies construido a partir del programa Tree Annotator v 1.6.1 (Drummond y Rambaut 2007). El apoyo a los nodos se determinó utilizando probabilidades posteriores (PP). Análisis morfológico El género Neoechinorhynchus posee más de 116 especies con una distribución cosmopolita, esta diversidad de especies se diferencian principalmente en el tamaño de los ganchos de la proboscis, la cual tiene 18 ganchos ordenados en tres hileras con 6 ganchos cada una, siendo estos ganchos un carácter diagnóstico del género y de las especies. En este estudio cada una de las especies candidatas reconocidas a través de ambos arboles guía fue analizada la longitud de los ganchos de la proboscis. Los ganchos de la proboscis se dividieron en ganchos apicales, medios y posteriores (Figura 1). Se tomaron medidas morfométricas para cada uno de estos ganchos para machos y hembras. Se realizaron análisis multivariado de varianza (MONOVA) y análisis de componente principales (PCA) con el programa Statistica (StatSoft, Inc. 2005. STATISTICA data analysis software system, version 7.1. www.statsoft.com). 127 Figura 1. Medidas de los ganchos apicales, medios y posteriores que fueron analizados en este estudio. a) N. (N.) golvani, b) N. (N.) mexicoensis, c) N. (N.) brentnickoli. a) b) c) Apical hook length Middle hook length Posterior hook length 9   128 RESULTADOS Recolecta del material biológico y delimitación de especies Se colectaron nueve especies del género Neoechinorhynchus formalmente descritas y 10 especies putativas (linajes) que fueron diagnosticadas en este estudio principalmente en México y algunas localidades de Centroamérica (ver Tabla 1; Figura 2). La especie N. (N.) brentnickoli se recolectó del intestino de Dormitator latifrons en ocho localidades de lagunas costeras y ríos en la vertiente del pacífico mexicano con una distribución que abarca desde el sur del estado de Guerrero hasta Colima. La especie N. (N.) roseum fue muestreada en dos localidades, una laguna y un estero principalmente en los estados de Sinaloa y Nayarit; esta especie de acantocéfalo está asociada a las especies de peces como Achirus mazatlanus y Citharichthys gilberti. Otra especie colectada fue N. (N.) mamesi la cual fue descrita por Pinacho-Pinacho et al. (2012); esta especie se recolectó en tres lagunas costeras del estado de Chiapas la cual está asociada a Dormitator latifrons. La especie N. (N.) golvani fue recolectada de tres localidades, Catemaco, Veracruz; Presa Temascal, Oaxaca, México y de la localidad las Lisas en Guatemala. Del intestino de tortugas dulceacuícolas se colectaron dos especies N. (N.) schmidti y N. (N.) emyditoides en una y tres localidades, respectivamente en el Golfo de México. Adicionalmente N. (N.) chimalapasensis, N. (N.) panucensis y N. (N.) mexicoensis fueron colectadas en las localidades tipo para estas especies. En total se recolectaron especímenes en 57 localidades de Centroamérica (Tabla 1; Figura 2). 129 Figura 2. Localidades de muestreo para Neoechinorhynchus spp. en Centroamérica Como parte de este estudio se diagnosticaron 10 linajes o especies putativas en peces estuarinos y dulceacuícolas (Figuras 3 y 4). El linaje 1 se recolectó en dos localidades del estado de Baja California Sur, México, este linaje está asociado a Dormitator latifrons. El linaje 2 se recolectó en seis localidades que abarca desde Topolobampo, Sinaloa hasta el Río Cuiztmala, Jalisco. Como linaje 3 se colectaron ejemplares en el Río Coatzacoalcos y Río el Espino, ambas localidades en el Golfo de México asociado al pez Dormitator maculatus. Los linajes 4 y 5 solo se recolectaron de una localidad (Playa Grande, Costa Rica y Las Brisas del Chamalecon, Honduras respectivamente) del intestino de Dormitator 130 maculatus. Los linajes 6 y 7 se colectaron de una localidad (Puente Manialtepec, Mexico y las Lisas, Guatemala, respectivamente), ambos del intestino de Dormitator latifrons. Como linaje 8 se colectaron especímenes en dos localidades de Costa Rica (Lago Jalapa y Quebrada Puercos) de 6 especies de peces de la familia Cichlidae. El linaje 9 se colectó del intestino de Vieja pearsei en dos presas del Río Grijalva en Chiapas, México. Finalmente el linaje 10 se colectó de múltiples localidades y huéspedes de la familia Cichlidae, principalmente en el sureste de México (Tabla 1; Figuras 3 y 4). 131 Figura 3. Primera estrategia para obtener árbol guía basado en 353 secuencias parciales del gen citocromo oxidasa 1 (COI). a) árbol ultrametrico obtenido del modelo GMYC, líneas negras en las terminales representan las entidades detectadas bajo GMYC, líneas grises representan los grupos obtenidos con el método ABGD con una divergencia del 1.3 al 2.2%. b) resumen del árbol guía, clados en colores representan especies o linajes. Valores en los nodos representan probabilidades posteriores. 132 Figura 4. Árbol de especies obtenido en *BEAST a partir de 203 especímenes para los genes COI+ITS+28S. Colores corresponden a cada linaje y/o especie de Neoechinorhynchus. Valores internos de los nodos representan probabilidades posteriores. 133 Análisis morfológico de MANOVA y PCA De los datos morfométricos, los ganchos de la proboscis mostraron la mayor variación entre especies y/o linajes, y entre la mayor fueron los ganchos apicales. Los ganchos medios y posteriores mostraron poca variación siendo muy similares entre linajes. De los 10 linajes encontrados en este estudio, solo el linaje 8 (Lago de Jalapa, Costa Rica) mostró una variación significativa en el tamaño de los ganchos apicales tanto en machos como en hembras con respecto a las otras especies y/o linajes en Centroamérica (Figura 5). Los otros 9 linajes no mostraron variación significativa con respecto a las otras especies. 0 10 20 30 40 50 60 70 80 90 100 0 10 20 30 40 50 60 70 80 90 100 N . s c h m id ti ( n = 1 5 ) N . e m y d it o id e s ( n = 2 4 ) N . ro s e u m ( n = 2 7 ) N . b re n tn ic k o li (n = 8 4 ) L in ea g e 1 (n = 26 ) L in ea g e 2 (n = 39 ) N . c h im a la p a s e n s is ( n = 1 5 ) N . m e x ic o e n s is ( n = 2 4 ) L in ea g e 3 (n = 19 ) L in ea g e 4 (n = 6) L in ea g e 5 (n = 6) L in ea g e 6 (n = 24 ) L in ea g e 7 (n = 11 ) N . m a m e s i (n = 2 6 ) N . p a n u c e n s is ( n = 2 1 ) N . g o lv a n i (n = 3 9 ) L in ea g e 8 (n = 33 ) L in ea g e 9 (n = 30 ) L in ea g e 10 ( n = 30 ) a) b) N . s c h m id ti ( n = 1 2 ) N . e m y d it o id e s ( n = 2 7 ) N . ro s e u m ( n = 2 7 ) N . b re n tn ic k o li (n = 4 1 ) L in ea g e 1 (n = 27 ) L in ea g e 2 (n = 61 ) N . c h im a la p a s e n s is ( n = 1 2 ) N . m e x ic o e n s is ( n = 3 5 ) L in ea g e 3 (n = 12 ) L in ea g e 4 (n = 14 ) L in ea g e 5 (n = 9) L in ea g e 6 (n = 12 ) L in ea g e 7 (n = 21 ) N . m a m e s i (n = 2 0 ) N . p a n u c e n s is ( n = 2 1 ) N . g o lv a n i (n = 2 3 ) L in ea g e 8 (n = 26 ) L in ea g e 9 (n = 21 ) L in ea g e 10 ( n = 39 ) Apical hooks length Middle hooks length Posterior hooks length L e n g th ( µ m ) PCA 1: 90.78% P C A 2 : 8 .4 7 % c) d) N. emyditoides N. schmidti N. panucensis N. chimalapasensis N. roseum N. emyditoides N. schmidti N. panucensis N. chimalapasensis N. roseum L e n g th ( µ m ) 0 0-8 -4-6 -2 -2.5 -1 2 1 2 PCA 1: 90.38% P C A 2 : 8 .8 0 % 0 0 -2.5 -1 1 2 -8 -4 -2-6 2 134 Figura 5. Análisis morfométricos de los ganchos de todas las especies y linajes de este estudio. a) MANOVA de los ganchos de la proboscis en machos, b) MANOVA de los ganchos en hembras, el eje de las X representa la longitud en micrómetros, el eje de las Y representa a cada especie o linaje y entre paréntesis el número de ganchos analizados. c) PCA para ganchos de machos, d) PCA para ganchos de hembras. DISCUSIÓN Adicionalmente a las nueve especies descritas morfológicamente en Centroamérica, otras 10 especies putativas fueron diagnosticadas basado en ambos arboles guía. Análisis basados en múltiples métodos para la delimitación de especies más análisis estadísticos morfológicos mostraron que especies del género Neoechinorhynchus en Centroamérica es un grupo hiper-diverso conformado por múltiples especies cripticas. En este estudio se encontraron al menos nueve especies cripticas y una especie diagnosticada morfológicamente distinta (linaje 8) asociados a especies de peces esturinos del género Dormitator y peces dulceacuícolas de la familia Cichlidae. LITERATURA CITADA Amin O. M. y R. Heckmann. 2009. Description of Neoechinorhynchus (N.) buckneri n. sp. from the blacktailed redhorse Moxostoma poecilurum (Catostomidae) in the Tchoutacabouffa River, Mississippi, with a key to species of Neoechinorhynchus with different dorsoventral body wall thickness. Comparative Parasitology, 76: 154–161. 135 Amin O. M. 2002. Revision of Neoechinorhynchus Stiles y Hassall, 1905 (Acanthocephala: Neoechinorhynchidae) with keys to 88 species in two subgenera. Systematic Parasitology, 53: 1–18. Amin O. M. 2013. Classification of the Acanthocephala. Folia Parasitologica, 60: 273–305. Barger M. A., E. V. Thatcher y B. B. Nickol. 2004. A new species of Neoechinorhynchus (Acanthocephala: Neoechinorhynchidae) from a red-eared slider (Trachemys scripta elegans) in Mexico. Comparative Parasitology, 71: 1–3. Bowles J., D. Blair y D. P. McManus. 1995. A molecular phylogeny of the human schistosomes. Molecular Phylogenetics and Evolution, 4: 103–109. Blasco-Costa I., A. Faltynková, S. Georgieva, K. Skírnisson, T. Scholz y A. Kostadinova. 2014. Fish pathogens near the Arctic Circle: molecular, morphological and ecological evidence for unexpected diversity of Diplostomum (Digenea: Diplostomidae) in Iceland. International Journal of Parasitology, 44: 703–715. Camargo A. y J. W. Sites. 2013. Species delimitation: a decade after the Renaissance. In: Pavlinov I. (edi.) The species problem-ongoing issues. InTech. doi:10.5772/52664. García-Varela M. y S. A. Nadler. 2005. Phylogenetic relationships of Palaeacanthocephala (Acanthocephala) inferred from SSU and LSU rDNA gene sequences. Journal of Parasitology, 91: 1401–1409. Herrmann K. K., R. Poulin, D. B. Keeney y I. Blasco-Costa. 2014. Genetic structure in a progenetic trematode: signs of cryptic species with contrasting reproductive strategies. International Journal of Parasitology, 44: 811–818. 136 Huelsenbeck J. P. y F. Ronquist. 2001. MrBayes: Bayesian inference of phylogeny. Bioinformatics, 17:754–5. Locke S. A., M. Caffara, D. J. Marcogliese y M. L. Fioravanti. 2015a. A large-scale molecular survey of Clinostomum (Digenea, Clinostomidae). Zoologica Scripta, 44: 203–217. Locke S. A., F. S. Al-Nasiri, M. Caffara, F. Drago, M. Kalbe, A. R. Lapierre, J. D. McLaughlin, P. Nie, R. M. Overstreet, G. T. R. Souza, R. M. Tokemoto y D. J. Marcogliese. 2015b. Diversity, specificity and speciation in larval Diplostomidae (Platyhelminthes: Digenea) in the eyes of freshwater fish, as revealed by DNA barcodes. International Journal of Parasitology, 45: 841–855. Maddison D. R., y W. P. Maddison. 2002. MacClade Version 4.0. Sinauer Associates, Sunderland, Massachusetts. Maddison W. P. y D. R. Maddison. 2011. Mesquite: a modular system for evolutionary analysis Version 2.75. Available: http://mesquiteproject.org. Martínez-Aquino A., F. S. Ceccarelli y G. Pérez-Ponce de León. 2013. Molecular phylogeny of the genus Margotrema (Digenea: Allocreadiidae), parasitic flatworms of goodeid freshwater fishes across central Mexico: species boundaries, host-specificity, and geographical congruence. Zoological Journal of the Linnean Society, 168: 1–16. Miller R. R., W. L. Minckley y S. M. Norris. 2005. Freshwater fishes of Mexico. The University of Chicago Press, Chicago, Illinois. p. 559. 137 Pinacho-Pinacho C. D., G. Pérez-Ponce De León y M. García-Varela. 2012. Description of a new species of Neoechinorhynchus (Acanthocephala: Neoechinorhynchidae) a parasite of Dormitator latifrons from Southwestern Mexico based on morphological and molecular characters. Parasitology International, 61: 634–644. Pons J., T. G. Barraclough, J. Gomez-Zurita, A. Cardoso, D. P. Duran, S. Hazell, S. Kamoun, W. D Sumlin y A. Vogler. 2006. Sequence-based species delimitation for the DNA taxonomy of undescribed insects. Systematic Biology, 55: 595–609. Posada D. 2008. jModelTest: phylogenetic model averaging. Molecular Biology and Evolution, 25: 1253–1256. Puillandre N., A. Lambert, S. Brouillet y G. Achaz. 2012. ABGD, Automatic Barcode Gap Discovery for primary species delimitation. Molecular Ecology, 21:1864–1877. Rambaut A. y A. J. Drummond. 2007. Tracer v1.4, Available: http://beast.bio.ed. ac.uk/Tracer. Salgado-Maldonado G. 2013. Redescription of Neoechinorhynchus (Neoechinorhynchus) golvani Salgado-Maldonado, 1978 (Acanthocephala: Neoechinorhynchidae) and description of a new species from freshwater cichlids (Teleostei: Cichlidae) in Mexico. Parasitology Research, 112:1891–1901. Smales L. R. 2013. A review of the genus Neoechinorhynchus (Acanthocephala: Neoechinorhynchidae) from Australia with the description of two new species. Journal of Parasitology, 99: 1106–1112. 138 Stamatakis A. 2006. Raxml-vi-hpc: maximum likelihood-based phylogenetic with thousands of taxa and mixed models. Bioinformatics, 22: 2688–2690. Thompson J., D. Higgins y T. Gibson. 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position- specific gap penalties and weight matrix choice. Nucleic Acids Research, 22: 4673–4680. 139                                                             6. 2. Apéndice 2 First Record of the Intermediate Host of Pseudocorynosoma constrictum Van Cleave, 1918 (Acanthocephala: Polymorphidae) in Central Mexico Martín García-Varela, Carlos Daniel Pinacho-Pinacho, Ana-L. Sereno- Uribe, Berenít Mendoza-Garfías Comparative Parasitology (2013) 80: 171–178 140 First Record of the Intermediate Host of Pseudocorynosoma constrictum Van Cleave, 1918 (Acanthocephala: Polymorphidae) in Central Mexico MARTÍN GARCÍA-VARELA,1 CARLOS-DANIEL PINACHO-PINACHO, ANA-LUCIA SERENO URIBE, AND BERENÍT MENDOZA-GARFÍAS Departamento de Zoologı́a, Instituto de Biologı́a, Universidad Nacional Autónoma de México, Avenida Universidad 3000, Ciudad Universitaria, C.P. 04510, Distrito Federal, Mexico (e-mail: garciav@unam.mx; danyboy_jd26@hotmail.com; moquitolino@yahoo.com.mx; berenit@ibunam2.ibiologia.unam.mx) ABSTRACT: Pseudocorynosoma constrictum Van Cleave, 1918 (Polymorphidae) is an endoparasite that infects a variety species of waterfowl from North America. Specimens of P. constrictum were recovered in central Mexico from 7 species of definitive host as well as from the freshwater amphipod Hyalella azteca, its intermediate host. In total, 69 amphipods were infected with 15 acanthella and 58 cystacanths. Morphologically, the adults and cystacanths of P. constrictum possess triangular spines covering most of the anterior part of the trunk, they have a slight constriction separating the anterior and posterior regions of the trunk, and they have an ovoid or cylindrical proboscis with a slightly swollen region covered with 16 longitudinal rows of 10 hooks each. Sequences of the mitochondrial coding gene cytochrome c oxidase were generated for 21 samples of P. constrictum (14 adults, 3 acanthella, and 4 cystacanths). The genetic divergence estimated among specimens was very low, ranging from 0 to 3%. All these sequences were aligned with 18 other taxa, representing 6 genera of Polymorphidae, forming a data set of 39 taxa with 655 nucleotides. The maximum parsimony and maximum likelihood trees indicated that the 21 sequences of P. constrictum formed a well-supported clade. The morphological evidence, in combination with the genetic divergence, plus the systematic position in the phylogenetic trees, indicated that all the samples of P. constrictum belong to the same lineage. The presence of P. constrictum in 7 species of waterfowl from central Mexico could be explained as a result of host-sharing, as the result of these hosts occurring in sympatry, and by the fact that they feed on the same species of amphipod known to harbor cystacanths. This study also confirms that a complete life cycle occurs in central Mexico wetlands. KEY WORDS: Acanthocephala, Pseudocorynosoma constrictum, adult, cystacanth, cox 1, genetic divergence, Mexico, phylogenetic analysis, maximum likelihood, maximum parsimony. Species of Pseudocorynosoma Aznar, Pérez Ponce de León and Raga (Acanthocephala), distributed throughout North and South America, are endopar- asites that use waterfowl and amphipods to complete their life cycle (Van Cleave, 1945; Podesta and Holmes, 1970; Aznar et al., 2006; Duclos et al., 2006). Morphologically, Pseudocorynosoma is dis- tinct from other genera of Polymorphidae Meyer, 1931 in possessing spines covering the anterior part of the trunk, an ovoid or cylindrical proboscis with a slightly swollen region, a truncated cone-shaped neck, spines surrounding the genital pore, and by the presence of from 4 to 6 tubular cement glands in the male. Furthermore, the eggs have a prominent polar protrusion in the middle fertilization membrane. Based on these morphological features, the genus currently includes 5 species: Pseudocorynosoma constrictum Van Cleave, 1918 (type species); Pseu- docorynosoma peposacae Porta, 1914; Pseudocor- ynosoma anatarium Van Cleave 1945; Pseudocor- ynosoma enrietti Molfi and Fernandes, 1953; and Pseudocorynosoma iheringi Machado Filho, 1961 (Aznar et al., 2006). The acanthocephalan P. constrictum is one of the most abundant species of polymorphids and is associated with several species of waterfowl in North America (Van Cleave, 1945; Farias and Canaris, 1986). Pseudocorynosoma constrictum has an indirect life cycle involving 2 hosts: the freshwater amphipod Hyalella azteca, the intermediate, and several species of waterfowl that serve as definitive hosts (Podesta and Holmes, 1970; Duclos et al., 2006). Adults of P. constrictum have been recorded in 2 species of waterfowl in central Mexico: Anas diazi and Anas clypeata (see Farias and Canaris, 1986; Garcı́a-Prieto et al., 2010). In the current study, cystacanths identified as P. constrictum are reported for the first time from its intermediate host in central Mexico. The cystacanth was linked to the adult by using a combination of morphological and molecular features. MATERIALS AND METHODS Adults and cystacanths identified as P. constrictum were collected from naturally infected vertebrate and invertebrate hosts in central Mexico (Table 1). Definitive hosts were1Corresponding author. Comp. Parasitol. 80(2), 2013, pp. 171–178 171 141                                                                             6. 3. Apéndice 3 Using mitochondrial and ribosomal DNA sequences to test the taxonomic validity of Clinostomum complanatum Rudolphi, 1814 in fish-eating birds and freshwater fishes  in Mexico, with the description of a new species Ana L. Sereno-Uribe, Carlos Daniel Pinacho-Pinacho, Martín García- Varela, Gerardo Pérez-Ponce de León Parasitology Research (2013) 112: 2855-2870 142   ORIGINAL PAPER Using mitochondrial and ribosomal DNA sequences to test the taxonomic validity ofClinostomum complanatumRudolphi, 1814 in fish-eating birds and freshwater fishes in Mexico, with the description of a new species Ana L. Sereno-Uribe & Carlos D. Pinacho-Pinacho & Martín García-Varela & Gerardo Pérez-Ponce de León Received: 3 April 2013 /Accepted: 8 May 2013 /Published online: 25 May 2013 # Springer-Verlag Berlin Heidelberg 2013 Abstract The taxonomic history and species composition of the genus Clinostomum has been unstable. Two species, Clinostomum complanatum Rudolphi, 1814 and Clinostomum marginatum Rudolphi, 1819, have been particularly problem- atic and its validity has been disputed for nearly 200 years. In this paper, we have made use of an integrative taxonomy approach, and we used, in first instance, DNA sequences of two genes (cox1 and ITS) to test the validity of C. complanatum, a species apparently widely distributed in Mexico and to link the metacercariae and adult forms of the recognized species ofClinostomum. Combining molecular data with morphology, host association, and geographical distribu- tion, we searched for the potential existence of undescribed species. A new species of Clinostomum is described based on adults found in the mouthy cavity of three species of fish-eating birds as well as in metacercariae found in freshwater and estuarine fishes. A few morphological characteristics dis- tinguish the new species from other congeners even though reciprocal monophyly in a phylogenetic tree based on maximum-likelihood and Bayesian analysis, genetic divergence, and a multivariate analysis of vari- ance and a principal component analysis of 18 morpho- metric traits for adults and metacercariae demonstrates the validity of the new species. Based on our results, it seems that C. complanatum is not currently distributed in Mexico, although this requires further verification with a more thoroughful sampling in other areas of the country, but it is plausible to support the hypothesis that C. marginatum is the American form, as previously suggested by other authors. Introduction Clinostomum Leidy, 1856 is one of the three genera current- ly allocated to the subfamily Clinostomatinae Luhe, 1901 infecting, as adults, fish-eating birds and usually found in the mouth cavity and esophagus of herons (Ardeidae) dis- tributed worldwide (Matthews and Cribb 1998; Kanev et al. 2002; Gustinelli et al. 2010; Bonett et al. 2011; Caffara et al. 2011). The taxonomic history of Clinostomum as well as its species composition has been unstable; several authors addressed this particular issue in the past arguing about the high degree of morphological variability within species (see Ukoli 1966; Yamaguti 1971; Feizullaev and Mirzoeva 1983; Matthews and Cribb 1998). The confusing taxonomic history of the genus was recently reviewed by Gustinelli et al. (2010), which recognized between 13 and 27 valid species. For instance, Caffara et al. (2011) discussed that the taxonomic validity of two common species, i.e., Clinostomum complanatum Rudolphi, 1814 and Clinostomum marginatum Rudolphi, 1819, has been disputed for nearly 200 years. The metacercariae of cosmopolitan species of Clinostomum (commonly known as “yellow grub”) produce severe damages in their freshwater fish intermediate hosts (e.g., Shareef and Abidi 2013), and in addition to that, this digenean may infect human beings, and because of that, it has received a great attention and many published accounts do exist in the world literature. A. L. Sereno-Uribe : C. D. Pinacho-Pinacho :M. García-Varela : G. P.?@@;' ABB@C' D(0-%/(' "3' 0.E;' >???C' !030#(%(&' 0,-' F750"))"%;' AB>BGE' H5/&' 4%(+9' &5(I&' .(I' ."J".&' ()' %/75,"&&' I/35' K' L,(I,' &9"7/"&' 7.0&&/)/"-' /,' 0' &/,4."' 4",+&' =!"#$%&'%(%)' 1+$$&G'0,-'0..'35"/%'#"#$"%&'%"9%"&",3'0,'",-"#/7'./,"04";' 3503'9%($0$.M'/,50$/3"-'35/&'%"4/(,'&/,7"'35"'*./(7","'0,-' 9"%509&' "J",' 35"'!/(7","' =!/.."%;' >?@@C'D(0-%/(' "3' 0.E;' >???C'<(,NO."NPD/0N'"3'0.E;'ABB@C'Q".&(,;'ABBRC'S%(&"'0,-' *0+.M;'AB>BC'!030#(%(&'0,-'F750"))"%;'AB>BGE *)(+",--./"&.-)0)1/$)#2.%3.+,10)"#+.(%00'")#),-.%3.#+,.3$,-+4/#,$.3)-+. !"#$%&'%(%)*+%&,-.-%)*56)-(,-7.829$)"%&%"#)&/,:.3$%0.;/,<)(% *)?',@/.2.-)0)1)#'&.&,.(%0'")&/&,-.&,.+,10)"#%-.&,1.9,@.&'1(,/('A(%1/.!"#$%&'%(%)* +%&,-.-%)*56)-(,-7.829$)"%&%"#)&/,:.,".;/B<)(% T0%.(&'D0,/".'*/,075(P*/,075(> ;'!0E'-"'.(&'U,4"."&'*V%"NPW+/N>;'6,0'XE'F"%",(PY%/$"A;'!0%3Z,'<0%7Z0P [0%".0A'0,-'\#/./('!0%3Z,"NPW0#Z%"N] *!#)+",'#-.&-/0.&10,)-20#(3+01,)4-5&)606%6#-'.-20#(#+7,4-8&09.")0','-:,10#&,(-;%63&#<,-'.-=>?01#@-;A,"6,'#-A#)6,(-BCD*EF4-CGE*C-=>?01#-H@I@4- =.?01#@ J5&)606%6#-'.-20#(#+7,4-8&09.")0','-:,10#&,(-;%63&#<,-'.-=>?01#@-;A,"6,'#-A#)6,(-BCD*EF4-CGE*C-=>?01#-H@I@4-=.?01#@ FH.A,"6,<.&6#-'.-5&9.)60+,103&4-K".,-'.-;1%,1%(6%",4-/.&6"#-5&6."'0)10A(0&,"0#-'.-5&9.)60+,103&-A,",-.(-H.),""#((#-5&6.+",(-L.+0#&,(4-8&0','- M,?,1,4-5&)606%6#-!#(06>1&01#-:,10#&,(@-N#"&#)-:O<@-*CCF4-/#(@-:#1P.-2%.&,4-Q,&6,-/"%R-S#?#1#6(T&4-B*JFC-M,?,1,4-=.?01#@ '',&UV#UWX'JYZP#6<,0(@1#< CD-#$/(#E'H5"'5".#/,35'90%0&/3"')0+,0'()'!"#$%&'%(%)-A%&16,6%)-/,'K'.(70./3/"&')%(#'80:070'F303";'!":/7(;'I0&'&3+-/"-E' 6'3(30.'()'>]A')/&5'I"%"'0,0.MN"-E'S(+%3"",'5".#/,35' 30:0'I"%"'%"7(%-"-;' /,7.+-/,4'?'-/4","0,&'=!,",1".A6#6".<,- V(,&1#0;' !,",1".A6#6".<,- A"#$%&'%(%)04- !PU((#'0)6#<%<' &9E;' /%(%[0U,' 7)E' 101P(0'#"%<;' /(0&#)6#<%<- &9E;' D/9.(&3(#/-0"'4",E'&9E;'!#)6P#'0A(#)6#<%<-<0&0<%<;';)1#1#6U(.'=;)1#1#6U(.G'$.(0AA.0-0,-'/.&6"#1.)6%)-$#"<#),&%)G;' A'#(,(4","0,&'=\U"#',16U(%)'&9E'0,-'Q,()%+0&%)-&9EG;'0,-']',"#03(-"&'=QA0&06.16%)-P%^' &9"7/"&G' 0,-' -/J"%&/3M' =F50,,(,_`/","%'0,-'2%/..(+/,'/,-/7"&'%0,4"-'$"3I"",'BE]@?'3('AEBa]'0,-'BE]@a'3('AEB^A'$/3&b/,-EG'/,'35"'K'.(70./3/"&;' 0,-' &(#"'I"%"' -(#/,03"-' $M' ]' 5".#/,35' &9"7/"&' =;)1#1#6U(.- =;)1#1#6U(.G' $.(0AA.0;'/.&6"#1.)6%)- $#"<#),&%);- 0,-' LP,V'#1P#&,-),(+,'#0GE-`/35' 35"'7+%%",3'-030;'I"'7(,7.+-"-' 3503'!@-A%&16,6%)' /&'90%0&/3/N"-'$M'0'90%3/7+.0%'4%(+9' ()' 5".#/,35' &9"7/"&' ="E' 4E;' !,",1".A6#6".<,- V(,&1#0;' !,",1".A6#6".<,- A"#$%&'%(%)0;' QA0&06.16%)- P%]A'9"7"&E'\.'%"4/&3%('5".#/,3(.e4/7('-"'"&3"'9"N'7(,&30'-"'>^'30:0'-"'5".#/,3(&;'.(&'7+0."&' /,7.+M",'?'30:0'-"'-/4V,"(&'=!,",1".A6#6".<,-V(,&1#0;'!,",1".A6#6".<,-A"#$%&'%(%)0;'!PU((#'0)6#<%<'&9E;'/%(%[0U,' 7)E' 101P(0'#"%<;'/(0&#)6#<%<- &9E;' D/9.(&3(#/-0"' 4",E' &9E;'!#)6P#'0A(#)6#<%<-<0&0<%<;';)1#1#6U(.' =;)1#1#6U(.G' $.(0AA.0-M'/.&6"#1.)6%)-$#"<#),&%)G;'A'30:0'-"'#(,(4V,"(&'=\U"#',16U(%)'&9E'M'Q,()%+0&%)-&9EG'M']'30:0'-"',"#O3(-(&' =QA0&06.16%)-P%^'"&9"7/"&G'M'-/J"%&/-0-'=Z,-/7"&'-"'F50,,(,_`/","%'M'2%/..(+/,'#(&3%0%(,'J0.(%"&'",3%"'BE]@?'0' AEBa]'M'BE]@a'0'AEB^A'$/3&b/,-EG'",'.0&'K'.(70./-0-"&'M'0.4+,0&'-"'"&30&')+"%(,'-(#/,0-0&'9(%']'"&9"7/"&'-"'5".#/,3(&' ="&3('"&;';)1#1#6U(.'=;)1#1#6U(.G'$.(0AA.0;'/.&6"#1.)6%)-$#"<#),&%)-M'LP,V'#1P#&,-),(+,'#0^E-Q+"&3%(&'-03(&'&+4/"%",' g+"'!"#$%&'%(%)- A%&16,6%)- "&' 90%0&/30-(' 9(%-+,' 4%+9(' 90%3/7+.0%' -"' 5".#/,3(&' ="&3(' "&;'!,",1".A6#6".<,- V(,&1#0;' !,",1".A6#6".<,-A"#$%&'%(%)0;'QA0&06.16%)-P%1+,3.=3&'=0#?6*0.*#.=#-'$*,0-'&<*+,*,1#("@0)#1* ,'("#(*'.*A'==&#BC-#1'$0 Carlos Daniel Pinacho-Pinacho!"#, Martín García-Varela!, Jesús S. Hernández-Orts!, Carlos A. Mendoza-Palmero!, Ana L. Sereno-Uribe!, Emilio Martínez-Ramírez$, Leopoldo Andrade-Gómez!, Alejandra López-Jiménez!, Eduardo Hernández-Cruz!, Gerardo Pérez-Ponce de León! 7 Departamento de Zoología, Instituto de Biología, Universidad Nacional Autónoma de México, Apartado Postal 70-153, C. P. 14510, México, D. F., México 9 Posgrado en Ciencias Biológicas, Instituto de Biología, Universidad Nacional Autónoma de México, Apartado Postal 70-153, C.P. 04510, México, D.F., México D Departamento de Investigación, Área de Acuacultura, Centro Interdisciplinario de Investigación para el Desarrollo Integral Regional, Unidad Oaxaca, Instituto Politécnico Nacional. Hornos Núm. 1003, Col. Noche Buena, Santa Cruz Xoxocotlán, 71230 Oaxaca, México %&''()*&+,-+./0123&'4 Carlos Daniel Pinacho-Pinacho (danyboy_jd26@hotmail.com) 560,(7-6/(,-2&'4 D. Gibson  |  Received 18 June 2015  |  Accepted 27 August 2015  |  Published 28 September 2015 http://zoobank.org/35E4923C-71F1-4F7F-9DA2-CAFAC7E0F6D5 !')0)'+.E Pinacho-Pinacho CD, García-Varela M, Hernández-Orts JS, Mendoza-Palmero CA, Sereno-Uribe AL, Martínez-Ramírez E, Andrade-Gómez L, López-Jiménez A, Hernández-Cruz E, de León GP-P (2015) Checklist of the helminth parasites of the genus Profundulus Hubbs, 1924 (Cyprinodontiformes, Profundulidae), an endemic family of freshwater fishes in Middle-America. ZooKeys 523: 1–30. doi: 10.3897/zookeys.523.6088 C5()10$) From December 2012 to November 2014, 267 fish belonging to the family Profundulidae (represent- ing nine of the 11 species of the genus Profundulus) were collected in 26 localities of Middle-America, across southern Mexico, Guatemala, and Honduras, comprising the distribution range of the genus, and analyzed for helminth parasites. Additionally, a database with all ten available published accounts of the helminth parasite fauna of this genus (the only genus within the family) was assembled. Based on both sources of information, a checklist containing all the records was compiled as a tool to address future questions in the areas of evolutionary biology, biogeography, ecology and phylogeography of this host-parasite association. #e helminth parasite fauna of this fish group consists of 20 nominal species, classified in 17 genera and 14 families. It includes six species of adult digeneans, five metacercariae, two monogeneans, one adult cestode, three adult nematodes and three larval nematodes. #e profundulid 8&&9(:)/;#$4/!<$=/>#=!;? ,&-4/!=@$ABCDE&&F(:)@;#$@G=AA 322*4DDE&&F(:)@*(+)&H2@+(2 %&*:'-.32/!"#$%&'(")*+$',*)"-.%/,*)"-.%'+0'"$1'I3-)/-)/0+/&*(+/066())/0'2-6J(/,-)2'-K12(,/1+,('/23(/2('7)/&H/23(/%'(02-L(/%&77&+)/522'-K12-&+/M-6(+)(/ >%%/NO/P@=?"/Q3-63/*('7-2)/1+'()2'-62(,/1)("/,-)2'-K12-&+"/0+,/'(*'&,162-&+/-+/0+:/7(,-17"/*'&L-,(,/23(/&'-.-+0J/0123&'/0+,/)&1'6(/0'(/6'(,-2(,@ !4F!GHIJK !"#$%&'()*+)"%%','-"*')./+(/0'-1/*2)-'1'"-%& !" #$$%&%$'($)$*" +#$,&-..$//" 0+1%,-2 157                                                                               6. 11. Apéndice 11 An integrative taxonomic study reveals a new species of Tylodelphys Diesing, 1950 (Digenea: Diplostomidae) in central and northern Mexico Martín García-Varela, Ana. L. Sereno-Uribe, Carlos Daniel Pinacho- Pinacho, Eduardo Hernández-Cruz y Gerardo Pérez-Ponce de León Journal of Helminthology 158   An integrative taxonomic study reveals a new species of Tylodelphys Diesing, 1950 (Digenea: Diplostomidae) in central and northern Mexico M. Garcı́a-Varela*, A.L. Sereno-Uribe, C.D. Pinacho-Pinacho, E. Hernández-Cruz and G. Pérez-Ponce de León Departamento de Zoologı́a, Instituto de Biologı́a, Universidad Nacional Autónoma de México, Avenida Universidad 3000, Ciudad Universitaria, C.P. 04510, Distrito Federal, México (Received 5 July 2015; Accepted 10 September 2015) Abstract Tylodelphys aztecae n. sp. (Digenea: Diplostomidae) is described from adult specimens obtained from the intestine of the pied-billed grebe (Podilymbus podiceps) and the metacercariae found in the body cavity of freshwater fishes of the families Goodeidae and Cyprinidae in eight localities across central and northern Mexico. The new species is mainly distinguished from the other four described species of Tylodelphys from the Americas (T. adulta, T. americana, T. elongata and T. brevis) by having a forebody slightly concave, a larger ventral sucker, two larger pseudosuckers and by having between 2 and 7 eggs in the uterus. Partial DNA sequences of the mitochondrial gene cytochrome c oxidase subunit I (cox1), and the internal transcribed spacers (ITS1 þ 5.8S þ ITS2) of the ribosomal DNA, were generated for both developmental stages and compared with available sequences in GenBank of other congeners. The genetic divergence estimated among Tylodelphys aztecae n. sp. and other congeneric species varied from 12 to 15% for cox1, and from 3 to 11% for ITS. In contrast, the genetic divergence among metacercariae and adults of the new species was very low, ranging between 0 and 1% for cox1 and between 0 and 0.3% for ITS. Phylogenetic analyses inferred with both molecular markers using maximum likelihood and Bayesian inference placed the adults and their metacercariae in a single clade, confirming that both stages are conspecific. The morphological evidence and the genetic divergence, in combination with the reciprocal monophyly in both phylogenetic trees, support the hypothesis that the diplostomids found in the intestines of the pied-billed grebe bird and the body cavity from goodeid and cyprinid fishes in central and northern Mexico represent a new species. Introduction Modern taxonomic practices in helminths combine morphological data and DNA sequences, allowing the establishment of a link between larval and adult stages in different host species in an ecosystem. Recent studies on diplostomid trematodes illustrate the usefulness of such approaches, with the internal transcribed spacers (ITS) of ribosomal DNA and the mitochondrial gene cyto- chrome c oxidase subunit I (cox1) as the most popular molecular markers used for the identification and delimitation of species in these trematodes (Chibwana et al., 2013, 2015; Georgieva et al., 2013; Blasco-Costa et al., 2014;Garcı́a-Varela et al., 2015; Selbach et al., 2015). Further, the development of diplostomid-specific primers flanking the barcode region (cox1), allowed the construction of a large barcode library of diplostomids that includes *Fax: (525) 5550 0164 E-mails: garciav@unam.mx; garciav@ib.unam.mx Journal of Helminthology, page 1 of 12 doi:10.1017/S0022149X15000917 q Cambridge University Press 2015 159                                                                             6. 12. Apéndice 12 Maritrema corai n. sp. (Digenea: Microphallidae) from the white ibis Eudocimus albus (Linnaeus) (Aves:  Threskiornithidae) in Mexico Jesús S. Hernández-Orts, Carlos Daniel Pinacho-Pinacho, Martín García-Varela y Aneta Kostadinova Parasitology Research (2015) 160   ORIGINAL PAPER Maritrema corai n. sp. (Digenea: Microphallidae) from the white ibis Eudocimus albus (Linnaeus) (Aves: Threskiornithidae) in Mexico Jesús S. Hernández-Orts1 & Carlos D. Pinacho-Pinacho1 & Martín García-Varela1 & Aneta Kostadinova2 Received: 25 July 2015 /Accepted: 1 October 2015 # Springer-Verlag Berlin Heidelberg 2015 Abstract Maritrema corai n. sp. is described based on mate- rial from the intestine of the white ibis Eudocimus albus (L.) (Threskiornithidae) in Mexico. The new species can be distin- guished morphologically from all congeners by the unique combination of the following morphological features: a very long cirrus sac attenuated distally [cirrus sac to body length ratio 1:0.90–1.29 (mean 1:1.07)]; a large, elongate-oval sem- inal receptacle, located dorsally between the cirrus sac and ovary; and long, filiform, unarmed, evaginable cirrus. Phylogenetic analyses of 28S ribosomal DNA (rDNA) se- quences for the new species and for Maritrema spp. and Microphallus spp. depicted strong support for the two genera (excluding Microphallus fusiformis) and revealed close rela- tionships between Ma. corai n. sp. and the clade formed by Maritrema novaezealandense Martorelli, Fredensborg, Mouritsen & Poulin, 2004, Maritrema heardi (Kinsella & Deblock, 1994) and Maritrema cf. eroliae. Keywords Maritrema . Eudocimus albus . Microphallidae . 28S rDNA . Phylogeny . North America Introduction Species of the microphallid genusMaritremaNicoll, 1907 are cosmopolitan parasites of birds and occasionally mammals (Deblock 2008). Their life cycles involve gastropods as first intermediate hosts and crustaceans as second intermediate hosts and take place in brackish, marine or freshwater habitats (Deblock 1971). Maritrema is divided into two subgenera, Maritrema (Maritrema) Nicoll, 1907 for species characterised by a simple, slightly differentiated, unarmed genital pore and Maritrema (Atriospinosum) Deblock, 1973 for species with a modified genital pore, provided with spinous atrio-acetabular plate and subtegumentary muscular rings (Deblock 2008). Despite the large diversity of species of Maritrema (about 65 species), a single species has so far been reported from Mexico, i.e. Maritrema patulus Coil, 1955 from the solitary sandpiper Tringa solitaria (Wilson) in the region of Salina Cruz, Oaxaca, Pacific coast of Mexico (Coil 1955). In a study of parasites of the white ibis Eudocimus albus (L.) (Threskiornithidae) along the Atlantic and the Pacific coasts of Mexico, we collected numerous microphallid digeneans. Detailed morphological and molecular analyses revealed that this material represents a species new to science and the second species of Maritrema to be described from Mexico. This paper provides morphological and genetic char- acterisation of Maritrema (Maritrema) corai n. sp. Materials and methods Sample collection Seventy-one adult white ibises were collected between 2006 and 2015 from 15 localities along the Atlantic and Pacific coasts of Mexico (seemap in Fig. 1). The digestive tract of fresh birds was * Jesús S. Hernández-Orts jesus.s.hernandez@uv.es 1 Departamento de Zoología, Instituto de Biología, Universidad Nacional Autónoma de México (UNAM), Avenida Universidad 3000, Ciudad Universitaria, CP 04510 Distrito Federal, México 2 Institute of Parasitology, Biology Centre, Czech Academy of Sciences, Branišovská 31, 370 05 České Budějovice, Czech Republic Parasitol Res DOI 10.1007/s00436-015-4771-x 161                                                                             6. 13. Apéndice 13 Phylogenetic analysis using the 28S rRNA gene reveals that the genus Paracreptotrema Choudhury, Pérez-Ponce de León, Brooks and Daverdin, 2006 (Digenea: Allocreadiidae) is not monophyletic; description of two new genera and one new species Gerardo Pérez-Ponce de León, Carlos Daniel Pinacho-Pinacho, Berenit Mendoza-Garfias, Anindo Choudhury y Martín García-Varela Journal of Parasitology (2016) 162   PHYLOGENETIC ANALYSIS USING THE 28S rRNA GENE REVEALS THAT THE GENUS PARACREPTOTREMA (DIGENEA: ALLOCREADIIDAE) IS NOT MONOPHYLETIC; DESCRIPTION OF TWO NEW GENERA AND ONE NEW SPECIES Gerardo Pérez-Ponce de León, Carlos D. Pinacho-Pinacho, Berenit Mendoza-Garfias, Anindo Choudhury*, and Martı́n Garcı́a-Varela Instituto de Bioloǵıa, Universidad Nacional Autónoma de México. Ap. Postal 70-153. C.P. 04510, México D.F., México. Correspondence should be sent to: ppdleon@ib.unam.mx ABSTRACT: This study investigates the systematics of Paracreptotrema Choudhury, Pérez-Ponce de León, Brooks and Daverdin, 2006 using morphological data (stained whole mounts and scanning electron microscopy) and partial sequences of the 28S ribosomal rRNA gene, obtained from freshly collected material. In total, 484 specimens representing 4 species, i.e., Paracreptotrema blancoi (157), Paracreptotrema profundulusi (12), Paracreptotrema rosenthali (8), and Paracreptotrema blancoi sensu Salgado-Maldonado et al. (2011) (307) were collected. Existing museum depositions were also studied. The 28S rRNA gene sequences of these Paracreptotrema spp. were aligned, along with sequences from 22 other allocreadiids and 4 other non-allocreadiid xiphidiatan species. Bayesian inference and maximum likelihood analyses indicated a paraphyletic Paracreptotrema split into 3 clades: 1 comprising P. blancoi and P. rosenthali that was sister to a clade formed by 3 other species of allocreadiids (species of Wallinia, Creptotrematina, and Auriculostoma) typically found in characid fishes, a second clade formed solely by Paracreptotrema heterandriae as the sister taxon of the aforementioned species, and a third by P. profundulusi and specimens erroneously identified as P. blancoi. Two new taxa were erected to reflect these results: Paracreptotrematoides for Paracreptotrema heterandriae, and Pseudoparacreptotrema for Paracreptotrema profundulusi and P. macroacetabulata (the species erroneously identified as P. blancoi from profundulids across Middle America). Closer consideration of the morphology corroborates these findings. The revised systematics also indicated that Paracreptotrema spp. are found in poeciliids, whereas Pseudoparacreptotrema spp. parasitize profundulids. The study demonstrates the value of an integrative taxonomy approach to address the apparently complicated systematics of the allocreadiids. The allocreadiid genus Paracreptotrema was established by Choudhury et al. (2006) for Paracreptotrema blancoi Choudhury, Pérez-Ponce de León, Brooks and Daverdin, 2006, an intestinal parasite of the poeciliid Priapichthys annectens (Regan, 1907) from the Rı́o Orosı́, Guanacaste Province, Costa Rica. In the same study, Fellodistomum mendezi Sogandares-Bernal, 1955, a parasite of the poeciliid Brachyrhaphis episcopi (Steindachner, 1878) from Gatun Lake in Panama, was transferred to Para- creptotrema. Subsequently, 3 other congeners were described, all from Mexico: Paracreptotrema profundulusi Salgado-Maldonado, Caspeta-Mandujano and Martı́nez-Ramı́rez, 2011, in killifishes Profundulus punctatus (Günther, 1866) and Profundulus balsanus Ahl 1935 from the Tehuantepec and Atoyac-Verde River basins respectively; Paracreptotrema heterandriae Salgado-Maldonado, Caspeta-Mandujano and Vázquez, 2012, in the poeciliid Pseu- doxiphophorus bimaculatus (Heckel, 1848) from the Antigua River basin, in Veracruz; and Paracreptotrema. rosenthali Bautista- Hernández, Monks, Pulido-Flores, and Miranda, 2015 in 2 poeciliids, Xiphophorus malinche Rauchenberger, Kallman and Morizot, 1990, and Pseudoxiphophorus jonesii (Günther, 1874), from the Malila River, of the Panuco River basin (Salgado- Maldonado et al., 2011, 2012; Bautista-Hernández et al., 2015). In addition, Salgado-Maldonado et al. (2011) reported Paracrepto- trema blancoi in 3 species of Profundulus Hubbs, 1924 from the Tehuantepec, Atoyac-Verde and Papagayo River basins, and in some localities sympatrically with Paracreptotrema profundulusi. Pinacho-Pinacho et al. (2014) also reported P. blancoi from 7 localities in separate river basins of the Oaxacan lowlands. Salgado-Maldonado et al. (2014) expanded the host and distribution records of P. blancoi in 4 species of Profundulus from localities in Oaxaca and Chiapas, Mexico, and in Guatemala and El Salvador. In a recent comprehensive checklist of helminth parasites of profundulids (Pinacho-Pinacho et al., 2015) Para- creptotrema blancoi is listed as occurring in 8 species of Profundulus and in 38 localities across Middle America. Thus, the genus currently comprises 5 species that parasitize cyprino- dontiform fishes in Middle America; the distribution range extends from Gatun Lake in Panama in the south, northward to the Papagayo River basin in Guerrero, and from the southwestern Pacific slope of Mexico in the west to La Antigua and Panuco River basins in Veracruz, on the Atlantic slope of Mexico. All 5 species of Paracreptotrema were described from stained whole mounts and without the benefit of molecular data or surface ultrastructure information (scanning electron microscope [SEM] studies). The reportedly wide distribution of P. blancoi prompted us to examine specimens reported by Salgado- Maldonado et al. (2011), deposited in the Colección Nacional de Helmintos (CNHE), Mexico City; our observations suggested that these specimens may not be of P. blancoi, and raised questions about some of the morphological characters used to distinguish species of Paracreptotrema. Over the past several months, we sampled freshwater cypri- nodontiforms (species of Profundulidae and Poeciliidae) in several areas of Middle America, including localities in Guate- mala, Honduras, Costa Rica, and southern Mexico (in rivers across the states of Hidalgo, Oaxaca, and Chiapas), where species of Paracreptotrema have been reported. As a matter of convenience, in this paper we use Middle America for the region between the southern boundary of the Nearctic biogeographic region in Mexico and the southern border of Panama in Central America, thereby avoiding current controversy over the term Mesoamerica (Winker, 2011; Sánchez-González et al., 2013). Our sampling included the type hosts and localities of P. profundulusi, and P. rosenthali, both in Mexico, and P. blancoi in Costa Rica, which allowed us to reassess relationships among members of the Received 2 July 2015; revised 26 October 2015; accepted 5 November 2015. * Division of Natural Sciences, St. Norbert College, 100 Grant Street, DePere, Wisconsin 54115. DOI: 10.1645/15-815 131 J. Parasitol., 102(1), 2016, pp. 131–142 ! American Society of Parasitologists 2016 163