UNIVERSIDAD NACIONAL AUTÓNOMA DE MÉXICO Maestría y Doctorado en Ciencias Bioquímicas Estudio de la cadena respiratoria de Wolbachia pipientis TESIS QUE PARA OPTAR POR EL GRADO DE: Doctor en Ciencias PRESENTA: M. en C. Cristina Uribe Alvarez TUTOR PRINCIPAL: Dr. Antonio Peña Díaz Instituto de Fisiología Celular MIEMBROS DEL COMITÉ TUTOR Dr. Diego González Halphen Instituto de Fisiología Celular Dr. Juan Pablo Pardo Vázquez Facultad de Medicina Ciudad de México. Agosto, 2018. UNAM – Dirección General de Bibliotecas Tesis Digitales Restricciones de uso DERECHOS RESERVADOS © PROHIBIDA SU REPRODUCCIÓN TOTAL O PARCIAL Todo el material contenido en esta tesis esta protegido por la Ley Federal del Derecho de Autor (LFDA) de los Estados Unidos Mexicanos (México). El uso de imágenes, fragmentos de videos, y demás material que sea objeto de protección de los derechos de autor, será exclusivamente para fines educativos e informativos y deberá citar la fuente donde la obtuvo mencionando el autor o autores. Cualquier uso distinto como el lucro, reproducción, edición o modificación, será perseguido y sancionado por el respectivo titular de los Derechos de Autor. aa Isa qui Maestría y Doctorado PMDCB/1030/2018 Uribe Alvarez Cristina Estudiante de Doctorado en Ciencias Bioquímicas Presente Los miembros del Subcomité Académico en reunión ordinaria del día 21 de mayo del presente año, conocieron su solicitud de asignación de JURADO DE EXAMEN para optar por el grado de Doctorado EN CIENCIAS, con la réplica de la tesis “Estudio de la cadena respiratoria de Wolbachia pipientis”, dirigida por el/la Dr(a). Peña Díaz Antonio. De su análisis se acordó nombrar el siguiente jurado integrado por los doctores: PRESIDENTE Chávez Cossío Edmundo VOCAL Flores Herrera Oscar VOCAL Pérez Martínez Xochitl VOCAL García Trejo José de Jesús SECRETARIO Camarena Mejía Rosa Laura Sin otro particular por el momento, aprovecho la ocasión para enviarle un cordial saludo. Atentamente “POR MI RAZA, HABLARÁ EL ESPÍRITU” Cd. Universitaria, Cd. Mx., a 21 de mayo de 2018. COORDINADORA | A E Dra. ANA BRÍGIDA CLORINDA ARIAS ÁLVAREZ contacto: mdcbqeposgrado.unam.mx Tel. 5623 7006 I RECONOCIMIENTOS Esta tesis se realizó bajo la asesoría del Dr. Antonio Peña Díaz en el laboratorio 306-Oriente, Departamento de Genética Molecular, Instituto de Fisiología Celular, UNAM. El jurado del examen estuvo conformado por: Dr. Edmundo Chávez Cosío, Departamento de Farmacología, Instituto Nacional de Cardiología Ignacio Chávez. Dr. Oscar Flores Herrera, Departamento de Bioquímica, Facultad de Medicina, UNAM. Dra. Xóchitl Pérez Martínez, Departamento de Genética Molecular, Instituto de Fisiología Celular, UNAM. Dr. José de Jesús García Trejo, Departamento de Biología, Facultad de Química, UNAM. Dra. Rosa Laura Camarena Mejía, Departamento de Biología Molecular y Biotecnología, Instituto de Investigaciones Biomédicas, UNAM. El Comité Tutoral que asesoró el desarrollo de este trabajo estuvo formado por: Dr. Antonio Peña Díaz, Departamento de Genética Molecular, Instituto de Fisiología Celular, UNAM. Dr. Diego González Halphen, Departamento de Genética Molecular, Instituto de Fisiología Celular, UNAM. Dr. Juan Pablo Pardo Vázquez, Departamento de Bioquímica, Facultad de Medicina, UNAM. VI El Jurado del examen de candidatura estuvo integrado por: Dra. Rosa Laura Camarena Mejía, Departamento de Biología Molecular y Biotecnología, Instituto de Investigaciones Biomédicas, UNAM. Dr. Juan Pablo Pardo Vázquez, Departamento de Bioquímica, Facultad de Medicina, UNAM. Dr. Diego González Halphen, Departamento de Genética Molecular, Instituto de Fisiología Celular, UNAM. Dra. Marietta Tuena Sangri, Departamento Bioquímica y Biología Estructural, Instituto de Fisiología Celular, UNAM. Dra. Emma Cecilia Saavedra Lira, Departamento de Bioquímica, Instituto Nacional de Cardiología, Ignacio Chávez. Dra. Bertha María Josefina González Pedrajo, Departamento de Genética Molecular, Instituto de Fisiología Celular, UNAM. El jurado del examen de ingreso estuvo integrado por: Dra. Bertha María Josefina González Pedrajo, Departamento de Genética Molecular, Instituto de Fisiología Celular, UNAM. Dra. Xóchitl Pérez Martínez, Departamento de Genética Molecular, Instituto de Fisiología Celular, UNAM. Dra. Sobeida Sánchez Nieto, Departamento de Bioquímica, Facultad de Química, UNAM. Dr. Rogelio Rodríguez Sotres, Departamento de Bioquímica, Facultad de Química, UNAM. Dr. José de Jesús García Trejo, Departamento de Biología, Facultad de Química, UNAM. VII Se reconoce la colaboración, asesoría y asistencia del Dr. Salvador Uribe Carvajal y de la Dra. Natalia Chiquete Félix del Departamento de Genética Molecular, Instituto de Fisiología Celular, UNAM; de la Dra. Martha Calahorra Fuertes y de la M. en C. Norma Silvia Sánchez del Departamento de Genética Molecular, Instituto de Fisiología Celular, UNAM; de la Dra. Martha Lucinda Contreras Zentella del Departamento de Biología Celular y del Desarrollo, Instituto de Fisiología Celular, UNAM; del Dr. Luis Vaca y la Dra. Arlette Bohórquez Hernández del Departamento de Biología Celular y del Desarrollo, Instituto de Fisiología Celular, UNAM. Se reconoce el apoyo de la Dra. Laura Ongay Larios de la Unidad de Biología Molecular del IFC; del Dr. Fernando García Hernández y el Sr. Rodolfo Paredes Díaz de la Unidad de Microscopía del IFC; de Ramón Méndez Franco, Auxiliar del laboratorio 305-Ote. Departamento de Genética Molecular, Instituto de Fisiología Celular; de Leticia García Gutiérrez, Asistente de procesos, Programa en Ciencias Bioquímicas, UNAM; de Adelina González Pérez, Asistente de procesos, Programa en Ciencias Bioquímicas, UNAM; de Gabriela Valdés, Secretaria ejecutiva, Coordinación del Departamento de Genética Molecular, Instituto de Fisiología Celular, UNAM. Se agradece al Dr. Juan Carlos González Hernández del Instituto Tecnológico de Morelia por la donación de los oligonucleótidos ITS1 y ITS4. Se agradece a Bei Resources por la donación del anticuerpo anti-wsp. La sustentante gozó del apoyo CONACyT No. 344726 para realizar los estudios de doctorado (CVU No.288969 ). El proyecto fue financiado por los proyectos para SU: CONACyT 239487 y DGAPA-PAPIIT IN204015; y para AP CONACyT238497 y DGAPA-PAPIIT IN2114. Se agradece al Posgrado en Ciencias Bioquímicas y al Programa de Apoyo a los Estudios de Posgrado (PAEP) por los apoyos recibidos para la asistencia a Congresos Nacionales e Internacionales. VIII Dedicatorias A mi mamá, por ser mi amiga, mi consejera y por cuidarme. Gracias por estar siempre a mi lado. A mi papá, gracias por compartir tanto conmigo, por enseñarme a ser una mejor persona y por enseñarme a hacer ciencia durante los últimos cinco años. Gracias por exigirme, por apoyarme y por festejarme. Todo lo que soy se los debo a ustedes dos, los amo. A Rodrigo, Shaista y María Luisa, aunque hay muchos kilómetros de distancia, siempre están en mi corazón y mis pensamientos. Gracias por estar en mi vida, por hacerla más feliz y divertida. A Robin, gracias por haber llegado, por haber regresado, por haberte quedado y porque estoy segura que seguirás a mi lado. Amo ser tu familia y compartir todos los días contigo. Sin duda llegaste a mejorar mi persona y mi vida. Al recuerdo de los mejores abuelos del mundo. A mi familia académica: Al Dr. Peña, por tantas enseñanzas, que van desde bioquímica hasta como hacer tus propias balas y hacer tu propio hidromiel. Por compartir las mejores anécdotas conmigo y por siempre apoyarme en el laboratorio. Al Lab. 306 Ote, Martha, Norma y Kari, gracias por hacer todo más divertido, por su apoyo incondicional y por sus críticas en el trabajo, sin duda sirvieron para mejorar mi proyecto. A Natalia, por enseñarme la mayoría de lo que aprendí durante el doctorado, por tanta paciencia, por festejarnos los cumpleaños y por hacer la vida en el lab. más entretenida. IX A Dany por ser mi hermana mayor no-sanguínea. Por marcarme un camino a seguir en la ciencia, por darme tantos consejos, por entender mis miedos y ayudarme a afrontarlos. A Mónica, Ale, Neus y Mau por ser mis hermanas no-sanguíneas desde hace 11 años, por todas las experiencias y las anécdotas de la FQ y las que siguieron. Siempre habrá un lugar especial en mi corazón para ustedes. A Natalia Pavón, por empezar como una colaboración científica y acabar como amigas. Por ser tan positiva, por siempre ponerme más trabajo y por compartir muchos ideales conmigo. A todos los miembros del Lab. 305 Ote, Lili, Emilio, Gerardito, Isa, Félix, Ulrik y Ramón porque he aprendido mucho a su lado y han enriquecido mi experiencia académica. Por los seminarios y por las convivencias. A mi familia del IBT, Poncho, Checho, Ori, Marel, Hippie, Gigi, Sandy y Fabs, por madurar conmigo, por compartir los problemas y las frustraciones de ser un adulto y de titulación. Nunca me dejen. A todas las personas del Rugby, que a pesar de que ayudaron a alargar mi estancia en el doctorado, seguro lo hicieron más divertido. Una vez puma, siempre puma. 1, 2, 3 Coyotas Awww! X 1 μm Microscopía Electrónica de Transmisión de S. cerevisiae W303. Unidad de Microscopía del Instituto de Fisiología Celular XI ÍNDICE 1. Resumen XIV 2. Abstract XVI 3. Introducción 1 3.1 Simbiosis 1 3.2 Wolbachia sp 3 3.2.1 Wolbachia evitan la propagación de enfermedades transmitidas por vectores 7 3.3 El genoma de Wolbachia y la relación endosimbionte-mitocondria 8 3.4 Cadena transportadora de electrones (CTE) y fosforilación oxidativa 3.4.1 NADH: ubiquinona oxidorreductasa (Complejo I) 3.4.2 Succinato: ubiquinona oxidorreductasa (Complejo II) 3.4.3 Ubiquinol ferrocitocromo c oxidorreductasa (Complejo III) 3.4.4 Citocromo c oxidasa (Complejo IV) 3.4.5 ATP sintasa (Complejo V) 3.4.6 Cadenas ramificadas de levaduras y bacterias 11 12 13 13 15 16 18 3.5 Cultivo de Endosimbiontes/endoparásitos en hospederos artificiales 3.5.1 Bacterias endosimbiontes de hongos 3.5.1.1 Helicobacter pylori como endosimbionte/endoparásito de Candida sp 3.5.1.2 Burkholderia sp como endosimbionte/endoparásito de Rhizopus microsporus 21 21 22 22 4. Planteamiento del problema 23 5. Hipótesis 25 6. Objetivos 6.1 Objetivos particulares 25 25 7. Materiales y Métodos 7.1 Reactivos 7.2 Anticuerpos primarios 7.2.1 Anticuerpos secundarios 26 26 26 27 XII 7.3 Material biológico 7.4 Mantenimiento y cultivo de la línea celular Aa23 7.4.1 Aa23Δw: Eliminación de Wolbachia de la línea celular Aa23 27 28 7.5 Infección de Saccharomyces cerevisiae con Wolbachia extraída de la línea celular Aa23 7.5.1 Infección de Saccharomyces cerevisiae con Wolbachia extraída de levadura 7.6 Mantenimiento de diferentes cepas de Saccharomyces cerevisiae infectadas con Wolbachia 7.7 Cultivo de Saccharomyces cerevisiae en medio líquido (infectadas y no infectadas con Wolbachia) 7.8 Comprobación de la presencia de Wolbachia en los diferentes tipos celulares 7.8.1 Confirmación de la presencia de Wolbachia por PCR del gen wsp 7.8.2 Western Blot para la proteína wsp 7.8.2.1 Geles para SDS-PAGE 7.8.2.2 Western Blot para VDAC 7.8.2.3 Desnudar y reutilizar membranas 7.8.3 Hibridación in-situ con sondas fluorescentes 7.9 Tinción de las levaduras con calcoflúor y FISH 7.10 Microscopía Electrónica de Transmisión 7.11 RT-qPCR 7.12 PCR para el gen 5.8S rDNA de levadura 7.13 Determinación de proteína 7.13.1 Determinación de proteína por Biuret 7.13.2 Determinación de proteína por Bradford 7.14 Curvas de crecimiento de Saccharomyces cerevisiae W303 y BY4741 7.15 Viabilidad celular 7.16 Ensayos de fermentación de las levaduras 7.16.1 Consumo de glucosa 7.17 Aislamiento de la fracción mitocondrial 29 29 30 30 30 31 32 32 34 34 35 35 36 36 37 37 38 38 38 39 39 40 40 XIII 7.18 Mediciones del consumo de oxígeno 7.18.1 Oximetría de fracción mitocondrial de S. cerevisiae 7.18.2 Actividad de la citocromo c oxidasa 7.18.3 Oximetría de la línea celular C6/C36 7.19 Electroforesis en geles Nativos 7.19.1 Preparación de los geles 7.19.2 Amortiguadores para BN-PAGE 7.19.3 Amortiguadores para hrCN-PAGE 7.19.4 Preparación de muestras y corrida de los geles. 7.20 Actividades en gel 7.20.1 NADH deshidrogenasa 7.20.2 Succinato deshidrogenasa 7.20.3 Citocromo c oxidasa 7.20.4 ATPasa 7.21 Espectros diferenciales de los citocromos 7.22 Secuenciación de las bandas de proteína 7.23 Separación de Wolbachia de la fracción mitocondrial 7.23.1 Aislamiento de Wolbachia por gradientes 7.23.2 Aislamiento de Wolbachia por incubación ex vivo 7.24 Hidrólisis de ATP en Wolbachia aislada 7.25 Infección de la línea celular C6/C36 40 40 41 41 41 42 43 43 44 45 45 45 45 46 46 46 47 47 47 47 48 8. Resultados 8.1 Crecimiento, adaptación y transporte de la línea celular Aa23 8.2 Infección de Wolbachia en la línea celular Aa23 8.3 Cultivo de Wolbachia ex-vivo 8.4 Cultivo de Wolbachia como endosimbionte de la levadura Saccharomyces cerevisiae 8.4.1 Evolución de la infección de Wolbachia en S. cerevisiae W303 8.5 Actividad fermentativa de ScW303 y wScW303 8.6 Efecto de Wolbachia sobre la cadena respiratoria de S. cerevisiae 8.7 Cultivo de Wolbachia en diferentes cepas de Saccharomyces cerevisiae rho0 8.8 Wolbachia aislada no expresa una cadena respiratoria activa 49 49 49 51 52 61 66 67 72 73 XIV 8.9 Wolbachia aislada hidroliza ATP 8.10 Wolbachia aislada a partir de levaduras mantiene su capacidad infectiva pero no modifica el consumo de oxígeno de la línea celular 75 76 9. Discusión 10. Conclusiones 11. Perspectivas 12. Bibliografía 13. Anexos A. Abreviaturas B. Comparación de genomas de Wolbachia utilizando la base de datos Genoscope C. Secuencias de genes amplificados D. Proteínas identificadas por MS E. Publicaciones 79 85 86 88 105 105 107 110 112 118 XV ÍNDICE DE TABLAS Tabla 1. Características de bacterias endosimbiontes y de vida libre 1 Tabla 2. Componentes de las cadenas respiratorias clásicas de mamífero, levadura y bacteria 19 Tabla 3. Soluciones para preparar los geles SDS-PAGE 33 Tabla 4. Preparación de geles de gradiente BN o hrCN-PAGE 42 Tabla 5. Densidad de la infección con Wolbachia de diferentes hospederos 65 Tabla 6. Control respiratorio de ScW303 y wScW303 Tabla 7. Concentración de citocromos en la fracción mitocondria-Wolbachia de ScW303 y wScW303. 67 70 XVI ÍNDICE DE FIGURAS Figura 1. Microscopía de transmisión electrónica (MET) de Wolbachia Figura 2. Diversidad de las cadenas transportadoras de electrones bacterianas Figura 3. Esquema de la cadena respiratoria clásica de mitocondria Figura 4. Esquema de reacciones químicas que se llevan a cabo durante el ciclo Q en el complejo III de la cadena transportadora de electrones Figura 5. Estructura de la ATP sintasa Figura 6. Infección de la línea celular Aa23 con Wolbachia Figura 7. Infección de la cepas ScW303, ScBY y ScD273-10B con Wolbachia wAlbB de la línea celular Aa23 Figura 8. Infección de la levadura S. cerevisiae W303 con Wolbachia. Figura 9. La infección de Wolbachia en ScW303 depende de la correcta suplementación del medio Figura 10. Comprobación de la identidad de S. cerevisiae Figura 11. La levadura wScW303 teñida con Calcoflúor e hibridada contra la sonda 16S rDNA de Wolbachia Figura 12. Reconstrucción de los cortes en Z de la levadura wScW303 teñida con Calcoflúor e hibridada contra la sonda 16Sr DNA de Wolbachia Figura 13. Microscopía Electrónica de Transmisión de ScW303 y wScW303 Figura 14. Acercamientos de fotografías tomada por Microscopía Electrónica de Transmisión de wScW303 Figura 15. Crecimiento de S. cerevisiae infectada con Wolbachia utilizando como fuente de carbono galactosa y glucosa Figura 16. Efecto de Wolbachia sobre la viabilidad de Saccharomyces cerevisiae W303 Figura 17. Evolución de la infección de S. cerevisiae W303 con Wolbachia Figura 18. Viabilidad de Wolbachia durante la infección en S. cerevisiae W303 Figura 19. Fermentación de S. cerevisiae W303 infectada con Wolbachia. Figura 20. Consumo de oxígeno de la fracción mitocondrial de S. cerevisiae infectada y no infectada con Wolbachia con uno y 14 días de cultivo Figura 21. BN-PAGE y hrCN-PAGE de ScW303 con y sin Wolbachia a 1 y 14 días Figura 22. Espectros diferenciales de membranas de ScW303 y wScW303 6 9 11 15 17 50 52 53 55 56 57 58 59 60 61 62 63 64 66 68 70 71 XVII Figura 23. Infección de S. cerevisiae W303 rho0 Figura 24. Consumo de oxígeno de la fracción mitocondrial de S. cerevisiae rho0 control o infectada con Wolbachia con uno y 14 días de cultivo Figura 25. Microscopía Electrónica de Transmisión de la fracción con Wolbachia aisalda de ScW303 y wScW303 Figura 26. Consumo de oxígeno de Wolbachia aislada Figura 27. Wolbachia hidroliza ATP Figura 28. Infección de C6/C36 con Wolbachia wAlbB 72 73 74 75 76 77 XVIII 1. Resumen Wolbachia es una bacteria Gram negativa endoparasita/endosimbionte que coloniza a más del 65% de las especies de insectos. Influye sobre la proporción machos-hembras, la fertilidad, la expresión de proteínas, el metabolismo y la esperanza de vida de sus hospederos. Actualmente Wolbachia se utiliza como una herramienta para el control de enfermedades transmitidas por vectores. Por razones desconocidas a la fecha, Wolbachia no crece ex vivo y su cultivo en animales o en líneas celulares requiere una gran inversión y se recuperan pocas bacterias. Estudios previos de los genomas de Wolbachia y sus hospederos reportan una posible simbiosis mutualista, dónde Wolbachia podría donar riboflavina, grupos hemos y/o energía en forma de ATP al hospedero. A la fecha estas hipótesis no han sido comprobadas con experimentos bioquímicos debido a la escasez de biomasa obtenida al cultivar Wolbachia en líneas celulares. En esta tesis se creó un endoparasitismo artificial utilizando a Saccharomyces cerevisiae como hospedero alterno aumentando dos órdenes de magnitud la cantidad de bacterias obtenidas. Se estudiaron los efectos de Wolbachia sobre el metabolismo aerobio del hospedero ya que la riboflavina, que es el precursor de la síntesis de los grupos FAD y FMN; y los grupos hemo que forman parte de los citocromos respiratorios. Heddi et al. (1999), reportó que la actividad de las enzimas del metabolismo aerobio del hospedero Sitophilus oryzae están aumentadas cuándo alberga un endosimbionte que suplementa riboflavina conocido como SOPE. Al eliminar al endosimbionte con antibióticos las actividades enzimáticas disminuyen a la mitad. Acorde a lo reportado en dicho sistema, en las levaduras infectadas con Wolbachia, la fosforilación oxidativa se encuentra acoplada por más tiempo; sin embargo, al aislar a la bacteria se observó que no consume oxígeno indicando que Wolbachia podría no expresar una cadena transportadora de electrones funcional. Los complejos respiratorios detectados en la fracción mitocondria-bacteria eran de S. cerevisiae y únicamente se encontraron algunas subunidades de la F1F0-ATPasa de Wolbachia. El análisis por BLAST del genoma reportado para Wolbachia (wAlbB) mostró la ausencia de algunas subunidades de los complejos transportadores de electrones, lo que indica que Wolbachia no tiene una cadena transportadora de electrones funcional. XIX Finalmente, observamos que el endoparásito provoca la muerte prematura de la levadura, efecto similar al observado en los mosquitos del género Aedes que los hace menos eficientes como vectores de enfermedades virales. En esta tesis se logró construir un novedoso sistema de endosimbiosis artificial utilizando a S. cerevisiae como hospedero alterno. La metodología de infección de la levadura S. cerevisiae es relevante en el campo biotecnológico, en dónde podría facilitar la generación de microbio-reactores. Nosotros utilizamos este sistema para estudiar la interacción del endosimbionte obligado Wolbachia pipientis con su hospedero y encontramos que, contrario a lo reportado, Wolbachia no posee una cadena transportadora de electrones capaz de suministrar ATP al hospedero. Sin embargo el aumento en la actividad de las enzimas del metabolismo aerobio podría indicar que hay una suplementación de grupos hemo y/o de riboflavina por parte de la bacteria. S. cerevisiae es una de las levaduras preferidas para manipular genéticamente, por lo tanto, la evaluación del efecto de la infección en mutantes de S. cerevisiae es una posibilidad novedosa. En el campo de infectología, S. cerevisiae podría utilizarse como modelo para estudiar la infección y propagación de otras bacterias como L. monocytogenes. XX 2. Abstract Wolbachia is an endoparasitic/endosymbiotic gram-negative Rickettsiae-like bacterium. It has colonized over sixty five percent of insect species. Wolbachia efficiently manipulates fertility, protein expression, lifespan and metabolism in the host, thus constituting a potential tool for the management of insect vector-borne diseases. However, attempts to culture Wolbachia ex-vivo have been unsuccessful; unfortunately cell culture yields are low, thus precluding biochemical studies. Previous studies of the Wolbachia available genomes indicate a possible mutualistic symbiosis, where Wolbachia donates riboflavin, heme groups and/or ATP to the host. To date, these hypotheses have not been tested with biochemical experiments due to the low culture yields. Here, an artificial endoparasite relationship was created using Saccharomyces cerevisiae as an alternative host, increasing bacterial yield by two orders of magnitude. The effects of Wolbachia on the hosts aerobic metabolism were studied since riboflavin, which is the precursor of the synthesis of FAD and FMN groups; and heme groups are essential components of the electron transport chain. Heddi et al. (1999) reported that Sitophilus oryzae aerobic metabolism enzymes activities are increased when it harbors an endosymbiont (SOPE) that supplements riboflavin. When eliminating the endosymbiont with antibiotics the enzymatic activities are diminished by 50%. In Wolbachia-infected yeast, mitochondrial respiratory-chain enzyme activities and respiratory controls were preserved for longer periods. However, no respiratory proteins or oxygen consumption from Wolbachia were detected. Only some F1F0- ATPase subunits were expressed. A BLAST analysis of the Wolbachia (wAlbB) genome showed that some subunits of the electron transport complexes were not present, which indicates that the organism may not be capable of generating its own functional respiratory proteins. In addition, we observed that Wolbachia causes premature death in yeast as it does in Aedes mosquitoes. In this work an artificial endosymbiosis system was constructed using S. cerevisiae as alternate host. The infection methodology of S. cerevisiae is relevant in the biotechnological field, where it could facilitate the generation of one-cell microbe reactors. We use this system to study the interaction of the obligate endosymbiont XXI Wolbachia pipientis with its host and we found that, contrary to some reports, Wolbachia does not have an electron transport chain coupled to the synthesis of ATP. However, the increase in the activity of aerobic metabolism enzymes could indicate that Wolbachia contributes with heme and / or riboflavin groups. S. cerevisiae is one of the preferred yeasts to manipulate by means of molecular biology; therefore evaluating the effect of infection on mutants of S. cerevisiae is a possibility that was very limited in insect cells. In the infectology field, S. cerevisiae could be used as a model to study the infection and spread of other bacteria such as L. monocytogenes. 3. Introducción 3.1 Simbiosis Se denomina simbiosis a la asociación íntima entre dos especies que habitan un mismo nicho ecológico y que comparten actividades o requerimientos en común. Se puede presentar en tres formas: mutualismo, comensalismo o parasitismo. En el mutualismo ambas especies resultan beneficiadas; en el comensalismo, una especie se beneficia de otra sin perjudicarla ni beneficiarla; y en el parasitismo, la presencia del huésped daña al hospedero. Además, las relaciones simbióticas pueden clasificarse en ectosimbiosis cuando uno de los seres vive sobre el cuerpo del otro o endosimbiosis cuando uno vive dentro del otro, ya sea en sus órganos o células; también, dependiendo de si pueden vivir independientemente o no, los organismos se dividen en facultativos y obligados (Dimijian, 2000; Winner, 1969). Las bacterias endosimbiontes obligadas pasan por un proceso de inactivación de genes y reducción de genomas (McCutcheon y cols., 2012; Stepkowski y cols., 2001) (ver Tabla 1). Generalmente, los genomas de bacterias de vida libre son mayores que los de las bacterias endosimbiontes. La bacteria de suelo Sorangium cellulosum tiene el genoma más grande, de 13 Mpb (Schneiker y cols., 2007), mientras que la bacteria de vida libre con el genoma más pequeño es la α-proteobacteria Bartonella quintana, con 1.5 Mpb (Alsmark y cols., 2004). Los endosimbiontes obligados bacterianos poseen genomas menores a 1.1 Mpb (ver Tabla 1) por lo que dependen del hospedero para sobrevivir (McCutcheon y cols., 2012). Tabla 1.Características de algunas bacterias endosimbiontes y de vida libre. Bacteria Gen. (Mpb) Hospedero t (h) Relación y papel para el hospedero Ref. Buchnera aphidicola 0.425- 0.650 Pulgón (Bacteriocito) 36 Endosimbionte obligado: provee aminoácidos (Lamelas y cols., 2011) Wigglesworthia glossinidia 0.7 Mosca Tse-tsé (Citoplasma) 36 Endosimbionte obligado: provee vitamina B6, aminoácidos y es necesario para la fecundación. (Akman y cols., 2002) Blochmania sp. 0.7 Hormiga carpintero (Citoplasma) 36 Endosimbionte obligado: provee aminoácidos, compuestos nitrogenados, azufrados e hidroliza la (Degnan y cols., 2005; Gil y cols., 2003; Vieira- Silva y cols., II urea. 2010) Blattobacteria sp. 0.59- 0.63 Cucaracha (micetocitos) - Endosimbionte obligado: provee aminoácidos y recicla nitrógeno. (Sabree y cols., 2009) Carsonella ruddii 0.16 Psílidos Pachpylla venusta - Endosimbionte obligado: se cree que provee aminoácidos al hospedero. (Nakabachi y cols., 2006; Tamames y cols., 2007) Tremblaya princeps 0.14 Cochinilla Planococcus citri (bacteriocito) - Endosimbionte obligado: a su vez posee otro endosimbionte llamado: Candidatus moranella endobia. Ambos proveen aminoácidos al hospedero. (Lopez- Madrigal y cols., 2011; McCutcheon y cols., 2011) Sulcia muelleri 0.19- .27 Saltamontes (bacteriocito) - Endosimbionte obligado: a su vez posee otro endosimbionte llamado Arsenophonus Ambos proveen aminoácidos al hospedero. (Chang y cols., 2015; Kobialka y cols., 2016; Wu y cols., 2006) Baumannia cicadellinicola 0.68 Cigarras (bacteriocito) - Endosimbionte obligado: provee vitaminas B1, B2, B3, B5 and B6. (Wu y cols., 2006) Hadgkinia cicadicola 0.14 Cigarras Diceroprocta semicincta (bacteriocito) - Endosimbionte obligado: puede proveer aminoácidos (McCutcheon y cols., 2009) Candidatus endoecteinascid ia frumentensis 0.63 Tunicado Ecteinascidiat urbinata (bacteriocito) - Endosimbionte obligado: produce ecteinascidin 743, un agente quimioterapéutico. (Moss y cols., 2003; Schofield y cols., 2015) Wolbachia subgrupos C y D 0.95- 1.08 Filarias nemátodos (Citoplasma) - Endosimbionte obligado: provee riboflavina y grupos hemo. (Darby y cols., 2012; Fenn y cols., 2004; Foster y cols., 2005) Sodalis glossinidus 4.1 Mosca Tse-tsé (Bacteriocito) 26 Endosimbionte facultativo: se cultiva en Mitsuhashi-Maramarosch suplementado con 20% de eritrocitos de caballo en 5 a 10% de CO2. (Belda y cols., 2012; Dale y cols., 1999; Matthew y cols., 2005) Burkholderia rhizoxinica 3.75 Mb Rhizopus microsporus (Citoplasma) 0.75 Endosimbionte facultativo: Crece en medio TSB. (Partida- Martinez y cols., 2005) III Wolbachia subgrupo A, B, E y F 1.48- 1.26 Artrópodos (Citoplasma) - Parásito reproductivo obligado intracelular: provoca feminización de machos, partenogénesis e incompatibilidad citoplasmática. (Klasson y cols., 2008; Mavingui y cols., 2012; O'Neill y cols., 1997; Salzberg y cols., 2009; Wu y cols., 2004) Coxiella brunetti 2.1 Garrapatas, macrófagos y neutrófilos (lisosomas) 20 Parásito intracelular obligado: cultivado en huevos de gallina fertilizados. (Elliott y cols., 2013; Omsland y cols., 2013; Weiss, 1973) Chlamydia sp. 1 Monocitos (fagosoma) 20- 24 Parásito intracelular obligado. Cultivado en líneas celulares (Moulder, 1991; Omsland y cols., 2014; Vieira-Silva y cols., 2010) Rickettsia sp. 1.11 Garrapatas, piojos, pulgas, ácaros y mamíferos (citoplasma) 12- 13 Parásito intracelular obligado. Cultivados en líneas celulares y huevos de gallina fertilizados (Andersson y cols., 1998; McLeod y cols., 2004; Wood y cols., 2012) Helicobacter pylori 1.66 Macrófagos, células dendríticas y epiteliales (vacuolas) 2.4 Patógeno facultativo intracelular: cultivado como bacteria libre en medios suplementados. (Dubois y cols., 2007; Lamarque y cols., 2003; Siavoshi y cols., 2005a) Escherichia coli 4.6 Células epiteliales, macrófagos y monocitos. .35 Patógeno facultativo intracelular (Levine, 1987; Sukumaran y cols., 2003) Gen: tamaño del genoma; Mpb: Mega pares de bases; t (h): tiempo de duplicación en horas; - no reportado. Los endosimbiontes obligados bacterianos realizan funciones específicas para el hospedero, como sintetizar nutrientes (Buchner, 1965; Dale y cols., 2006; Douglas, 2015), reciclar productos nocivos de excreción tales como urea o ácido úrico (Malke, 1964), sintetizar compuestos tóxicos que el hospedero utiliza como defensa y/o para facilitar el parasitismo de otras especies (Partida-Martinez y cols., 2007a; Partida- Martinez y cols., 2005) (ver Tabla 1). 3.2 Wolbachia sp Wolbachia sp es un α-proteobacteria (Gram negativa) que infecta del 65 al 70% de los insectos que habitan la Tierra; es la bacteria intracelular más común reportada a la fecha IV (Foster y cols., 2005; Jeyaprakash y cols., 2000; Werren y cols., 2008). Se transmite a la progenie por herencia materna (Bandi y cols., 2001) y mide de 0.02 μm a 1 μm de largo58,59 (Figura 1), no presenta flagelos, fimbrias ni pili, sin embargo no se considera inmóvil, ya que existe la posibilidad de que utilice el citoesqueleto de actina del hospedero para desplazarse (Foster y cols., 2005). En artrópodos Wolbachia puede transmitirse horizontalmente. Los mecanismos sugeridos incluyen alimentarse con insectos previamente infectados con Wolbachia, canibalismo y transmisión de la bacteria en el alimento (planta) (Ahmed y cols., 2016; Chrostek y cols., 2017; White y cols., 2017). Dependiendo del hospedero, Wolbachia puede considerarse un parásito reproductivo o un endosimbionte mutualista (Tabla 1). En artrópodos, esta bacteria ha desarrollado mecanismos de parasitismo reproductivo para facilitar la invasión de poblaciones provocando en sus hospederos incompatibilidad citoplasmática, feminización de machos y partenogénesis (Werren y cols., 2008). En Drosophila melanogaster, aumenta la longevidad, la capacidad reproductiva y suministra nutrientes durante periodos de estrés por exposición a dietas bajas o altas en hierro (Brownlie y cols., 2009a). En Aedes aegypti se ha observado que confiere protección contra la colonización del insecto por Plasmodium, virus del Nilo, chikungunya, zika, dengue, etc. evitando que dichas enfermedades se propaguen (Brownlie y cols., 2009b; Dutra y cols., 2016; Glaser y cols., 2010; Hedges y cols., 2008; Hoffmann y cols., 2011; Johnson, 2015; Moreira y cols., 2009; Mousson y cols., 2010; Pan y cols., 2012; Walker y cols., 2011). En los nemátodos, la relación bacteria-hospedero ha evolucionado hacia una endosimbiosis obligada: Wolbachia es esencial para el crecimiento, desarrollo, cambio de estadio larvario, fecundación y supervivencia del parásito (Fenn y cols., 2004; Langworthy y cols., 2000; Taylor y cols., 1999). Ambos organismos poseen genomas complementarios; es decir, los genes de ciertas vías metabólicas y de síntesis de cofactores esenciales se encuentran únicamente en el genoma de la proteobacteria o en el del hospedero (Bandi y cols., 2001; Foster y cols., 2005; Rao y cols., 2002; Taylor y cols., 1999). Al ser esencial en el desarrollo de las filarias, Wolbachia se ha convertido en un posible blanco terapéutico contra las filariasis causadas por Wuchereria bancrofti, Brugia malayi y Onchocerca volvulus (Bandi y cols., 2001; Johnston y cols., 2010). Los genomas de Wolbachia secuenciados a partir de hospederos artrópodos son más grandes que los obtenidos de especies de Wolbachia de nemátodos (ver Tabla 1) en V los que la bacteria es un endosimbionte obligado (Darby y cols., 2012; Foster y cols., 2005; Mavingui y cols., 2012; Metcalf y cols., 2014; Salzberg y cols., 2009; Wu y cols., 2004). Esto puede deberse a que en los artrópodos la bacteria no es necesaria y debe mantener sus mecanismos de parasitismo para garantizar su permanencia en la población. Basándose en un análisis filogenético del gen ftsZ, Wolbachia se ha clasificado en 6 subgrupos dependiendo del hospedero en donde habita. Los subgrupos A y B corresponden a Wolbachia endosimbionte de artrópodos. Los subgrupos C y D corresponden a Wolbachia endosimbionte de filarias. El grupo E corresponde a endosimbiontes de colémbolos, que son artrópodos hexápodos y el grupo F corresponde a Wolbachia endosimbionte de termitas (Lo Nathan, 2002). Como todos los endosimbiontes obligados, Wolbachia no puede cultivarse fuera de un hospedero por lo que se mantiene en animales vivos infestados con nemátodos, en artrópodos o en cultivos celulares. La primera línea celular infectada con Wolbachia fue obtenida a partir de huevos de mosquito tigre Aedes albopictus naturalmente infectados con Wolbachia (wAlbB) (O'Neill y cols., 1997) a esta línea celular se le conoce como Aa23 (Figura 1 a y b). Actualmente se ha logrado cultivar en neuroblastos y fibroblastos humanos (Noda y cols., 2002; White y cols., 2017), células L929 de ratón(Noda y cols., 2002), mariposa Sf9 (Dobson y cols., 2002; Noda y cols., 2002) y derivados de líneas de insecto como la línea C6/C36 (Baldridge y cols., 2014). Se h reportado que Wolbachia no puede establecer infecciones en mamíferos debido a sus propiedades antigénicas (Shiny y cols., 2009). Wolbachia posee un grupo de proteínas conocidas como Wolbachia surface proteins (wsp) localizadas en la cara externa de la membrana bacteriana. Aunque no se sabe la función exacta de estas proteínas, se cree que están involucradas en las interacciones bacteria-hospedero y en la distribución de Wolbachia durante los estadios de crecimiento del hospedero. Se ha propuesto la función de dos de estas proteínas en Wolbachia de Brugia malayi: wBm0432 interactúa con varias enzimas glucolíticas incluyendo a la aldolasa y la enolasa y wBm0152 interactúa con la actina y la tubulina del hospedero (Melnikow y cols., 2013). Las proteínas wsp evocan una respuesta inmune innata en mamíferos a través de la activación de TLR1 Y TLR4 en humanos y en ratones (Brattig y cols., 2004) que culmina con la eliminación de la bacteria del hospedero mamífero. En 2015, en el Hospital "Peking University First Hospital" en Beijing, China, se amplificaron los genes 16S rRNA y fbpA de Wolbachia a partir de las muestras de VI sangre de un paciente con linfoma de Hodgkin (Chen y cols., 2015). Las secuencias obtenidas de dichos genes indicaron una infección con Wolbachia del subgrupo B. Este caso sugiere que Wolbachia puede transmitirse a humanos inmunodeprimidos por medio de picadura de mosquito. En 2017 se demostró que Wolbachia no es un endosimbionte exclusivo del reino animal, este puede colonizar de manera transitoria plantas de algodón (Figura 1 c y d), pepino y frijol, lo que facilita su transmisión de insecto a insecto (Chrostek y cols., 2017; Li y cols., 2017). Figura 1. Microscopía de transmisión electrónica (MET) de Wolbachia. a y b) en la línea celular Aa23 infectada naturalmente. Wolbachia se señala con una flecha. Imagen tomada de (O'Neill y cols., 1997); c y d) y en el tubo del tamiz del floema de una hoja de algodón. CW, pared celular del floema de la planta; CH, cloroplasto; M, mitocondria; V, vacuola de la célula vegetal; W, Wolbachia. Imagen tomada de (Li y cols., 2017). a b c d VII 3.2.1 Wolbachia evitan la propagación de enfermedades transmitidas por vectores Dos de las enfermedades con mayor relevancia epidemiológica a nivel mundial son el paludismo y el dengue. Según la OMS (Organización Mundial de la Salud), las enfermedades transmitidas por un vector artrópodo representan el 17% de las enfermedades infecciosas a nivel mundial, con 1,000 millones de casos y un millón de defunciones anuales (WHO, 2016; WHO, 2017). Varios grupos de investigación han reportado que los mosquitos infectados con Wolbachia disminuyen su capacidad de propagación de enfermedades (Blagrove y cols., 2013; Dutra y cols., 2016; Evans y cols., 2009; Hughes y cols., 2011; Hughes y cols., 2012; Hussain y cols., 2013; Kambris y cols., 2010; McMeniman y cols., 2009; Moreira y cols., 2009; Mousson y cols., 2010; Pan y cols., 2012). Un mosquito hembra madura a los dos días de eclosionar y debe ingerir sangre para poner huevos fértiles. Si la sangre consumida estaba contaminada con algún patógeno, estos requieren un período de incubación que dura de 10 a 17 días para dengue y malaria, en dónde se replican en el intestino del mosquito para después migrar a las glándulas salivales (WHO, 2017). Normalmente, un mosquito hembra vive entre 40-50 días, lo que implica que por lo menos la mitad de su vida podrá ser contagiosa si consume sangre contaminada en su primera alimentación. Wolbachia (wMelPop) aislada de Drosophila melanogaster e introducida en Aedes aegypti acorta la vida media del mosquito en un 50%, disminuyendo el tiempo en el que el mosquito actúa como vector (Evans y cols., 2009; McMeniman y cols., 2010). Wolbachia impide la colonización de hospedero por otros patógenos. Se ha observado que Wolbachia confiere protección contra la colonización del insecto por Plasmodium y virus de Dengue, virus del Nilo, Chikungunya, Zika, etc., evitando que dichas enfermedades se propaguen (Blagrove y cols., 2013; Dutra y cols., 2016; Evans y cols., 2009; Hughes y cols., 2011; Hughes y cols., 2012; Hussain y cols., 2013; Kambris y cols., 2010; McMeniman y cols., 2009; Moreira y cols., 2009; Mousson y cols., 2010; Pan y cols., 2012). El mecanismo por el que Wolbachia inhibe la colonización del patógeno no ha sido elucidado pero se piensa que compite por nutrientes como aminoácidos y colesterol (Caragata y cols., 2013; Caragata y cols., 2014), y que mantiene activado el sistema inmune del hospedero (Amuzu y cols., 2016; Terradas y cols., 2017). Finalmente, Wolbachia causa incompatibilidad citoplásmica que puede utilizarse VIII como herramienta para prevenir la propagación de enfermedades (Loreto y cols., 2016). Ésta consiste en una modificación en el DNA del mosquito que provoca que los machos infectados únicamente puedan tener una descendencia viable si se aparean con hembras infectadas, si se aparean con hembras no infectadas la descendencia no es viable. La descendencia de una hembra infectada será 100% viable y portadora de Wolbachia. (Werren, 1997; Werren y cols., 2008). La estrategia sugerida sería disminuir la población total de mosquitos infectando a una población de machos con Wolbachia, pero no a las hembras, promoviendo la muerte de la mayoría de la progenie. En Australia, Colombia, Estados Unidos y algunos países de Asia se han infectado mosquitos con Wolbachia (wMel) y se han introducido en zonas endémicas de dengue y se ha observado una disminución de casos reportados. 3.3 El genoma de Wolbachia y la relación endosimbionte-mitocondria Wolbachia y sus hospederos tienen vías metabólicas complementarias. Por ejemplo, el genoma de B. malayi carece de las vías metabólicas para la síntesis de riboflavina y del grupo hemo, mientras que el genoma de Wolbachia de B. malayi (wBm) contiene los genes completos para ambas vías. Por otro lado, B. malayi tiene la capacidad de sintetizar aminoácidos de novo, mientras que wBm no tiene las vías metabólicas para producirlos, pero tiene simportadores de aminoácidos. Además, posee sistemas de translocación de proteínas, sistemas de secreción Tipo IV y sistemas de secreción ABC (Foster y cols., 2005; Klasson y cols., 2008; Wu y cols., 2004). Todos los subgrupos de Wolbachia carecen de los genes que codifican para las enzimas de la glucólisis: glucosa-6-fosfatocinasa (HK), fosfofructocinasa (PFK) y sólo tiene los genes a partir de fructosa-1,6-bifosfato aldolasa. No tiene genes codificantes para la piruvato cinasa (PK), pero la sustituyen con una piruvato fosfato dicinasa. Dichas bacterias tienen todos los genes que codifican para las proteínas del ciclo de ácidos tricarboxílicos y la vía completa de gluconeogénesis necesaria para la vía de las pentosas (Foster y cols., 2005; Klasson y cols., 2008; Wu y cols., 2004). Al ser un α-proteobacteria se espera que Wolbachia posea los genes necesarios para codificar cadenas respiratorias similares a las de, rickettsias y mitocondrias (Emelyanov, 2003). Cada genoma de Wolbachia posee diferentes genes para formar una cadena respiratoria (ver anexo B). Dependiendo de la especie, pueden incluir NADH: ubiquinona oxidorreductasa, succinato deshidrogenasa, glicerol-3-fosfato deshidrogenasa, glicerol deshidrogenasa, PQQ deshidrogenasa, ubiquinol oxidasa- citocromo c reductasa, citocromo c oxidasa soluble, citocromo c oxidasa, citocromo d IX oxidasa y nitrato reductasa (Figura 2, anexo B). Según el genoma de Wolbachia wAlbB (Mavingui y cols., 2012) analizado en la plataforma MycroScope (Vallenet y cols., 2009) (http://www.genoscope.cns.fr/agc/microscope) esta posee 11 subunidades de Complejo I, tres subunidades de complejo II, una subunidad de complejo III y tres subunidades de complejo IV (ver Anexo B). Todos los genomas poseen las unidades a, b, c, α, β, γ, δ, ε de la F1Fo-ATP sintasa (Foster y cols., 2005; Klasson y cols., 2008; Wu y cols., 2004). Figura 2. Diversidad de la cadena transportadora de electrones de bacterias. Imagen modificada de (Rosas-Lemus, 2016). A) La cadena respiratoria de E. coli ofrece una gran diversidad de deshidrogenasas y oxidasas que se expresan dependiendo de la disponibilidad de sustratos y de la concentración de oxígeno a la que está expuesta. E. coli no posee complejo III ni complejo IV por lo que los electrones pasan directamente de las pozas de ubiquinol a los citocromos bo3 o bd; o a las reductasas que utilizan aceptores de electrones diferentes al oxígeno (Ingledew y cols., 1984; Trumpower, 1990; Unden y cols., 1997). B) La cadena respiratoria de Wolbachia incluye una cadena respiratoria similar a la mitocondrial, además de numerosas posibles deshidrogenasas (Foster y cols., 2005; Klasson y cols., 2008; Wu y cols., 2004). Baldrige y cols. (2014) purificaron Wolbachia a partir de cultivos de líneas celulares de Aedes albopictus C7-10 mediante un gradiente de sacarosa y caracterizaron X su proteoma. Dentro de estas secuencias, no se encontraron las de complejo I, III o IV, únicamente subunidades de la succinato deshidrogenasa y de la ATP sintasa (Baldridge y cols., 2014). Darby y cols., 2012 sugieren que Wolbachia dona ATP a su hospedero lo que parece ser contradictorio, ya que para generar suficiente energía para el hospedero y para la bacteria, las proteínas de la cadena transportadora de electrones deberían ser fácilmente detectables. El grupo del Dr. Sullivan sugiere que Wolbachia no dona ATP al hospedero y únicamente le suplementa con riboflavina y grupos hemos (Pietri y cols., 2016). Otras vías presentes en Wolbachia, pero no en Rickettsias incluyen la degradación de treonina, la biosíntesis de riboflavina, la síntesis de pirimidinas y la presencia de transportadores de hierro (Foster y cols., 2005; Wu y cols., 2004). En contraste, Wolbachia ha perdido la capacidad de biosíntesis de lipopolisacáridos y lípido A, pero puede sintetizar peptidoglicanos (N-acetilglucosamina y N- acetilmuramato), ácidos grasos, fosfolípidos e isoprenoides (Foster y cols., 2005). El efecto de Wolbachia sobre el metabolismo de sus hospederos se ha estudiado utilizando a la filaria patógena de ratas de algodón, Litomosoides sigmodontis. Se observó que al eliminar Wolbachia con tetraciclina, había un aumento en la expresión de los genes de la cadena respiratoria que están codificados en el genoma mitocondrial (ND1-5 de la NADH deshidrogenasa, citocromo b, COX I, II y III y la subunidad ATP6 de la ATP sintasa). En ese estudio proponen que al eliminar Wolbachia, la filaria no es capaz de sintetizar enzimas funcionales que contengan grupos hemo y derivados de riboflavina, lo que resulta en una pérdida de energía que el organismo trata de compensar (Strubing y cols., 2010). Darby y cols. (2012) evaluaron mediante RNA-seq las vías metabólicas que aumentaron al tratar al hospedero con tetraciclina, observando mayor expresión de la subunidad 3 de la citocromo c oxidasa y de la ATP sintasa, por lo que proponen que Wolbachia sustituye a la mitocondria donando energía al hospedero (Darby y cols., 2012). Otro endosimbionte que favorece el metabolismo energético del hospedero es una γ-proteobacteria conocida como SOPE (Endosimbionte Principal de Sitophilus oryzae); es un endosimbionte de S. oryzae (gorgojo de arroz). En larvas se ha reportado que el SOPE aumenta la fosforilación oxidativa al suministrar riboflavina y ácido pantoténico al hospedero, optimizando las actividades de la succinato citocromo c reductasa, glicerol-3-fosfato deshidrogenasa, citocromo c reductasa, piruvato deshidrogenasa y α-cetoglutarato deshidrogenasa. La adición de estas vitaminas a las XI larvas aposimbiontes restaura las actividades de dichas enzimas en un 70-80% (Heddi y cols., 1999). El protozoario Strigomonas culicis posee una bacteria endosimbionte no identificada, cuya eliminación disminuye el consumo de oxígeno del hospedero en un 76% (de 1.2 a 0.3 nmolO2/min*106 células) (Loyola-Machado y cols., 2017). 3.4 Cadena transportadora de electrones (CTE) y fosforilación oxidativa La respiración es un proceso que crea la energía protón motriz transmembranal que se utiliza para la síntesis de ATP por la ATP-sintasa (Mitchell, 1966) y para energizar el transporte secundario transmembranal. Mediante el flujo de electrones a través de los complejos de la cadena respiratoria se cataliza la translocación de protones al espacio intermembranal (EIM) generando una diferencia en el potencial transmembranal que se acopla a la síntesis de ATP, la principal molécula energética en los seres vivos. Figura 3. Esquema de la cadena respiratoria clásica mitocondrial. Tomada de (Sazanov, 2015). La cadena respiratoria mitocondrial clásica está formada por cuatro complejos. El complejo I (NADH-ubiquinona óxidorreductasa) y el complejo II (Succinato-ubiquinona óxidorreductasa) catalizan la transferencia de electrones producto de la oxidación del NADH y del succinato a la poza de ubiquinona (UQ) que se reduce a ubiquinol. Posteriormente, el complejo III (Ubiquinol ferrocitocromo c oxidorreductasa o citocromo bc1) toma los electrones del ubiquinol y a través del citocromo c soluble transfiere los electrones al complejo IV (Citocromo c oxidasa) que finalmente reduce al O2 formando agua. Los complejos respiratorios bombean 4/0/4 y 2 protones al espacio intermembranal (EIM o IMS en esta figura) generando un gradiente de pH que a su vez se convierte en el potencial eléctrico transmembranal. Esta fuerza protón-motriz es utilizada por el complejo V (ATP sintasa) para fosforilar ADP y producir ATP. Por cada molécula de NADH oxidada se bombean 10 protones (Lehninger, 2013; Sazanov, 2015) y en una ATPasa con diez subunidades c, se requieren 2.7 protones para XII sintetizar una molécula de ATP. Para la imagen se utilizaron las estructuras de complejo I de Thermus thermophilus (PDB id. 4HEA), complejo II de Sus scrofa (PDB id. 1ZOY), complejo III de Bos taurus (PBD id. 1OCC), ATPasa de B. taurus (J.E. Walker, Medical Research Council, Mitochondrial Biology Unit, Cambridge, UK). En una cadena respiratoria clásica (de mamífero), los electrones provenientes de intermediarios del metabolismo son transportados de la matriz mitocondrial (Mat) a través del Complejo I (NADH-ubiquinona oxidorreductasa) o del Complejo II (Succinato-ubiquinona oxidorreductasa) a la poza de ubiquinona (UQ), que se reduce a ubiquinol. Enseguida, el ubiquinol dona sus electrones al complejo III (Ubiquinol ferrocitocromo c oxidorreductasa o citocromo bc1), el cual, a través del citocromo c soluble transfiere sus electrones al complejo IV (Citocromo c oxidasa) que finalmente reduce al O2 formando agua. Los complejos I, III y IV sirven como bombas de protones transfiriendo 4, 4 y 2 protones, respectivamente, al espacio transmembranal generando una diferencia en el potencial eléctrico transmembranal (Figura 3)(Lehninger, 2013). Finalmente, el complejo V (F1Fo ATP sintasa) aprovecha el gradiente de protones generado por la CTE disipándolo en un proceso acoplado a la producción de ATP. 3.4.1 NADH: ubiquinona óxidorreductasa (Complejo I) La NADH: ubiquinona óxidorreductasa es el primer complejo multi-proteico de la CTE. Este complejo acopla la transferencia de un par de electrones del NADH producido durante la oxidación de los diferentes intermediarios del ciclo de Krebs y de la β- oxidación a la translocación de cuatro protones a través de la membrana interna mitocondrial, catalizando la siguiente reacción: NADH + H+ + Q + 4H+ Mat→ NAD+ + QH2 + 4H+ EIM Esta enzima tiene una estructura de "L" formada por un brazo periférico (N) que posee como grupo prostético un flavín mononucleótido (FMN) y el sitio de unión a NADH del lado de la matriz mitocondrial. Posee además 8-9 centros Fe-S unidos covalentemente que conectan el FMN con el módulo Q, que es donde se encuentra el sitio de unión a la quinona. Finalmente, el brazo de membrana (P) se encuentra embebido en la membrana interna mitocondrial y se encarga de la translocación de los protones al espacio intermembranal (Figura 3). El complejo I de mamíferos y levaduras está formado por 42-43 subunidades de las cuales 7 están codificadas en genoma mitocondrial (Carroll y cols., 2003; Degli Esposti, 1998; Walker, 1992; Zhu y cols., XIII 2016). El complejo I de E. coli está formado por 13 subunidades, mientras que los de Thermus thermophilus y P. denitrificans poseen 14 subunidades (Carroll y cols., 2003; Sazanov, 2015; Stolpe y cols., 2004; Walker, 1992; Zickermann y cols., 2015) (Tabla 2). El mecanismo de acción del complejo I es el mismo para todos los organismos: el NADH se oxida a NAD+ en la subunidad Nqo1/NuoF del brazo N y dona sus electrones al FMN localizado en la misma subunidad. Después los electrones pasan de manera individual a través de 7 centros Fe-S colocados a una distancia igual o menor a 14 Å que forman una cadena que va desde el FMN hasta el sitio de unión a la quinona en el módulo Q donde los electrones reducen la ubiquinona a ubiquinol. El paso de los electrones del brazo N al módulo Q genera un cambio conformacional en el brazo de membrana que permite la translocación de cuatro protones al espacio intermembranal (Walker, 1992). La rotenona, el amital y la piericidina A inhiben la actividad del complejo I al bloquear el sitio de unión de la ubiquinona en el sitio Q (Degli Esposti, 1998). La función de las subunidades supernumerarias aún no ha sido elucidada, aunque se cree que pueden funcionar como chaperonas ayudando a ensamblar el complejo. 3.4.2 Succinato: ubiquinona óxidorreductasa (Complejo II) El segundo complejo de la cadena transportadora de electrones se localiza en la membrana interna mitocondrial. Esta enzima también cataliza un paso del ciclo de Krebs por lo que es un punto de unión entre el ciclo de ácidos tricarboxílicos y la cadena respiratoria. Este complejo no bombea protones y no contribuye a la generación del potencial transmembranal. Cataliza la siguiente reacción: Succinato + Q → Fumarato + QH2 El complejo está formado por cuatro subunidades: dos hidrofílicas que se encuentran del lado matricial, sdhA y sdhB; y dos membranales, sdhC y shdD. La subunidad sdhA es una flavoproteína que tiene el sitio de unión al succinato y una molécula de FAD+ unida covalentemente. El succinato interactúa con el sitio de unión y dona sus electrones reduciendo el FAD+ a FADH2. Los dos electrones del FADH2 pasan de manera independiente por los centros Fe-S hasta el sitio de unión de la ubiquinona, formado por las subunidades sdh B, C y D. Se cree que el hemo b que se localiza en la subunidad sdhB sirve para mantener al primer electrón atrapado entre la semiubiquinona y el hemo b. Posteriormente, cuando llega el segundo electrón se XIV reduce la ubiquinona y así se evita la producción de especies reactivas de oxígeno (EROs) (Cecchini, 2003; Sun y cols., 2005). Existen dos tipos de inhibidores: los que funcionan como análogos del succinato, como el malonato, malato y oxaloacetato y los que interfieren en el sitio de unión de la ubiquinona como la carboxina y la fenoiltrifluoroacetona (Hagerhall, 1997; Mowery y cols., 1977; Ramsay y cols., 1981). 3.4.3 Ubiquinol ferrocitocromo c óxidorreductasa (Complejo III) El complejo III cataliza la transferencia de electrones del ubiquinol al citocromo c soluble, transfiriendo cuatro protones al EIM. El complejo III es un dímero: cada monómero está constituido por 11 subunidades en mamífero, 9 en levadura y 3 en bacterias (Iwata y cols., 1998; Lange y cols., 2002; Solmaz y cols., 2008; Trumpower, 1990; Wittig y cols., 2010; Xia y cols., 1997; Yang y cols., 1986; Zhang y cols., 1998). Las 3 subunidades codificadas en bacteria son el citocromo b, que en eucariotas es codificado en el genoma mitocondrial y que contiene los sitios Q0, Qi y dos grupos hemo b: bL y bH; la subunidad citocromo c que tiene un citocromo c1; y la proteína Rieske que tiene un centro Fe-S. El complejo III tiene dos sitios de unión al ubiquinol, el sitio Q0 que se encuentra cerca del EIM y el Qi que se encuentra cerca de la matriz mitocondrial (Trumpower, 1990) (Figura 4). El funcionamiento del complejo III requiere dos vueltas al llamado ciclo Q para completar la siguiente reacción: QH2 + 2 citocromos c3+ + 2H+ Mat → Q + 2 citocromos c2+ + 4H+ EIM En el primer ciclo, una molécula de ubiquinol se oxida en el sitio QO transfiriendo uno de sus electrones a los centros fierro-azufre de la proteína Rieske, de donde pasa al citocromo c1 y de ahí al citocromo c soluble, colocando dos protones en el EIM. La semiquinona resultante dona su segundo electrón al sitio QO y reduce al hemo bL, convirtiéndose en ubiquinona. El electrón pasa del hemo bL al bH y al sitio Qi, en donde se encuentra unida una ubiquinona que al recibir el electrón se reduce a semiquinona. En la segunda parte del ciclo, otra molécula de ubiquinol se oxida en el sitio QO, transfiriendo de la misma manera un electrón al citocromo c soluble y bombeando dos protones al EIM. El electrón restante pasa hasta la semiquinona que quedó en el sitio Qi por el mismo camino que el anterior, regenerando una molécula de ubiquinol. Así, por cada molécula de ubiquinol se transfieren cuatro protones al EIM y se reducen 2 moléculas de citocromo c soluble (Osyczka y cols., 2005). XV Figura 4. Esquema de reacciones químicas que se llevan a cabo durante el ciclo Q en el complejo III de la cadena transportadora de electrones. El complejo III de la cadena transportadora de electrones se forma por la subunidad citocromo b (verde) que posee dos grupos hemo de tipo b (bL y bH), la subunidad citocromo c que posee un grupo hemo de tipo c (azul) y la proteína de hierro azufre de Rieske (morada) que posee una agrupación formada por dos átomos de hierro y dos de azufre (2Fe•2S). El complejo III cataliza la reducción del citocromo c por medio de la reducción de la ubiquinona (QH2) a ubiquinol (Q) acoplado a la transferencia de 4 protones hacia el espacio intermembranal. Imagen tomada de (Lehninger, 2013). La antimicina A es un inhibidor de complejo III que al unirse al sitio Qi impide el transporte de electrones del citocromo bH a la ubiquinona unida en este sitio (Drose y cols., 2008). Otros inhibidores del complejo III son el mixotiazol y la estigmatelina. Estos se unen al sitio Q0 impidiendo la transferencia de electrones del ubiquinol a la proteína Rieske (Uribe-Carvajal, 2008). 3.4.4 Citocromo c oxidasa (Complejo IV) El complejo IV es el último complejo de la cadena respiratoria y se encarga de reducir el oxígeno molecular a agua utilizando los electrones provenientes de cuatro citocromos c solubles: 4 citocromos c2+ + O2 + 8 H+ Mat → 4 citocromos c3++2H20 + 4H+ EIM XVI Los monómeros activos de esta proteína están formados por 11-13 subunidades en eucariotes y 3-4 subunidades en procariotes. Las unidades conservadas entre reinos son COX I, II y III, que en eucariotes están codificadas en el genoma mitocondrial. En las subunidades COX I y COX II se encuentran 2 grupos hemos aa3; y dos cobres CuA y CuB (Iwata, 1998; Steffens y cols., 1987; Yang y cols., 1986). Un electrón proveniente de cada citocromo c soluble pasa de manera individual al primer cobre (CuA). Después, los electrones pasan al hemo a y finamente al centro binuclear hemo a3-CuB donde se reduce una molécula de oxígeno a dos de agua. La reacción requiere 8 protones: 4 para la formación del agua y 4 que se bombean al EIM. Se cree que por cada electrón que se deposita en el centro binuclear un protón se bombea al EIM. El cianuro, la azida y el monóxido de carbono inhiben al complejo IV al bloquear el sitio de unión del oxígeno (Yoshikawa y cols., 1990). 3.4.5 ATP sintasa (Complejo V) El complejo V (F1Fo ATP sintasa) es una enzima transmembranal que se encarga de la producción de ATP a partir de ADP y Pi. Está formada por dos segmentos principales unidas por interacciones no covalentes: el segmento Fo que está embebido en la membrana mitocondrial interna y a través de la cual pasan los protones expulsados por la CTE al EIM; y el segmento F1, que es la porción catalítica que se proyecta hacia la matriz mitocondrial y en coordinación con la rotación de las subunidades c, γ y ε de la porción Fo experimenta cambios conformacionales que fosforilan al ADP (Figura 5). La ATP sintasa actúa independientemente de la CTE, pero depende del potencial transmembranal generado por la translocación de protones. La síntesis del ATP acoplada a la respiración celular se denomina fosforilación oxidativa (Bakhtiari y cols., 1999; Jonckheere y cols., 2012). El segmento F0 está formado por las subunidades a-g en mamíferos, a-h en levaduras y a-c en bacterias. Constituye el grueso del motor rotatorio pudiendo variar de 8 a 15 subunidades: la mitocondria de bovino posee un anillo con 8 subunidades c, las levaduras poseen un anillo de 10 subunidades c y E. coli puede tener entre 10 y 14 subunidades. Los protones acumulados en el EIM pasan a la matriz mitocondrial a través de un canal formado entre las subunidades a y c de la subunidad F0 ocasionando la rotación del anillo c. Las subunidades a y b de la subunidad F0 forman el brazo periférico de la enzima y no giran (estator). Del otro lado del tallo central y del lado de la matriz mitocondrial se encuentra anclado el segmento F1. Este segmento se encuentra XVII unido a este anillo rotatorio por medio de un eje central (subunidades , ) que rota con el anillo c. Esta está formada por 3 subunidades y alternadas de manera circular. Los sitios de unión de ADP, Pi y ATP están localizados en las interfaces de las subunidades / . En un giro de 360 cada sitio activo pasa por tres estados: abierto que permite la entrada y salida de productos; relajado, en donde se encuentran el ADP y el fosfato en un espacio cerrado; y cerrado, donde se induce la formación del enlace fosfodiéster entre el ADP y el fosfato. El rendimiento teórico indica que por cada NADH que entra a la CTE se producirán entre 2.5 y 2.7 ATPs, mientras que por cada succinato, se producirán 1.5 a 1.6 ATPs (Lehninger, 2000). Figura 5. Estructura de la ATP sintasa. Estructura de la ATPasa, tomada de Molecular Cell Biology, 6ª edición, 2015. La ATPasa está formada por la unidad F0, formada por las subunidades estáticas (naranja) a y b y la subunidades móviles (verde) conocidas como ``anillo c´´, un brazo periférico estático (naranja) constituido por las subunidades a y b; un tallo central móvil (verde) que conecta las subunidades F0 y F1 formado por las subunidades , , , y la subunidad F1 o unidad catalítica que se encarga de fosforilar el ADP y está formada por 3 dímeros de subunidades / . XVIII 3.4.6 Cadenas ramificadas de levaduras y bacterias Las bacterias y las levaduras son organismos cosmopolitas, su metabolismo ha evolucionado para poder obtener energía a partir de diferentes fuentes. Como consecuencia, las cadenas respiratorias de dichos organismos son ramificadas, es decir, pueden estar formadas por diferentes deshidrogenasas, quinonas y oxidasas expresadas en función de la especie, los sustratos disponibles, la concentración de oxígeno en el ambiente y los requerimientos energéticos de la célula (Anraku, 1988). Las NADH deshidrogenasas alternas o de Tipo II (NDH2), presentes en bacterias, hongos y plantas, están formadas por una cadena sencilla de aminoácidos con una masa entre 43 y 60 kDa y que tiene como grupo prostético un FAD unido no covalentemente. Estas se codifican en el genoma nuclear y no tienen segmentos transmembranales. La levadura S. cerevisiae, que no tiene complejo I, codifica para tres NDH2, una interna que cumple con la función de donador de electrones a la poza de ubiquinonas para surtir a la cadena transportadora de electrones, y dos externas cuya función es reoxidar el NADH citosólico. En bacterias, las NDH2 siempre se encuentran del lado citosólico de la membrana plasmática (Kerscher y cols., 2008; Kerscher y cols., 1999; Uribe-Alvarez y cols., 2016). Las NDH2 se inhiben con compuestos derivados de flavonas (Juarez y cols., 2004). Los donadores de electrones adicionales que una bacteria puede utilizar dependen de la naturaleza de ésta: si es organótrofa, consumirá moléculas orgánicas y si es litótrofa utilizará donadores de electrones inorgánicos como hidrógeno, amoníaco, sulfuro, fierro, etc. En las bacterias se han reportado la formato deshidrogenasa, las D y L-lactato deshidrogenasas, la gliceraldehído-3-fosfato deshidrogenasa, la glucosa deshidrogenasa, la D-aminoácido deshidrogenasa, la hidrogenasa, etc. como donadores de electrones de la CTE. Al igual que la NDH2, estas deshidrogenasas no bombean protones al espacio intermembranal y transfieren sus electrones a la poza de quinonas, que en el caso de bacterias puede ser ubiquinona, menaquinona o dimetilmenaquinona, dependiendo del potencial redox de los sustratos y de la oxigenación del medio (Rosas- Lemus, 2016). En las cadenas ramificadas bacterianas, existen diferentes tipos de oxidasas terminales: las citocromo c oxidasas (tipo I) y las quinol oxidasas (tipo II). Las oxidasas tipo I, reciben los electrones del citocromo c soluble y reducen el oxígeno a agua; pueden ser tipo IA, como el complejo IV y tener hemos a (aa3 o caa3) y cobre tipo IB y tener hemos b u o. Las oxidasas de tipo II o quinol oxidasas reciben electrones del XIX ubiquinol y los transfieren directamente al oxígeno. Estas pueden tener hemos a, b u o con cobre (IIA) o hemos b y d (IIB) (Anraku, 1988). Las oxidasas terminales de las cadenas ramificadas se expresan dependiendo la concentración de oxígeno del medio. E. coli, que no tiene complejo III ni complejo IV (Trumpower, 1990), bajo diferentes condiciones aeróbicas usa dos quinol oxidasas terminales: citocromos bo en medios oxigenados y citocromos bd cuando la tensión de oxígeno baja (Figura 2) (Anraku, 1987). Además de las oxidasas terminales (con citocromos) existen las oxidasas alternas (AOX). Estas enzimas toman electrones del ubiquinol y los transfieren directamente al oxígeno (Storey, 1976). Las AOX están compuestas por una sola cadena polipeptídica de ~40 kDa localizada del lado de la matriz mitocondrial o el citoplasma bacteriano (Cabrera-Orefice y cols., 2014). Esta enzima no contribuye a la formación de un potencial transmembranal y es codificada en genoma nuclear (Cabrera-Orefice y cols., 2014; Stenmark y cols., 2003). La respiración de la oxidasa alterna es insensible a inhibidores de los complejos III y IV (Tabla 2), pero es inhibida por alquilgalatos y derivados del ácido hidroxámico (Schonbaum y cols., 1971). En medios aeróbicos, las oxidasas terminales tienen preferencia por el oxígeno como aceptor terminal. Sin embargo, en medios anaeróbicos en donde no hay oxígeno, se pueden utilizar nitratos, nitritos, fierro, óxidos de azufre, dióxido de carbono, fumarato, etc. como el aceptor final de electrones (Anraku, 1988; Zannoni, 2008). Tabla 2. Componentes de la cadena respiratoria clásica de mamífero, levadura y bacteria. Especie T/M Peso molec. (kDa) Grupos prostéti- cos Inhibidores Referencias C I Mamífero (BHM) 43/7 1000 FMN/ 7(Fe-S) Rotenona, amital, piericidina A (Carroll y cols., 2003; Degli Esposti, 1998; Walker, 1992; Zhu y cols., 2016) Y. lipolytica 42/7 960 (Kerscher y cols., 2001; Zickermann y cols., 2015) E. coli T. thermophilus, P. denitrificans 13-14 550 (Sazanov, 2015; Sazanov y cols., 2006; Stolpe y cols., 2004; Zickermann y cols., 2000) XX C I I Mamífero (BHM) 4 123 FAD/ 3(Fe- S)/hemo tipo b Malonato, carboxina. (Hagerhall, 1997; Sun y cols., 2005; Wittig y cols., 2010) S. cerevisiae 4 120 (Hagerhall, 1997) E. coli 4 360 (T) (Cecchini, 2003; Yankovskaya y cols., 2003) C I II Mamífero (BHM) 11/1 482 (D) 2 hemos tipo b (bH-bL)/ 1 hemo c1 y 1 Fe-S Antimicina A, mixotiazol, estigmatelina (Iwata y cols., 1998; Trumpower, 1990; Wittig y cols., 2010; Xia y cols., 1997; Zhang y cols., 1998) Y. lipolytica S. cerevisiae 9/1 10/1 458 (D) 533 (D) (Lange y cols., 2002; Smith y cols., 2012; Solmaz y cols., 2008) P. denitrificans 3 122 (M) (Yang y cols., 1986) C I V Mamífero (BHM) 13/3 205 (M) - Cianuro, CO, NO, NO2 (Tsukihara y cols., 1996) Y. lipolytica S. cerevisiae 11/3 11/3 189 (M) 190 (M) (Capaldi, 1990; Geier y cols., 1995; Mason y cols., 1973) P. denitrificans 4 130(M) (Iwata, 1998; Schagger, 2002) C V Mamífero (BHM) 16/2 597 (M) Oligomicina (Jonckheere y cols., 2012; Watt y cols., 2010) Y. lipolytica S. cerevisiae 16/2 16/2 543 (M) 600 (M) (Bakhtiari y cols., 1999; Davies y cols., 2012; Jonckheere y cols., 2012; Robinson y cols., 2013) P. denitrificans 9 530 (M) (Garcia-Trejo y cols., 2016; Jonckheere y cols., 2012; Morales- Rios y cols., 2010; Morales-Rios y cols., 2015; Schagger, 2002; Zarco-Zavala y cols., 2014) Abreviaciones: T/M, Subunidades totales/ subunidades codificadas en el genoma mitocondrial; (M), monómero; (D), dímero; (T), trímero; FMN, flavín mononucleótido; FAD, flavín adenin dinucleótido; CO, monóxido de carbono; NO, monóxido de nitrógeno; NO2, dióxido de nitrógeno. BHM (Mitocondria de corazón de bovino), Y. lipolytica (Yarrowia lipolytica), E. coli (Escherichia coli), T. thermophilus (Thermus thermophilus), P. denitrificans (Paracoccus denitrificans), S. cerevisiae (Saccharomyces cerevisiae). XXI 3.5 Cultivo de endosimbiontes/endoparásitos en hospederos artificiales La construcción de ecosistemas artificiales análogos a relaciones simbióticas se han propuesto como modelos para estudiar la ecología y evolución de las simbiosis (Hosoda y cols., 2011b; Momeni y cols., 2011), construir sistemas endosimbionte/hospedero que faciliten la producción de compuestos útiles industrialmente (Brenner y cols., 2008; Mee y cols., 2012) y como hospederos de bacterias no cultivables como Treponema pallidum, el agente causal del sífilis (Stewart, 2012). La diferencia entre un microorganismo obligado y un facultativo se define por su capacidad de crecer fuera de una célula huésped. Algunos endosimbiontes obligados se cultivan en animales infectados, y cuando se necesita cosechar, el animal muere y la bacteria se recupera. En algunos casos específicos, las bacterias se pueden alojar dentro de animales parasitados por filarias o directamente en moscas o mosquitos (artrópodos) que necesitan alimento con sangre. A pesar de que este tipo de cultivo es lo más cercano a la realidad, el cultivo de bacterias en animales ha traído muchos problemas éticos, además de altos costos de mantenimiento, bajos rendimientos bacterianos y altos riesgos de contaminación. A la fecha, muchas de las investigaciones de endosimbiontes se realizan en líneas celulares, donde no se sacrifican animales. Las líneas celulares también ofrecen la ventaja de que la variabilidad biológica es mínima en comparación con los animales, y las líneas celulares infectadas con endosimbiontes pueden almacenarse en nitrógeno líquido. Lamentablemente, las líneas celulares son sensibles a los cambios de temperatura, las concentraciones de oxígeno en la atmósfera, requieren medios suplementados costosos y una gran cantidad de material plástico desechable. Las líneas celulares tienen bajos rendimientos de biomasa en comparación con las bacterias o levaduras de vida libre, lo que significa que los rendimientos son aún más bajos. 3.5.1 Bacterias endosimbiontes de hongos En los últimos años, el número de bacterias endosimbiontes ya sea mutualistas, comensales o parásitas encontradas en hongos ha aumentado notablemente; sin embargo, existen pocos estudios sobre la relación que puedan tener. Los casos más reportados de bacterias endosimbiontes son Helicobacter pylori como endosimbionte/endoparásito de Candida sp. (Bjorkholm y cols., 2000; Dubois y cols., 2007; Salmanian y cols., 2008; Saniee y cols., 2013a; Siavoshi y cols., 2005b; XXII Zendehdel y cols., 2005) y Burkholderia sp como endosimbionte de Rhizopus (Partida- Martinez y cols., 2005). 3.5.1.1 Helicobacter pylori como endosimbionte/endoparásito de Candida sp Helicobacter pylori es una bacteria Gram negativa que coloniza la mucosa del estómago y se multiplica en los macrófagos y las células epiteliales y dendríticas. Dado que la bacteria se considera un factor importante en enfermedades como gastritis, úlcera péptica, adenocarcinoma y linfoma MALT, su infección y mecanismos patogénicos han sido ampliamente estudiados (Dubois y cols., 2007; Lamarque y cols., 2003; Montecucco y cols., 2001; Siavoshi y cols., 2005a). Se han amplificado fragmentos de los genes específicos 16S rRNA, cagA, ahpC, vacA y ureAB de H. pylori, a partir de colonias de Candida sp aisladas de exudados faríngeos tomados de pacientes con úlcera gástrica y resultado positivo en la prueba bioquímica de la ureasa (Salmanian y cols., 2008; Saniee y cols., 2013a; Saniee y cols., 2013b; Siavoshi y cols., 2005b). El cultivo ex-vivo de H. pylori requiere una gran cantidad de suplementos, mientras que Candida sp es fácil de cultivar en condiciones de laboratorio. Si la bacteria persiste en cultivos de Candida en condiciones de laboratorio, se pueden cultivar grandes cantidades de bacterias. 3.5.1.2 Burkholderia sp como endosimbionte/endoparásito de Rhizopus microsporus Un caso de una endosimbiosis mutualista bacteria-hongo es el de la bacteria Burkholderia sp que vive en el citoplasma del hongo Rhizopus microsporus (Partida- Martinez y cols., 2005) que es un parásito de las plantas de arroz. En este caso, la bacteria se encarga de sintetizar una toxina llamada rizoxina con la que facilita el parasitismo de la planta de arroz por Rhizopus. La rizoxina se une a la β-tubulina de las células de la planta de arroz inhibiendo la mitosis y deteniendo el ciclo celular. El tratamiento de la planta con el antibacteriano ciprofloxacina elimina a la bacteria e inhibe la producción de la toxina30. Si la planta es infectada por una cepa de Rhizopus carente de Brukholderia, no se observa el fenotipo infectado en la planta de arroz. Sorprendentemente, Rhizopus microsporus es insensible a la rizoxina, lo que sugiere que ha habido una co-evolución de estos organismos para lograr parasitar a un tercero que les dará sustento (Partida-Martinez y cols., 2007a; Partida-Martinez y cols., 2005; Partida-Martinez y cols., 2007b). XXIII 4. Planteamiento del problema Las enfermedades transmitidas por vectores han sido poco estudiadas porque en su mayoría afectan países de tercer mundo. Estas enfermedades incluyen entre otras, a las ocasionadas por los virus del dengue, de la fiebre amarilla, del zika y del chikungunya que son transmitidas por moquitos del género Aedes. Como resultado del cambio climático y la facilidad de desplazamiento en el planeta, las enfermedades transmitidas por vectores están aumentando su cobertura mundial, lo que ha provocado un aumento en gastos médicos y una inversión en las estrategias para combatir dichas enfermedades. Las tres principales propuestas para erradicar estas enfermedades incluyen la creación de vacunas; la exterminación de los vectores con insecticidas, que podría causar un desequilibrio ecológico; y la posibilidad de infectar a los vectores con Wolbachia y evitar que los patógenos puedan colonizarlos. A pesar de se han liberado mosquitos infectados con Wolbachia en diferentes regiones del mundo, no existe una legislación sobre el proceso. Sin embargo, los mecanismos de infección y permanencia de la bacteria en los hospederos permanecen desconocidos. Esto se debe a que Wolbachia no crece en medios axénicos. Wolbachia se cultiva en nemátodos que infectan conejos o en líneas celulares. Ambos cultivos son caros, difíciles de mantener y de bajo rendimiento. Siguiendo el ejemplo de el cultivo axénico de Coxiella, estudiar los genomas reportados de Wolbachia podría ayudarnos a generar un medio de cultivo axénico constituido por elementos que sean especialmente requeridos por esta bacteria. Es decir si esta bacteria carece de las vías de síntesis de aminoácidos, se agregan estos al medio. Además los medios pueden suplementarse con elementos aerotolerantes y se pueden incubar los cultivos en atmósferas con bajas concentraciones de oxígeno para simular la atmosfera intracelular. Otra opción para aumentar la biomasa de Wolbachia es hacer cambios de hospedero a otras líneas celulares que crezcan mejor como la C6/C36 o a otro hospedero ya sea en huevos fecundados de pollo, que es la manera en que se crece Rickettsia o en hongos y levaduras como se ha sugerido recientemente. Estudiar a Wolbachia nos facilitará el diseño de estrategias científicas viables para controlar las viremias y nos permitirá anticipar las repercusiones sobre el medio ambiente, lo que hace aún más urgente el estudio de esta bacteria. Estudiar la interacción con su hospedero y cultivando a Wolbachia en mayores cantidades nos permitirá observar sí, como ha sido sugerido por varios grupos de XXIV investigación, Wolbachia puede donarle ATP a su hospedero sustituyendo o suplementando la actividad de la mitocondria o si únicamente, y similar al SOPE, suplementa la actividad mitocondrial, ya sea mediante el control de la expresión mitocondrial en fases anormales del crecimiento o bien al donarle riboflavina o grupos hemo, como otros grupos han sugerido. XXV 5. Hipótesis Si Wolbachia emula las funciones de la mitocondria y es capaz de crecer y multiplicarse en el interior de un hospedero modificando el patrón de fosforilación oxidativa del sistema, debe de tener un metabolismo aerobio propio o bien debe manipular la fosforilación oxidativa del hospedero. 6. Objetivos Determinar la actividad respiratoria de Wolbachia y estudiar sus efectos sobre el metabolismo aerobio del hospedero. 6.1 Objetivos particulares  Optimizar el cultivo de Wolbachia pipientis ya sea en cultivos axénicos o cambiando el hospedero a una levadura.  Estudiar la actividad respiratoria de S. cerevisiae en levaduras infectadas con Wolbachia pipientis.  Determinar si Wolbachia posee una cadena respiratoria. XXVI 7. Materiales y métodos 7.1 Reactivos Los reactivos ácido etilendiaminotetracético (EDTA), glucosa-6-fosfato, gliceraldehído- 3- fosfato, glicerol, piruvato, malato, succinato, citocromo c de corazón de caballo, NAD+, NADH, NADPH, ATP, n-dodecil β-D-maltósido, cloruro de azul de nitrotetrazolio (NBT), fluoruro de fenilmetilsulfonilo (PMSF), desoxicolato de sodio, ditionita de sodio, dodecil sulfato de sodio (SDS), trizma base, medio mínimo de Eagles, penicilina-estreptomicina, aminoácidos y vitaminas para MEM, L-glutamina, glucosa, perlas de vidrio, HEPES, trietanolamina, manitol, ácido 2-(N- morfolino)etanosulfónico (MES), CCCP, rotenona y antimicina A se adquirieron de Sigma Chem. Co (St. Luis Missouri, EUA). El etanol, sulfato de magnesio, cianuro de potasio, carbonato de potasio, hidróxido de potasio, cloruro de potasio, fosfato de sodio, bicarbonato de sodio y ácido succínico se adquirieron de JT Baker (Center Valley, PA, EUA). El 3,3′-hidrato de tetracloruro de diaminobenzidina (DAB) se adquirió de Fluka (Buchs, Switzerland). El persulfato de amonio, la glicina, la acrilamida y la bis N,N´- metilen-bis-acrilamida se adquirieron de BioRad (California, EUA). El imidazol y el ácido amino-caproico se adquirieron de MP (Santa Ana, CA, EUA). El sulfato de amonio se adquirió de Merck (Darmstadt, Germany); la triptona se adquirió de Difco (Franklin Lakes, NJ, EUA); y la peptona se adquirió de Bioxon (Edo de México, México). El PCR Master mix (2X) se adquirió de Thermo Scientific (Waltham, MA, EUA). La Taq polimerasa utilizada fue de Fermentas (adquirida por Thermo Scientific, Waltham, MA, EUA). La leche en polvo sin grasa se adquirió de Santa Cruz Biotechnology (Dallas, Texas, EUA). El suero bovino fetal (SBF) se adquirió de Biowest (Riverside – MO, EUA). El citrato férrico y el hidróxido de sodio fueron de Meyer (Vallejo, CA, EUA). El azul de Coomassie G se adquirió en Serva (Heidelberg, Alemania). 7.2 Anticuerpos Primarios Los anticuerpos Anti-wsp (Proteína de superficie de Wolbachia) monoclonales producidos in vitro en ratón, NR-31029 fueron donado por BEI Resources, NIAID, NIH. La dilución empleada fue de 1:1000 en TBS-T (Tris 50 mM, NaCl 150 mM, Tween 20 0.1%, pH 7.4). Los anticuerpos Anti-VDAC monoclonales producidos en XXVII ratón fueron comprados a Jackson Immunoreasearch (West Grove, PA, EUA). La dilución empleada fue 1:1000 en TBS-T. 7.2.1 Anticuerpos Secundarios Los anticuerpos secundarios anti-IgG de ratón acoplados a peroxidasa de rábano fueron de Jackson ImmunoResearch (West Grove, PA, EUA) y se empleó en una dilución 1:10,000 en TBS-T. 7.3 Material Biológico La línea celular Aa23 (Aedes albopictus infectada con la cepa de Wolbachia wAlbB (O'Neill y cols., 1997)) fue donada por la Dra. Ann Fallon de la Universidad de Minnesota, EUA. Las cepas de Saccharomyces cerevisiae utilizadas en este trabajo fueron: BY4741 (ScBY) (MATa; his3 Δ1; leu2 Δ0; met15 Δ0; ura3 Δ); W303 (ScW303) (MATα; ura3-1; trp1Δ 2; leu2-3,112; his3-11,15; ade2-1; can1-100), donada por el Dr. Michel Rigoulet, del Institut de Biochimie et Génétique Cellulaires (IBGC), Université Victor Segalen; Bordeaux 2, Bordeaux, Francia. La cepa W303 rho0 (ScW303 rho0) (MATα; ura3-1; trp1Δ 2; leu2-3,112; his3-11,15; ade2-1; can1-100; rho0) donada por el Dr. Gabriel del Río, del Departamento de Bioquímica y Biología Estructural del Instituto de Fisiología Celular, UNAM. Las cepas 273-10B (MATα; leu2, arg8::hisG, ura3-52; leu2-3,112) y 273-10B rho0 fueron donadas por la Dra. Xóchitl Pérez Martínez, del Departamento de Genética Molecular del Instituto de Fisiología Celular, UNAM. La línea celular C6/C36 fue donada por el Dr. Cuauhtémoc Juan Humberto Lanz Mendoza del Instituto Nacional de Salud Pública, Cuernavaca, Morelos, México. Las mitocondrias de corazón de bovino (BHM) fueron donadas por la Dra. Marietta Tuena Sangri del Departamento de Bioquímica y Biología Estructural del Instituto de Fisiología Celular, UNAM. 7.4 Mantenimiento y cultivo de las líneas celulares Aa23 y C6/C36 Las líneas celulares se cultivaron en medio mínimo de Eagle (MEM) de Sigma Chemical Co (M0643) complementado con aminoácidos no esenciales, L-glutamina, vitaminas, D-glucosa, antibióticos y bicarbonato de sodio (Shih y cols., 1998), pH 6.8 (HCl o NaOH). Los medios se esterilizaron por filtración (Millipore, 0.22 μm) y se XXVIII guardaron en alícuotas de 200 mL a 4°C. Previamente a ser utilizados, el medio se descongeló y se agregó 10% de suero bovino fetal (SBF) inactivado (30 min a 56°C) (Shih y cols., 1998). Las líneas celulares se cultivaron en cajas Petri True Line TR 4003 de 150 mm a 27°C en una atmósfera de 5% de CO2 (incubadora de cultivos celulares ESCO). Las líneas se resembraron con una dilución de 1:10 cada vez que se alcanzaba el 100% de confluencia. La cantidad de células se cuantificó con azul de tripano 0.4% (1:1) en una cámara de Neubauer. Las células vivas no se tiñen, mientras que las células cuya membrana está dañada se tiñen de azul. Alícuotas de las líneas celulares concentradas a 1 x 108 células/mL se mantuvieron a -80°C en MEM adicionado con 20% SBF y 40% DMSO estéril. El glicerol, comúnmente utilizado para congelar la levadura, no mantiene las líneas celulares viables. Para resembrar las células a partir de una alícuota en congelación, deben descongelarse en agua tibia y colocarse en un frasco de Roux con MEM y SBF al 20%. Después de 5 horas de incubación a 27°C en una atmosfera de 5% CO2, el medio debe cambiarse, ya que el DMSO puede ser tóxico (Scientific, 2017). Al principio del proyecto no se tenía incubadora de CO2, por lo que se adicionó 20 mM de HEPES y se disminuyó la concentración de bicarbonato de sodio del 0.22% al 0.085% para evitar la alcalinización del medio. El MEM tiene rojo neutro como colorante: en un medio alcalino se torna morado, mientras que en un medio ácido se torna amarillo. El pH ideal se mantiene entre color naranja y anaranjado. Para transportar las líneas celulares, deben resembrarse 1:2 en un frasco de Roux de 25 cm2 de tapa no ventada. Las células se incuban a 27°C por un día en MEM, 20% SBF. Al día siguiente se adiciona un volumen de MEM, 5% SBF que llene el frasco, se cierra, se sella con parafilm y está listo para transportarse. Se reduce la cantidad de SBF para limitar el crecimiento de la línea celular. 7.4.1 Aa23Δw: Eliminación de Wolbachia de la línea celular Aa23 Wolbachia se eliminó de la línea celular Aa23 mediante pases seriales utilizando 10 μg/mL de tetraciclina (Dobson y cols., 2002) en el medio de cultivo Eagles. Los pases de la línea celular se realizaban cada semana en un volumen final de 6 mL (caja petri de 60 mm de diámetro) y se incubaban igual que la línea celular Aa23. A partir del décimo pase el cultivo se considera libre de Wolbachia. La eliminación de Wolbachia se confirmó por PCR y Western blot. Para realizar experimentos con esta línea celular, se XXIX debe eliminar la tetraciclina por dos pases por lo menos, ya que este antibiótico afecta el metabolismo de la célula (Ballard y cols., 2007). 7.5 Infección de Saccharomyces cerevisiae con Wolbachia extraída de la línea celular Aa23 Se infectaron diferentes cepas de la levadura Saccharomyces cerevisiae con Wolbachia extraída a partir de la línea celular Aa23. Todos los procedimientos se realizaron en esterilidad y a temperatura ambiente. La línea celular Aa23 se cultivó en frascos de Roux (Corning, 225cm2) en medio Mínimo de Eagle (MEM) complementado con 10% SBF durante 20 días a 27°C y una atmósfera de 5% CO2. Las células se resuspendieron manualmente y se centrifugaron a 3,000 x g por 5 minutos. El paquete celular (1 x 107 células) se resuspendió en 10 mL de MEM con perlas de borosilicato estériles de 0.710- 3 mm y se lisó agitando en el vórtex por 10 minutos. El lisado se centrifugó a 3,000 x g por 5 min para remover las células intactas. El sobrenandante se filtró por una membrana de 2.7 μm y se centrifugó a 16,500 x g por 10 minutos (Rasgon y cols., 2006). El botón se resuspendió en medio Mitsuhashi-Maramorosch (MM) (Dale y cols., 1999) suplementado con 20% SBF (MMS) y se agregó directamente a un botón de la levadura deseada cultivada en 50 mL de YPD durante 3 horas, a 250 rpm, 30°C. La levadura se concentró por centrifugación a 3,000 x g por 3 min (aprox. 60 mg). El botón de levadura se resuspendió con la bacteria y se centrifugó a 700 xg durante una hora a temperatura ambiente para favorecer el contacto entre la bacteria y la levadura(Noda y cols., 2002). El botón se resuspendió en el mismo medio, se plaqueó en MMFeS adicionado con 2% agar y 25% de eritrocitos de humano (MMSS) y se incubó a 27°C en una atmósfera de 5% CO2 por 14 días. Posteriormente la levadura infectada se pasó a cajas de YPD suplementadas con 1 mM citrato de amonio férrico. La levadura se congeló en MM con 20% SBF y 40% glicerol y se mantuvo a -80°C. 7.5.1 Infección de Saccharomyces cerevisiae con Wolbachia extraída de levadura Se cultivó la levadura infectada con Wolbachia en cajas Petri de 245 mm en MMSS (sólido) a 27°C en una atmosfera de 5% CO2 por 14 días. Las células se concentraron a 3,000 xg por 5 minutos, se lavaron 2 veces con agua destilada y se resuspendieron en MM. Las células se lisaron con perlas de borosilicato de 0.5-3 mm; se centrifugaron a 3,000 xg por 10 minutos, el botón se filtró a través de membranas de XXX 0.8, 0.65 y 0.45 μm, y se centrifugó a 16,500 x g por 10 minutos. El botón se resuspendió en 2 mL de MMSS y se agregó a un botón de S. cerevisiae previamente incubado por 3 horas en YPD, 250 rpm, 30°C. El protocolo de infección continuó como el indicado en el inciso anterior (7.5). El MM puede sustituirse por YPD y Wolbachia es incapaz de mantenerse en la levadura si el medio no está adicionado con al menos 1% SBF. Se usaron paquetes de sangre caduca donados por el Instituto Nacional de Cardiología. El paquete de eritrocitos de humano se obtuvo centrifugando la sangre a 3,000 x g por 2 minutos. 7.6 Mantenimiento de diferentes cepas de Saccharomyces cerevisiae infectadas con Wolbachia Las diferentes cepas de S. cerevisiae infectadas con Wolbachia se mantuvieron en cajas de YPD con 2% de agar a temperatura ambiente en una atmosfera de 5% de CO2. El inóculo de las cepas infectadas se realizó en un mL de YPD, 1 mM citrato férrico amoniacal y 20% de suero bovino fetal. La levadura infectada se resembró cada mes agregando 2 mL de YPD adicionado con 20% SBF. La infección es estable entre 4 y 6 meses. Para un litro de medio MMSS se utilizaban 200 mL de SBF y 250 mL de paquete de eritrocitos humanos, lo que elevaba el costo de los cultivos. Se redujo la cantidad de SBF a 10, 5 y 1% gradualmente. Los medios no suplementados con SBF no mantienen el crecimiento de Wolbachia. Se agregó al medio 1 mM de Citrato Férrico amoniacal, este no debe exceder de 4 mM ya que es tóxico. 7.7 Cultivo de Saccharomyces cerevisiae en medio líquido (infectadas y no infectadas con Wolbachia) Los precultivos se sembraron a partir de una asada del cultivo sólido (YPD con 2% agar) en 100 mL de YPDS (YPD , 1% SBF, 1 mM citrato férrico amoniacal) estéril y se incubaron a 30°C, 130 rpm por 48 horas. Los precultivos se trasvasaron a un litro (1:10) de YPDS que se incubó a 30°C, 130 rpm por 14 días. 7.8 Comprobación de la presencia de Wolbachia en los diferentes tipos celulares Una vez cultivada la línea celular y las distintas cepas de S. cerevisiae la presencia de la bacteria se monitoreó siguiendo los siguientes protocolos: XXXI 7.8.1 Confirmación de la presencia de Wolbachia por PCR del gen wsp Para obtener una mejor amplificación de los fragmentos del gen wsp a partir de las líneas celulares y de los cultivos de levadura, se obtuvo el DNA de Wolbachia de la siguiente manera: Se concentraron el equivalente a 50 mL de wScW303 y por lo menos 1 x 108 células (línea de insecto Aa23). Éstas se resuspendieron en buffer SPG (Sacarosa 218 mM, KH2PO4 3.8 mM, K2HPO4 7.2 mM, L-glutamato 4.9 mM, pH 7.2) y se rompieron en el vórtex utilizando perlas de 0.5 mm para la levadura o 3 mm para la línea celular. Se realizaron dos ciclos de 5 minutos. Posteriormente se centrifugaron a 3,000 xg 5 min. para eliminar las células intactas. Se incubaron durante 30 minutos a 37°C con 30 μg/mL de DNAsa para remover el DNA del hospedero. La bacteria se concentró a 16,000 x g durante 5 minutos y se lavó dos veces en buffer SPG para remover la DNAsa (Iturbe-Ormaetxe y cols., 2011). Las muestras se calentaron durante 5 minutos a 95°C para inactivar cualquier DNAsa remanente. Finalmente se extrajo el DNA utilizando el Quick-gDNA MiniPrep (Zymo Research, D3025) siguiendo las instrucciones del proveedor. Se utilizaron los oligonucleótidos para la proteína de superficie de Wolbachia sp: wsp81f (5´ TGGTCCAATAAGTGATGAAGAAAC 3´) y wsp691r (5´ AAAAATTAAACGCTACTCCA 3´) (Zhou y cols., 1998). El fragmento se amplificó usando una Taq polimerasa (Fermentas/Thermoscientific) bajo las siguientes condiciones: un ciclo de desnaturalización inicial a 94°C por 2 minutos; 30 ciclos de desnaturalización a 94°C por un minuto, hibridación a 52°C un minuto y extensión a 72°C un minuto; un ciclo de extensión final a 72°C por 5 minutos. Se cargaron las muestras en un gel de agarosa al 1% y se corrieron a 90 mV en medio TAE (1 lt de TAE 50X: se prepara con 242 g de Tris base, 18.61 g de EDTA, 57.1 mL de ácido acético glacial y se afora a un litro con agua destilada) en una cámara de electroforesis de BIO- RAD hasta que el frente de corrida alcanzara el final del gel Se utilizaron 3 μL de la escalera 1 Kb plus (Invitrogen) como marcador de pesos moleculares. Se tiñó con bromuro de etidio. La banda debe corresponder aproximadamente a 590-632 pb dependiendo de la especie (Zhou y cols., 1998). Los productos de PCR se purificaron utilizando el GeneJET PCR Purification kit, (ThermoScientific), se resuspendieron en agua libre de DNAsas y RNAsas y se secuenciaron en la unidad de Biología Molecular del Instituto de Fisiología Celular, UNAM. XXXII 7.8.2 Western Blot para la proteína wsp Se resuspendió una asada de levadura a partir de medio sólido en 200 μL de agua, o se tomaron directamente 200 μL de muestra de cultivo y se centrifugaron a 3,000 x g por 5 minutos. Se lavó dos veces y se solubilizó con 200 μL de buffer RIPA (Tris•HCl 25 mM pH 7.6, NaCl 150 mM, nonidet P40 1%, deoxicolato de sodio 1%, SDS 0.1%) suplementado con el inhibidor de proteasas complete 1X y PMSF 1 mM. Las muestras se sonicaron en un sonicador Sonics VibraCell a 80% de amplitud por 10 segundos y se agitaron 30 minutos a 4°C. Las muestras se centrifugaron a 12,700 x g por 5 min. Se recuperó la fracción soluble y se cuantificó la concentración de proteína por el método de Bradford en un PolarStar Omega (BMGlabtech) (ver Sección 7.13.2). Se agregó buffer de carga a la muestra (Buffer de carga 3X, ver sección 7.19) y se calculó el volumen necesario para aplicar 20-30μg de proteína por carril. Las muestras deben hervirse durante 5 minutos antes de cargarse en el gel (ver Sección 7.8.2.1). Se realizó una SDS/PAGE en un gel de poliacrilamida al 10% y se corrió a 100 mV en buffer de corrida. Las proteínas del gel se transfirieron a una membrana de fluoruro de polivinilideno (PVDF) previamente activada en metanol y lavada en buffer de transferencia (fosfato de potasio 25 mM, fosfato de sodio 25 mM, Tris 12 mM, glicina 192 mM, ajustado a pH 7.0) con 20% metanol, por 10 min. Las membranas se bloquearon con 5% de leche en polvo sin grasa Blotto en TBS-T por 1 h, y se dejaron incubando toda la noche a 4°C con el anticuerpo primario anti-wsp. Las membranas se lavaron con TBS-T tres veces por 5 minutos y se incubaron a 37°C por 1 h con el anticuerpo secundario de ratón. Las membranas se lavaron tres veces por 10 minutos con TBS-T con un kit de quimioluminiscencia ECL (Chiquete-Felix y cols., 2009). 7.8.2.1 Geles para SDS-PAGE Para cada gel SDS-PAGE al 10% se prepararon 10 mL de la siguiente solución: 4 mL de agua destilada, 3.3 mL de acrilamida/bisacrilamida al 30%/1%, 2.5 mL de Tris 1.5 M pH 8.8, 0.1 mL de SDS 10%, 0.1 mL de persulfato de amonio 10% y 0.004 mL de TEMED (Laemmli, 1970; Schägger, 1994). La solución se agitó y se vertió en medio de los vidrios previamente montados. Se agregó 1 mL de etanol lentamente para que la superficie quedara uniforme. Después de polimerizado (aprox. 15 min.), se retiró el etanol y se agregó la solución concentradora previamente preparada. Se agregó para 3 mL de volumen final, 2.1 mL de agua destilada, 0.5 mL de acrilamida/bisacrilamida al XXXIII 30%/1%, 3.8 mL de Tris 1 M pH 6.8, 0.03 mL de SDS 10%, 0.03 mL de persulfato de amonio 10% y 0.003 mL de TEMED previamente mezclados en un tubo Falcon. Preparación de las soluciones necesarias para los geles SDS-PAGE: Tris/HCl 1.5 M pH 8.8. Para 100 mL, se disolvieron 18.15 g de Tris en 50 mL de agua destilada. Se ajustó el pH a 8.8 con HCl y se aforó a 100 mL. Tris/HCl 1 M pH 6.8. Para 100 mL, se disolvieron 12.1 g de Tris en 50 mL de agua destilada. Se ajustó pH a 8.8 con HCl y se aforó a 100 mL. Acrilamida/bisacrilamida 30%/1%. Para 100 mL, se disolvieron 29.2 g de acrilamida y 0.8 g de bisacrilamida en 100 mL de agua destilada. La acrilamida es neurotóxica por lo que se usaron guantes de nitrilo durante toda la manipulación. Persulfato de amonio 10%: Para 5 mL se disolvieron 0.5 g de persulfato de amonio en agua destilada y se alicuotaron en volúmenes de 1 mL. Esta solución se guardó en congelación. Buffer de muestra 3X: Para 10 mL se pesaron 0.36 mL de Tris/HCl 1M pH 6.8 (36 mM), 3 mL de glicerol 50%, 1.2 mL de SDS 10%, 0.3 mL de -mercaptoetanol, 0.06% de azul de bromofenol y se aforó con 5.14 mL de agua destilada. Buffer de corrida: Para 1 litro 10X, se pesaron 30 g de Tris, 144 g de glicina, 10 g de SDS y se aforó a un litro. Tabla 3. Soluciones para preparar los geles SDS-PAGE (Laemmli, 1970; Schägger, 1994) Gel separador 5ml 10 ml 15 ml 20 ml 25ml 30 ml 40 ml 50 ml 6% H2O 2.6 5.3 7.9 10.6 13.2 15.9 21.2 26.5 Acril/bisacril 30%/1% 1 2 3 4 5 6 8 10 Tris 1.5 M pH 8.8 1.3 2.5 3.8 5 6.3 7.5 10 12.5 SDS 10% 0.05 0.1 0.15 0.2 0.25 0.3 0.4 0.5 APS 10% 0.05 0.1 0.15 0.2 0.25 0.3 0.4 0.5 TEMED 0.004 0.008 0.012 0.016 0.02 0.024 0.032 0.04 8% H2O 2.3 4.6 6.9 9.3 11.5 13.9 18.5 23.2 Acril/bisacril 30%/1% 1.3 2.7 4 5.3 6.7 8 10.7 13.3 Tris 1.5 M pH 8.8 1.3 2.5 3.8 5 6.3 7.5 10 12.5 SDS 10% 0.05 0.1 0.15 0.2 0.25 0.3 0.4 0.5 APS 10% 0.05 0.1 0.15 0.2 0.25 0.3 0.4 0.5 TEMED 0.002 0.004 0.006 0.008 0.01 0.012 0.016 0.02 XXXIV 10% H2O 1.9 4 5.9 7.9 9.9 11.9 15.9 19.8 Acril/bisacril 30%/1% 1.7 3.3 5 6.7 8.3 10 13.3 16.7 Tris 1.5 M pH 8.8 1.3 2.5 3.8 5 6.3 7.5 10 12.5 SDS 10% 0.05 0.1 0.15 0.2 0.25 0.3 0.4 0.5 APS 10% 0.05 0.1 0.15 0.2 0.25 0.3 0.4 0.5 TEMED 0.002 0.004 0.006 0.008 0.01 0.012 0.016 0.02 12% H2O 1.6 3.3 4.9 6.6 8.2 9.9 13.2 16.5 Acril/bisacril 30%/1% 2 4 6 8 10 12 16 20 Tris 1.5 M pH 8.8 1.3 2.5 3.8 5 6.3 7.5 10 12.5 SDS 10% 0.05 0.1 0.15 0.2 0.25 0.3 0.4 0.5 APS 10% 0.05 0.1 0.15 0.2 0.25 0.3 0.4 0.5 TEMED 0.002 0.004 0.006 0.008 0.01 0.012 0.016 0.02 15% H2O 1.1 2.3 3.4 4.6 5.7 6.9 9.2 11.5 Acril/bisacril 30%/1% 2.5 5 7.5 10 12.5 15 20 25 Tris 1.5 M pH 8.8 1.3 2.5 3.8 5 6.3 7.5 10 12.5 SDS 10% 0.05 0.1 0.15 0.2 0.25 0.3 0.4 0.5 APS 10% 0.05 0.1 0.15 0.2 0.25 0.3 0.4 0.5 TEMED 0.002 0.004 0.006 0.008 0.01 0.012 0.016 0.02 Gel concentrador (5%) 1 ml 2ml 3 ml 4 ml 5 ml 6 ml 8 ml 10 ml H2O 0.68 1.4 2.1 2.7 3.4 4.1 5.5 6.8 Acril/bisacril 30%/1% 0.17 0.33 0.5 0.67 0.83 1 1.3 1.7 Tris 1 M pH 6.8 0.13 0.25 0.38 0.5 0.68 0.75 1 1.25 SDS 10% 0.01 0.02 0.03 0.04 0.05 0.06 0.08 0.1 APS 10% 0.01 0.02 0.03 0.04 0.05 0.06 0.08 0.1 TEMED 0.00 1 0.002 0.003 0.004 0.005 0.006 0.008 0.01 7.8.2.2 Western Blot para VDAC Los extractos, los geles y la transferencia se realizaron de la misma manera que en la sección 7.8.2. La cantidad de anticuerpos primarios y secundarios se ajustó según lo recomendado por los proveedores, reportado en la sección 7.2. Para poder utilizar varios anticuerpos en una misma membrana y poder estandarizar los datos, se desnudaron (eliminar los anticuerpos) y se re-probaron las membranas. 7.8.2.3 Desnudar y reutilizar membranas Las membranas se desnudaron y se reutilizaron de acuerdo con el protocolo de Abcam. En resumen, las membranas se lavaron tres veces de 5 a 10 minutos a temperatura ambiente con buffer de desnudamiento (glicina 1.5%, SDS 0.1%, Tween 20 1%, pH XXXV 2.2). Posteriormente se realizaron dos lavados de 10 minutos con PBS y dos lavados de 5 minutos con TBS-T. Las membranas sin anticuerpos se bloquearon de nuevo (1 h con leche en polvo sin grasa) antes de agregar el nuevo anticuerpo primario. 7.8.3 Hibridación in-situ con sondas fluorescentes Wolbachia se visualizó utilizando sondas específicas de oligonucleótidos diseñadas contra el gen 16S rDNA marcadas con Quasar 670 (Abs 647 nm, Em 670 nm) : W1, 5´- AATCCGGCCGARCCGACCC-3´ (Heddi y cols., 1999). Un mililitro del cultivo de levadura se centrifugó a 3,000 x g por 5 minutos. Para las líneas celulares se ajustó la concentración a 1 x 106 células/mL y se lavaron dos veces con PBS. Las células se resuspendieron en 3% de p-formaldehído en PBS y se incubaron una hora a 4°C. Las muestras se lavaron tres veces con PBS y se mantuvieron a 4°C para su posterior hibridación. En caso de hacer la hibridación en un portaobjetos, se colocó una alícuota (10 μL) de las muestras en portaobjetos y se dejó secar entre 24 y 48 horas. Los portaobjetos estaban recubiertos de poli-L-lisina. La muestra se esparció en el portaobjetos tratando de hacer una monocapa, si estaba muy concentrada no podía observarse correctamente. Después de fijar las muestras, se deshidrataron durante 3 minutos con etanol 50%, 80% y 90% consecutivamente. Se agregaron 50 μL de cada sonda (30 ng/μl) en buffer de hibridación (NaCl 0.9 M, formamida 35%, Tris-HCl 20 mM, pH 8, triton X-100 al 0.01%) y se incubó 2 horas en un cuarto obscuro a 46°C. Las muestras se lavaron dos veces durante 15 minutos con Tris-HCl 20 mM, NaCl 70 mM, EDTA 5 mM pH 8 y tritón X-100 al 0.01% en un cuarto obscuro a 48°C (Genty y cols., 2014). Las muestras se observaron en un microscopio confocal Olympus FV-10000 con una potencia del 5% de láser (rojo). Quasar 670 es un fluoróforo cuyos máximos de emisión/excitación se encuentran a 640/670 nm respectivamente. 7.9 Tinción de las levaduras con calcoflúor y FISH Después de hibridar las muestras con la sonda 16S rDNA marcada con Quasar 670, las muestras se tiñeron con 0.05 mM de calcoflúor en DMSO-20% y bicina 20 mM. El espectro de excitación/emisión del calcoflúor se encuentra en 380-440/500-520 nm respectivamente. El calcoflúor se une al quitosano de la pared celular de la levadura. Se realizaron cortes en Z de las muestras en un microscopio Olympus-FV1000 o FV-3000. Las imágenes se reconstruyeron usando el software Imaris 7.2.1 e Image J. XXXVI 7.10 Microscopía Electrónica de Transmisión Se colectaron las células a partir de 500 μL de cultivos de levadura infectada y control a 14 días, y se tomó una pequeña muestra del aislado de Wolbachia. Las células de levadura se lavaron dos veces en agua destilada a 3,000 x g por 5 min, mientras que la muestra de bacteria aislada se lavó a 16,000 x g por 5 min y se trataron de acuerdo a (Sun y cols., 2015). Las muestras se fijaron en 2% de KMnO4 a 4°C durante toda la noche. Al día siguiente se lavaron durante 15 minutos con agua desionizada 6 veces y se deshidrataron con lavados secuenciales de 10 minutos con etanol 50%, 70%, 80%, 90% y tres lavados con etanol 100%. Posteriormente la muestra se lavó con etanol-acetona (1:1) durante 8 minutos, después con acetona anhidra durante 5 minutos, después con acetona-EPON 821 (3:1) durante 1 hora y se dejaron en acetona -EPON 821 (1:3) toda la noche. Al siguiente día, las muestras se concentraron y se resuspendieron en acetona - EPON 821 (1:1) durante 1 hora. Las muestras se concentraron de nuevo y se dejaron en la resina pura durante 24 horas. Después de este período, se incubaron durante 12 horas a 37°C y después por 36 horas a 60°C. Las muestras se cortaron a 70 nm en un ultra- microtomo (Ultracut Reicheit-jung) y se observaron en un microscopio electrónico de transmisión JEOL JEM-1200 EXII . Las fotografías se procesaron utilizando el Software Gatan Digital Micrograph. Ningún protocolo que implicara la fijación de las levaduras con p-formaldehído o glutaraldehído permitió la clara observación de las mitocondrias y las bacterias. 7.11 RT-qPCR Se tomaron 0.5 mL de muestra de cultivos de levadura a diferentes días. La muestra se concentró a 3,000 x g por 5 min y se lavó dos veces en agua destilada libre de RNAsas y DNAsas. Se obtuvo el RNA de la muestra utilizando el kit Quick-RNA MiniPrep Kit (Zymo Research). El cDNA de sintetizó a partir de 1 μL de RNA con el kit Revert Aid First Strand cDNA (ThermoFischer). El qPCR para el gen wsp de Wolbachia se realizó de acuerdo con (Tortosa y cols., 2008): 50 ng de cDNA se corrieron con 0.5 μM de cada oligonucleótido utilizando 2X SYBR Green PCR Master Mix en un termociclador BioRad CFX96 Real- Time System. Los oligonucleótidos utilizados fueron específicos para wAlbB: 183F (5´- AAGGAACCGAAGTTCATG-3´) y QBrev2 (5´-AGTTGTGAGTAAAGTCCC-3´). El programa del termociclador incluía un paso de desnaturalización inicial de 10 minutos a XXXVII 95°C para activar la enzima; 40 ciclos de 15 s a 95°C, 1 min a 60°C y 30 s a 72°C (Zouache y cols., 2012). Para el gen 18S rRNA de S. cerevisiae se siguió el siguiente protocolo (Lu y cols., 2003): 50 ng de cDNA se corrieron con 0.3 μM de cada oligonucleótido en presencia de 2X SYBR Green PCR Master Mix en un termociclador BioRad CFX96 Real-Time System. Los oligonucleótidos empleados fueron: 18f (5´- CGGCTACCACATCCAAGGAA-3´) y 18r (5´-GCTGGAATTACCGCGGCT-3´). El programa incluye un paso a 95°C por 10 minutos, 40 pasos a 95°C por 15 s y 60°C por un minuto. Se corrieron duplicados de tres experimentos independientes. Todos los oligonucleótidos fueron sintetizados por Sigma-Aldrich Co (Saint Louis, MO). El cambio de fluorescencia del SYBR Green I Dye de cada ciclo se monitoreó en el software y se utilizó el Cq para calcular el número de transcritos de Wolbachia wsp y de S. cerevisiae. El kit 2X SYBR Green PCR Master Mix posee una enzima que necesita un ciclo de 10 minutos a 95°C para evitar que los oligonucleótidos dimericen. 7.12 PCR para el gen 5.8S rDNA de levadura De las diferentes cepas de levadura se extrajo el DNA con el kit quick-gDNA mini- prep, Zymo Research. Se utilizaron los siguientes oligonucleótidos específicos ITS1 (5´ TCCGTAGGTGAACCTGCGG 3´) y ITS4 (5´ TCCTCCGCTTATTGATATGC 3´) (White, 1990). El fragmento se amplificó usando Taq polimerasa (Fermentas/Thermo Scientific) bajo las siguientes condiciones: un ciclo de desnaturalización inicial a 94°C por 5 minutos; 40 ciclos desnaturalización a 94°C por un minuto, hibridación a 52°C por 2 minutos y extensión a 72°C por 2 minutos; un ciclo de extensión final a 72°C por 10 minutos. Se corrieron las muestras en un gel de agarosa al 1% usando el marcador 1Kb plus (Invitrogen), teñido con bromuro de etidio. La banda debe pesar aproximadamente 800 pb para S. cerevisiae (White, 1990). El producto de PCR se purificó (GeneJET PCR Purification kit, ThermoScientific), se resuspendió en agua y se secuenció en la unidad de Biología Molecular del Instituto de Fisiología Celular, UNAM. 7.13 Determinación de proteína Para determinar la cantidad de proteína presente se utilizaron dos métodos: XXXVIII 7.13.1 Determinación de proteína por Biuret La concentración de proteína de una muestra de células o de mitocondrias se determinó por medio del método de Biuret (Gornall y cols., 1949). Para prepara el reactivo de Biuret se prepara la solución A: 100 mL de solución de CuSO4 al 17.3% en agua caliente; y la solución B: 17.3 g de citrato sódico y 100 g de Na2CO3 disueltos en 800 mL de agua caliente. Posteriormente se mezclan las soluciones y se guardan en obscuridad. En un tubo de vidrio se añaden 62.5 μL de desoxicolato de sodio 5%, 175 μL de agua, un mL de solución de Biuret y 12.5 μL de la suspensión de mitocondrias o células. El cambio de absorbancia se determinó a 540 nm en un espectrofotómetro Beckman DU-50. El cambio en la absorbancia se debe a que la interacción del ion Cu2+ con los enlaces peptídicos de la proteínas genera una coloración violeta, proporcional a la concentración de la proteína en la muestra. 7.13.2 Determinación de proteína por Bradford La concentración de proteína de una muestra de células lisadas o de un extracto proteico se determinó por el método de Bradford. A diferencia del método de Biuret, este método no posee ningún agente para solubilizar las membranas celulares como el desoxicolato de sodio. Las determinaciones se realizaron en placas de Elisa de 96 pozos. Primero, se realizó una curva patrón de 0, 2, 3, 4 y 6 g de proteína utilizando un patrón de 1mg/ml de -globulina y se llevó a un volumen final de 20 L. En los siguientes pozos se adicionaron 2.5-5L de la muestra problema y se llevó a un volumen final de 20 L. Después se adicionaron 180 L de reactivo de Bradford (1:5). Se incubó la placa 15 minutos a temperatura ambiente y se leyó la absorbancia a 590 nm en un PolarStar Omega (BMG labtech) (Bradford, 1976). Se obtuvieron los valores de proteína de las muestras haciendo una regresión lineal de la curva patrón. 7.14 Curvas de crecimiento de Saccharomyces cerevisiae W303 y BY4741 Se sembraron precultivos de 48 horas de Saccharomyces cerevisiae en 30 mL de YPD (2%) o YPgal (2%), agitando a 130 rpm. Se determinó la densidad óptica del cultivo y se resembró en 100 mL a una densidad óptica final de 0.05 aproximadamente. Los medios se incubaron a 28°C, 130 rpm. Se determinó la absorbancia a 600 nm con un espectrofotómetro Beckman DU-50. Se utilizó la cepa BY4741 como control, porque en comparación con la cepa W303, presenta una fase diáuxica más clara. XXXIX 7.15 Viabilidad celular La viabilidad de la línea celular Aa23 y de las levaduras se evaluó usando el kit BacLight live-dead staining (Molecular Probes, Carlsbad, CA), que utiliza fluoróforos para distinguir la integridad de las membranas: el SYTO9 (verde) se une al DNA de todas las células tiñéndolas de verde mientras que el yoduro de propidio (rojo) únicamente tiñe aquellas que tengan las membranas dañadas. Por lo tanto, todas las células vivas aparecen verdes mientras que las muertas adquieren una coloración roja. A 10 μL de una suspensión celular se le agregaron 0.5 μL de SYTO9/IP preparado como indica el fabricante. Las células se visualizaron con un microscopio de epifluorescencia NIKON. El porcentaje de células vivas equivale a 100- (células muertas rojas/ total de células verdes). Filtro B-3A-Verde, excitación (420/490), emisión 520. Filtro G-2A- Rojo, excitación (535±50), emisión 590. 7.16 Ensayos de fermentación en levaduras Se realizaron los precultivos y cultivos como se describió en la sección 7.7. A las 6, 8 y 10 horas se tomó una muestra de 5 mL del cultivo y se centrifugó a 3,000 x g por 5 minutos. Las células se resuspendieron a un volumen final de 50%. Se incubaron 0.5 mL de células en 1 mL de MES-TEA 0.1 M pH 6.0, 0.2 mL de glucosa 1 M y 2 mM de cianuro en un volumen final de 10 mL (completar con agua destilada). Las muestras se incubaron 10 minutos en agitación a 30°C. Se centrifugaron 30 s a 10,000 xg y se guardó el sobrenadante tapado y congelado. La concentración de etanol se cuantificó con un ensayo acoplado a alcohol deshidrogenasa siguiendo la reducción del NAD+ a 340 nm en un espectrofotómetro Aminco-Olis. La reacción se lleva a cabo en 2 mL de volumen final que contienen 0.2 mL de buffer de pirofosfato de sodio 0.1 M pH 9.0, 0.1 ml de NAD+ (20 mg/mL), 0.1 mL de muestra y 1.8 mL de agua. La mezcla de reacción se agregó a la celda y se tomó el punto inicial (A1). Después se adicionaron 10 μL de alcohol deshidrogenasa (30 mg/mL) y se agitó durante 10-15 min. Se registró la absorbancia A2. Los cálculos se realizan como reglas de tres con la DO de una curva estándar de etanol. Como controles se cuantificaron blancos sin muestra. XL 7.16.1 Consumo de glucosa Se realizaron precultivos y cultivos como está descrito en la sección 7.7. Se tomaron muestras de 1 mL a diferentes horas de cultivo y se centrifugaron a 3,000 x g por 5 minutos. Se separó el sobrenadante y se mantuvo en congelación a -80°C. Las muestras se descongelaron en hielo y la concentración de glucosa en el medio se cuantificó con un kit D-Glucose HK Assay Kit de Megzyme. 7.17 Aislamiento de la fracción mitocondrial Después de cultivar las levaduras, se lavaron con agua destilada dos veces por centrifugación a 3,000 x g por 5 minutos y se resuspendieron en medio de extracción (Manitol 0.6 M, MES 5 mM, pH 6.8 ajustado con TEA). Se homogenizaron empleando un homogenizador (Bead beater Biospec Products) en una camisa de hielo y perlas de vidrio de 0.5 mm mediante tres pulsos de 20 segundos, con intervalos de 40 s de descanso (Gutierrez-Aguilar y cols., 2014). Posteriormente las mitocondrias se aislaron por centrifugación diferencial (Pena y cols., 1977) a 4°C utilizando una centrífuga Beckman con un rotor JA 25.5. Las muestras se centrifugaron, a 3,000 x g por 5 min para eliminar las células intactas; después el sobrenadante se centrifugó a 10,900 x g por 10 min. El botón de todos los tubos, ligeramente rojizo, se resuspendió en medio de extracción con un pincel y se concentró en un solo tubo hasta llegar a ¾ partes del volumen. Se centrifugó de nuevo a 5,000 rpm por 5 min y finalmente el sobrenadante se centrifugó a 12,000 rpm por 10 minutos. El sobrenadante se desechó y el botón se resuspendió en el sobrante de medio del tubo (700 μL). 7.18 Mediciones del consumo de oxígeno 7.18.1 Oximetría de fracción mitocondrial de S. cerevisiae La concentración de oxígeno se cuantificó con un OROBOROS (Innsbruck, Austria) con un electrodo tipo Clark inmerso en una cámara de 1.5 mL con agitación a 750 rpm y 30°C. El experimento se llevó a cabo en el medio de respiración (MES 5 mM, manitol 0.6 M, ácido fosfórico 4 mM pH 6.8, KCl 10 mM, pH 6.8). Se utilizó una concentración de células de 0.5 mg/mL. Dependiendo del experimento, se añadió una concentración de 2 mM de diferentes sustratos respiratorios: NADH, etanol, succinato, glicerol-3-fosfato, piruvato-malato, glutamato. Todos los sustratos se ajustaron a un pH de 7.4-7.6. El estado fosforilante (estado III) se estimuló añadiendo ADP 400 M. Para inducir un estado desacoplado se añadió 6 M CCCP. Como inhibidores de los diferentes XLI complejos respiratorios se utilizaron para complejo I, rotenona 0.1 μM en DMSO; para NADH deshidrogenasas alternas 20 mM flavona; para complejo III, 0.1 μM Antimicina A en DMSO; y para complejo IV, 1 mM cianuro de sodio. Los valores de control respiratorio (CR) se obtuvieron calculando el cociente de la velocidad del consumo de oxígeno en estado III sobre estado IV utilizando etanol como sustrato. El análisis de los datos se realizó con el software DatLab Oroboros. 7.18.2 Actividad de la citocromo c oxidasa La cuantificación de la actividad de la citocromo c oxidasa se realizó en las mismas condiciones que los trazos de oximetría. El ensayo se realizó en presencia de 2 μM antimicina A para inhibir al complejo III. Como donador de electrones se adicionó ascorbato 5mM (pH 7.4)-TMPD 50 M. El ascorbato mantiene al TMPD en un estado reducido y esté último dona sus electrones al citocromo c soluble que es el sustrato del complejo IV. Al final del trazo se agregó 1 mM de cianuro de sodio. 7.18.3 Oximetría de la línea celular C6/C36 La respiración de la línea celular C6/C36 y wC6/C36 se cuantificó en un OROBOROS con un electrodo tipo Clark inmerso en una cámara de 1.5 mL con agitación a 750 rpm y 28°C. La reacción se llevó a cabo en un medio de respiración para líneas celulares (manitol 75 mM, sacarosa 25 mM, KCl 100 mM, KH2PO4 10 mM, MgCl2 5 mM, Tris- HCl 20 mM, pH 7.4). Las líneas celulares se incubaron 20 días, se despegaron por agitación, se cuantificaron en una cámara de Neubauer y se utilizaron 5 millones de células por cámara. Las células se resuspendieron en el medio de respiración para líneas celulares y se permeabilizaron con digitonina al 0.025% y se agregó citocromo c 10 μM y ADP 2 mM. Se añadió al trazo NADH 2 mM, rotenona (DMSO) 0.1 M, succinato 2 mM, Antimicina A (DMSO) 2 μM, Ascorbato 5mM (pH 7.4), TMPD (Tetrametil- fenilen-81 diamina) 50 M y cianuro de sodio 1 mM. El análisis de los datos se realizó con el software DatLab Oroboros. 7.19 Electroforesis en geles Nativos Se realizó la electroforesis en geles de poliacrilamida (PAGE) (Wittig y cols., 2006) para separar y analizar las proteínas de la membrana de las mitocondrias y de Wolbachia. La electroforesis en geles nativos separa proteínas entre 10 kDa, hasta 10 MDa. En la electroforesis nativa las proteínas retienen su actividad enzimática, sus XLII estados oligoméricos y las interacciones proteína-proteína. Existen tres tipos de geles nativos: nativos azules (BN-PAGE), nativos claros (CN-PAGE) y nativos claros de alta resolución (hrCN-PAGE). Para hacer una BN-PAGE se utiliza azul de Coomassie (Serva-blue G-250) en el amortiguador del cátodo y en la muestra. El azul de Coomassie se une a las proteínas de membrana confiriendo una carga negativa y provocando que las proteínas migren hacia el ánodo, evitando la formación de bandas barridas. La migración de las proteínas queda en función de su peso molecular. En la CN-PAGE, las proteínas migran de acuerdo con su peso molecular y su carga intrínseca, por lo que no se puede calcular el peso molecular de las proteínas, sin embargo, este tipo de electroforesis nos permite ver las interacciones proteína-proteína que no se mantienen en la BN-PAGE. La hrCN-PAGE tiene desoxicolato de sodio en el amortiguador del cátodo por lo que las proteínas migraran con carga de manera similar a los obtenidos en la BN-PAGE, con mayor resolución que los CN-PAGE y sin la coloración conferida por el azul de Coomassie de los BN-PAGE. 7.19.1 Preparación de los geles Se realizó un gel en gradiente de acrilamida del 4 al 12%. Para poder secuenciar las bandas, todos los buffers y los geles se prepararon con agua miliQ (MilliQBiocell) y se utilizaron guantes para evitar contaminación por queratina. Para un gel de 13.3 x 8.7 cm de Biorad con 1.5 mm de espesor se necesita: Tabla 4. Preparación de geles de gradiente BN o hrCN-PAGE Acrilamida H 12% Acrilamida L 4% Concentrador Solución AB 1.11 mL 0.39 mL 0.25 Amortiguador 3X 1.50 mL 1.50 mL 1 Glicerol 80% 1.14 mL 0.29 mL - Agua destilada 0.73 mL 2.30 mL 1.74 TEMED* 4.4μL 4.4μL 4.5μL Persulfato de amonio 10%* 12μL 12μL 16μL Volumen final 4.5 4.5 3.02 * Se añaden al final. XLIII Solución AB: acrilamida al 48.5% y bis-acrilamida al 1.5% Amortiguador 3X nativo: ácido -aminocaproico 1.5 M, bis-Tris150 mM/imidazol 75 mM, pH 7.0 (ajustado con HCl) Glicerol al 80% Persulfato de amonio al 10% Para un gel de 20 x 18 cm se consideraron 18.57 mL de cada solución. La mezcla de acrilamida H se agregó en el contenedor más cercano a la salida del gradientero y la acrilamida L se agregó en el contenedor lejano a la salida del gradientero. El agitador mecánico se colocó en el lado de la acrilamida H. El agitador se colocó en velocidad 4. El TEMED y el persulfato de amonio de agregaron a cada contenedor y se abrió primero la válvula que comunica ambos compartimentos (con agitación) y después se abrió la válvula de salida. Al terminar el vaciado de los contenedores, se agregó etanol a la superficie del gel y se esperó a que polimerizara. Cada gel se realizó por separado. Finalmente se agregó la mezcla de gel concentrador en la parte superior y se dejó polimerizar con el peine necesario. Dependiendo del tipo de gel son los amortiguadores necesarios. 7.19.2 Amortiguadores para BN-PAGE  Amortiguador de cátodo para BN (1): tricina 50 mM, bis-Tris 15 mM (o imidazol 7.5 mM), azul de Coomassie de Serva 0.02%  Amortiguador de cátodo para BN (2): tricina 50 mM, bis-Tris 15 mM (o imidazol 7.5 mM), azul de Coomassie de Serva 0.002%  Amortiguador de ánodo: bis-Tris 50 mM (o imidazol 25 mM), pH 7.0 (ajustado con HCl). Durante la corrida se utilizó primero el amortiguador BN(1) y cuando las muestras iban a la mitad del gel, se cambió por el amortiguador BN(2). 7.19.3 Amortiguadores para hrCN-PAGE  Amortiguador del cátodo para CN: tricina 50 mM, imidazol 7.5 mM (ó bis-Tris 15 mM).  Amortiguador del cátodo para hrCN: tricina 50 mM, imidazol 7.5 mM (ó bis- Tris 15 mM), laurilmaltósido 0.01%, desoxicolato de sodio 0.05%. XLIV  Amortiguador el ánodo: imidazol 25 mM (ó bis-Tris 50 mM, pH 7.0 ajustado con HCl). A diferencia de los geles azules, en los geles claros, las proteínas migran según su peso molecular y su carga intrínseca. Se prefieren los geles CN cuando las interacciones proteína-proteína son más débiles y no pueden observarse en un gel BN. Los geles claros nativos de alta resolución (hrCN) son similares a los BN ya que al darle una carga negativa al amortiguador del cátodo con el desoxicolato, las proteínas migran de acuerdo con su peso molecular. Las ventajas de estos geles sobre los BN pueden apreciarse al medir actividades enzimáticas; al no tener un tono azulado, las actividades se observan más claras. 7.19.4 Preparación de muestras y corrida de los geles Para los tres tipos de electroforesis nativas, las mitocondrias se solubilizaron con laurilmaltósido (LM) (2g / mg de proteína) para poder analizar los complejos mitocondriales individuales. A diferencia de la digitonina (4g / mg de proteína), el LM tiene una mayor capacidad de remover lípidos, por lo que elimina las interacciones entre complejos. El detergente se disolvió en amortiguador de muestra (ácido ε-aminocaproico 750 mM, bis-Tris 50 mM / imidazol 25 mM pH 7.0 ajustado con HCl). Después de agregar la cantidad de detergente correspondiente, las muestras se incubaron en agitación en el cuarto frío durante 30 minutos y se centrifugaron a 17,500 rpm durante 75 minutos, o 100,000 x g durante 20 minutos. Se colectó el sobrenadante en un tubo limpio y se cuantificó la proteína por Bradford. Dependiendo del tamaño del gel y de la concentración de proteína se varío la cantidad de volumen de muestra a cargar para evitar la transferencia de muestras entre pozos. Para un gel grande se cargó un máximo de 200 l de volumen, mientras que para un gel chico se cargó un máximo de 80 l. Para preparar una muestra para gel BN-PAGE, se agregó 1μl de solución de azul de Coomassie (Serva Blue-G250) al 5% en amortiguador de muestra por cada 100 μl de muestra. Una vez preparada la muestra se cargó en los geles y se corrió a un amperaje constante de 30 mA por gel a 4°C. XLV 7.20 Actividades en gel Se utilizaron los geles nativos (BN, CN y hrCN-PAGE) para identificar bandas que presentaran actividad enzimática. Las determinaciones permiten distinguir cambios cualitativos en la cantidad de los complejos cuando provienen de diferentes condiciones. 7.20.1 NADH deshidrogenasa La actividad de NADH deshidrogenasa se determinó utilizando bromuro de nitro-azul de tetrazolio o NBT que se precipita y cambia de coloración amarilla a morada al reducirse. Se utiliza para detectar actividad de complejo I, supercomplejos que tengan complejo I o NADH deshidrogenasas alternas. Para detectar la actividad se incubó el gel en un volumen de 15-30 mL (que cubriera completamente el gel) de amortiguador Tris 10 mM pH 7.0 con una concentración final de NADH de 1 mM y de 0.5mg/mL de NBT (60 mg NBT disueltos en 2.8 mL de formamida y 1.2 mL de agua) en agitación a temperatura ambiente. La actividad es visible después de 30 min. En caso de que el gel fuera BN, se destiñó después de detectar la actividad con una solución acético-metanol 1:1. Si el gel se pone en contacto con la solución desteñidora antes, la actividad desaparece. 7.20.2 Succinato deshidrogenasa Esta tinción utiliza el mismo principio que el empleado para la NADH deshidrogenasa. En vez de utilizar NADH como sustrato se utilizó succinato a una concentración final de 5 mM (pH 6.8). Esta tinción comienza a revelarse después de varias horas en agitación. 7.20.3 Citocromo c oxidasa La actividad de complejo IV se determinó utilizando 3´,5´-diaminobencidina (DAB) y citocromo c de corazón de caballo como donador de electrones. La forma oxidada de la diaminobencidina es color rojo; al oxidar al citocromo c y reducirse, se precipita y como una banda de color café. Para detectar la actividad se incubó el gel en un volumen de 15-30 mL (que cubriera completamente el gel) de amortiguador de fosfatos 50 mM pH 7.4 con 10 mg/mL de citocromo c y 20 mg/mL de DAB. La reacción tarda horas en ser detectada. XLVI 7.20.4 ATPasa La actividad de hidrólisis de ATP del complejo V se detectó mediante la aparición un precipitado de fosfato de plomo. El ATP agregado se hidroliza a ADP y Pi, el cual reacciona con el nitrato de plomo formando fosfato de plomo que forma un precipitado blanco. Para detectar la actividad, el gel se incubó durante una hora en un amortiguador de incubación (glicina 270 mM, Tris 35 mM pH 8.4). Después se cambió al amortiguador de actividad (glicina 270 mM, Tris 35 mM pH 8.4, MgSO4 14 mM, Pb(NO3)2 0.2%) y se añadió ATP 8 mM gota a gota. La reacción tarda aproximadamente media hora. En este caso, no es necesario que el complejo V se encuentre completamente ensamblado, por lo que se pueden observar muchas bandas. 7.21 Espectros diferenciales de los citocromos Se obtuvieron los espectros de absorción de las muestras de 500 a 630 nm usando el espectrofotómetro Clarity, Olis spectrofotometer a 20°C y 900 rpm. Se utilizaron muestras de 200 μL finales a una concentración de 15 mg/mL de extracto. La primera muestra se oxidó con persulfato de amonio, se incubó 30 segundos en agitación y se cuantificó la absorbancia. La segunda muestra se incubó sin agitación, con ditionita. Después de obtener ambos espectros, el espectro oxidado se restó del espectro reducido. El contenido de citocromos por mg de proteína se calculó utilizando los coeficientes de extinción molar. Para el citocromo a+a3 (Steffens y cols., 1987), ∆ε 604- 630 nm= 24 mM-1 cm-1; para el citocromo b (Berden y cols., 1970), ∆ε 563-577 nm = 28 mM-1 cm-1; y para el citocromo c+c1 (Green y cols., 1959), ∆ε 553-539 nm = 19.1 mM-1 cm-1. Concentración de citocromo (nmol/mg) = (Abs/0.8) / (Concentración de la muestra en mg/mL)(ε)(Volumen de la muestra). 7.22 Secuenciación de las bandas de proteína Las bandas indicadas de los geles hr-CN PAGE o BN-PAGE se cortaron, se digirieron con tripsina, se separaron en una columna de HPLC Ekspertnano LC 425 (Eksigent, Redwood City CA) y se analizaron en un espectrómetro de masas MALDI-TOF/TOF 4800 Plus (ABSciex, Framingham MA) (Shevchenko y cols., 2006) en la Unidad de Genómica, Proteómica y Metabolómica, del CINVESTAV-IPN. Los espectros MS/MS generados se compararon usando el software Protein Pilot v. 4.0 (ABSciex, Framingham MA) contra las bases de datos de Saccharomyces cerevisiae ATCC XLVII 204508 (Uniprot, 6721 secuencias de proteína) y de Wolbachia (Uniprot, 47781 secuencias de proteína) usando el algoritmo Paragon. 7.23 Separación de Wolbachia de la fracción mitocondrial 7.23.1 Aislamiento de Wolbachia por gradientes Se rompieron las células infectadas con Wolbachia por sonicación en buffer SPE (Baldridge y cols., 2014). Las bacterias se filtraron por membranas de 5 a 1.5 m y se centrifugaron 10 minutos a 16,000 xg. El paquete se resuspendió en SPE y se colocó en un gradiente de sacarosa del 60 a 30%. Las células se centrifugaron a 210,000 xg por 90 min. Las fracciones se separaron, se les agregó aproximadamente 30 mL de agua y se centrifugaron a 14,000 rpm para concentrar las fracciones. 7.23.2 Aislamiento de Wolbachia por incubación ex vivo El protocolo de aislamiento de Wolbachia se adaptó a partir de (Rasgon y cols., 2006). Un cultivo de 14 días de 100 mL de wScW303 se centrifugó a 3,000 xg durante 5 minutos. El botón se lavó dos veces con agua estéril y se lisó con perlas de borosilicato estériles de 0.425-0.6 mm durante dos ciclos de 5 minutos con intervalos de 5 minutos. El lisado se centrifugó a 3,000 xg a 4°C durante 7 min para remover las células que no se rompieron. El sobrenadante se transfirió a un tubo limpio y se centrifugó a 18,400 xg por 5 minutos. El botón se resuspendió en un mL de medio mínimo de Eagle, SBF al 20% y se centrifugó a 5,000 xg por 5 minutos. El sobrenadante se filtró a través de filtros de jeringa de 2.7, 0.8, 0.65 y 0.45 μm y se incubó hasta 7 días a 27°C en una atmosfera de 5% de CO2. Se agregaron 300 μg/mL de G418 para evitar el crecimiento de levaduras en el medio. Todos los procedimientos se realizaron en condiciones de esterilidad. Se empleo como control un cultivo de 14 días de S. cerevisiae cultivado en las mismas condiciones. 7.24 Hidrólisis de ATP en Wolbachia aislada Se detectó la cantidad de fosforo inorgánico presente en el medio siguiendo el método de (Dryer RL, 1956). Se agregaron 50 μg/mL de Wolbachia aislada cuantificada por Biuret a un buffer de succinato 2 mM, MgCl2 2.5 mM en 10 mM de HEPES pH 6.8 en un volumen final de 110 μL. Dónde se indica, se agregaron 3 μg/mL de oligomicina. Las muestras se incubaron 10 minutos para permitir la acción de la oligomicina. La XLVIII reacción se inició con 2.5 mM de ATP y se agitó 10 segundos en un vórtex. Las muestras se incubaron 15 minutos en agitación a 27°C, se centrifugaron 5 minutos a 14,000 rpm y se recuperaron 100 μL del sobrenadante. Estos se agregaron a una placa de Elisa junto con 41 μL de Molibdato de Amonio 25 mM y se incubó por 10 minutos en agitación a temperatura ambiente. Posteriormente se agregaron 41 μL de ELON y se incubó la placa durante 10 minutos en obscuridad. Se midió la absorbancia en un POLAR Star Omega a 530 nm. La concentración de fosfatos se calculó utilizando una curva estándar. 7.25 Infección de la línea celular C6/C36 Las línea celular C6/C36 se cultivó en medio mínimo de Eagle (MEM) de Sigma Chemical Co (M0643) suplementado con aminoácidos no esenciales, L-glutamina, vitaminas, D-glucosa, antibióticos y bicarbonato de sodio(Shih y cols., 1998), pH 6.8 (HCl o NaOH). Previamente a ser utilizado se agregó 10% de suero bovino fetal (SBF) inactivado (30 min a 56°C)(Shih y cols., 1998). Las líneas celulares se cultivaron en cajas de Petri True Line TR 4003 de 150 mm a 27°C en una atmósfera de 5% de CO2 (incubadora de cultivos celulares ESCO). La infección de la línea celular se realizó con la técnica de infección ¨Shell vial¨ descrita por (Dobson y cols., 2002). XLIX 8 RESULTADOS 8.1 Crecimiento, adaptación y transporte de la línea celular Aa23 La línea celular Aa23 infectada con la cepa wAlbB de Wolbachia pipientis fue donada por la Dra. Ann Fallon del Departamento de Entomología de la Universidad de Minnesota. La línea celular se mantuvo en MEM que contiene rojo de fenol como indicador de pH: el color del medio debe mantenerse (rojo) para que las células no se despeguen; si el medio presenta un color morado indica un medio alcalino, mientras que un medio amarillo indica un pH ácido y en ambos casos la viabilidad celular disminuye. Al principio del proyecto no teníamos incubadora de CO2 por lo que se adicionó al medio 20 mM de HEPES y se redujo la concentración de bicarbonato de sodio del 0.22% al 0.085%. La línea celular crece en monocapa y puede mantenerse en este estado hasta 60 días agregando medio fresco cada 30 días, ya que tiende a evaporarse. La línea celular no crece en agitación. Si se utiliza la incubadora con 5% CO2, la concentración de bicarbonato de sodio debe ajustarse. El rendimiento de la línea celular es de ~3 millones de células por frasco de Roux grande (225 cm2)/75 mL. Para despegar la línea celular hay tres opciones: la primera es agitando vigorosamente durante 15 segundos. En este caso, después de extraer las células, puede agregarse medio fresco al frasco de Roux y la línea celular crece de nuevo. También se puede despegar la línea celular con tripsina o despegándola mecánicamente con jaladores pequeños (scrappers), en estos casos el rendimiento es mayor, pero el cultivo no puede crecer de nuevo en la misma caja. 8.2 Infección por Wolbachia en la línea celular Aa23 Se comprobó la presencia de Wolbachia en la línea celular de Aedes albopictus Aa23 de tres maneras. La primera fue amplificando un fragmento del gen wsp de Wolbachia. (Figura 6a). La línea celular Aa23 amplifica un fragmento de ADN de aproximadamente 600-650 pb, mientras que la línea celular tratada con tetraciclina durante 9 pases (Aa23Tet) no amplifica dicho fragmento. La secuencia del fragmento amplificado se encuentra anotada en el Anexo A. El segundo método empleado para comprobar la infección de la línea celular fue hibridar el gen 16S rDNA de Wolbachia con una sonda marcada con Quasar 670 (Figura 6b). En dichas imágenes, se observan cúmulos de células Aa23 de L c aproximadamente 5 m con marcas de hibridación (rosa) que confirman la presencia de la bacteria. Figura 6. Infección de la línea celular Aa23 con Wolbachia. (a) El fragmento amplificado del gen wsp de Wolbachia pesa 650 pb. Carril 1, marcador 1kb plus (Invitrogen); carril 2, Aa23; carril 3, Aa23Tet. (b) Microscopía confocal de dos campos observados de la línea celular Aa23. En la primera columna se muestra la fluorescencia obtenida por la hibridación del gen 16S rRNA de Wolbachia con una sonda marcada con Quasar 670 (rosa); la segunda columna muestra el campo claro y la tercera es una sobreposición de las imágenes, donde se observa la sonda dentro de la línea celular. (c) Western blot contra la proteína wsp de Wolbachia: carril 1, pb a b - 37 kDa - 25 kDa LI Aa23; carril 2, Aa23Tet; línea 1, proteína wsp detectada a 37 kDa; línea 2, VDAC utilizado como control de carga detectado a 25 kDa. El tercer método para comprobar la infección con Wolbachia fue identificando la proteína wsp por Western Blot (Figura 6c). De acuerdo con el proveedor, el anticuerpo primario monoclonal contra la proteína wsp da una señal a 37 kDa. En la placa revelada se observa una banda en 37 kDa en la muestra de Aa23. Esta señal no se observó en la línea celular tratada con tetraciclina (Aa23Tet). Se utilizó como control de carga la proteína VDAC (Canal aniónico dependiente de voltaje) cuya señal se detecta a 25 kDa. El anticuerpo anti-wsp puede dar una banda inespecífica a 70 kDa. 8.3 Cultivo de Wolbachia en diversos medios Para aumentar el rendimiento de Wolbachia y dado que la línea celular Aa23 tiene un crecimiento limitado en la superficie donde se coloque, se intentó cultivar la bacteria ex-vivo. Se utilizaron como base medio corazón-cerebro (BHI), MEM y Mitsuhashi- Maramarosch adicionados con diferentes concentraciones de sustratos compatibles (trehalosa, sacarosa, manitol y glicerol), SBF, catalasa, eritrocitos, y se cultivaron a concentraciones bajas de oxígeno. También se intentó cultivar la bacteria en un medio con lisado de la línea celular y otro con lisado de Drosophila sin lograr incrementar de manera significativa la cantidad de biomasa y comprometiendo el monocultivo de Wolbachia en algunos casos. Previamente, (Rasgon y cols., 2006) reportaron que Wolbachia puede permanecer viva, infectiva y sin aumentar su biomasa en MEM suplementado con 20% SBF en una atmósfera de 5% CO2. Nosotros observamos que Wolbachia es capaz de sobrevivir en medio BHI y en Mitsuhashi-Maramarosch con 20% de eritrocitos y 20% de SBF en una atmósfera de 5% de CO2. Sin embargo, al no lograr un aumento de la biomasa bacteriana, ninguno de estos cultivos nos acercaba a nuestro objetivo. Otra opción para aumentar el rendimiento de la bacteria fue cambiarla a un hospedero artificial. Recientemente se han encontrado diversas alfa y gamma proteobacterias como endosimbiontes de amibas, hongos filamentosos y levaduriformes (Bianciotto y cols., 1996; Bianciotto y cols., 2002; de Boer y cols., 2004; Hoffman y cols., 2010; Kang y cols., 2009; Lumini y cols., 2007; Partida-Martinez y cols., 2005; Saniee y cols., 2013a; Sato y cols., 2010). Se ha propuesto utilizar a estos hongos como posibles hospederos alternos para el cultivo de endosimbiontes obligados (Hosoda y cols., 2011a; Hosoda y cols., 2011b; Momeni y cols., 2011). LII 8.4 Cultivo de Wolbachia como endosimbionte de la levadura Saccharomyces cerevisiae Decidimos infectar a la levadura no patógena S. cerevisiae, ya que es de fácil manejo y su manipulación genética es sencilla. Además S. cerevisiae es aerobia facultativa lo que, en caso de ser necesario, nos permitiría mantener al sistema en concentraciones bajas de oxígeno. A diferencia de BY4741, la cepa W303 posee una pared celular más débil que el resto de las cepas de S. cerevisiae (Aguilar-Uscanga y cols., 2003; Avrahami-Moyal y cols., 2012; Smith y cols., 2000) y tiene una alta resistencia a las especies reactivas de oxígeno, que aumentan en presencia de Wolbachia (Fallon y cols., 2013; Pan y cols., 2012). a b c d Figura 7. Infección de la cepas ScW303, ScBY y ScD273-10B con Wolbachia wAlbB de la línea celular Aa23. FISH utilizando una sonda específica contra el gen 16S rDNA de Quasar 670 Campo claro Quasar 670 Campo claro Quasar 670 Campo claro LIII Wolbachia marcada con Quasar 670 (rosa) en cultivos control (primera línea) e infectados (segunda línea) para (a) ScW303, (b) ScBY, (c) ScD273-10B e infectados (segunda línea) para (a) wScW303, (b) wScBY, (c) wScD273-10B). (d) Porcentaje de células infectadas considerando positivas aquellas con hibridación (marca rosa) contadas en un microscopio epifluorescente Olympus. Se infectaron las cepas ScW303, ScBY y ScD273-10B siguiendo el protocolo modificado de (Dobson y cols., 2002). Después de 14 días de cultivo en medio sólido, se realizó una hibridación in-situ utilizando una sonda contra el gen 16S rDNA de Wolbachia marcada con Quasar 670 y se observó que menos del 20% de las levaduras de la cepa wScBY presentaban marca de hibridación (Figura 7b, d). En comparación, en la cepa wScW303 se encontró marca en el 71.8 ± 8.7% (Figura 7a, d) de las células, mientras que wScNB40 presentó marca en el 52.3 ± 14.3% (Figura 7c,d). a b c Figura 8. Infección de la levadura S. cerevisiae con Wolbachia. (a) PCR del gen wsp de Wolbachia de una infección artificial en S. cerevisiae. Carril 1, marcador 1 kb plus (Invitrogen); - 37 kDa - 25 kDa pb LIV carril 2, ScW303; carril 3, wScW303 infectada. (b) Microscopía confocal de Saccharomyces cerevisiae W303 (ScW303) y de levadura Saccharomyces cerevisiae W303 infectada (wScW303). En la primera columna se muestra la fluorescencia obtenida por la hibridación del gen 16S rRNA de Wolbachia con una sonda marcada con Quasar 670 (rosa) y DAPI (azul); la segunda columna muestra el campo claro con óptica Nomarski (DIC) y la tercera es una sobreposición de las imágenes donde se observa la sonda dentro de la célula. La microscopía fue realizada en un microscopio confocal Leica en la UBIMED, FES Iztacala, UNAM. (c) Western Blot contra la proteína wsp de Wolbachia: carril 1, ScW303; carril 2, wScW303; línea 1, proteína wsp detectada a 37 kDa; línea 2, VDAC utilizado como control de carga detectado a 25 kDa. La infección de la cepa de S. cerevisiae W303 se analizó con los mismos métodos empleados para comprobar la infección de la línea celular Aa23 (Figura 6). El PCR (Figura 8a) del gen wsp de Wolbachia amplificó una banda similar a la obtenida de la línea celular Aa23. Las imágenes de microscopía confocal muestran la hibridación de la bacteria dentro de la levadura. Además al agregar DAPI y teñir el ADN dentro de la levadura se observó que a diferencia de los controles donde únicamente se tiñó el núcleo de la levadura, se tiñeron varios puntos dentro de la célula señalando el DNA bacteriano (Figura 8b). En el Western Blot contra la proteína wsp, la levadura infectada mostró una banda en 37 kDa (Figura 8c, wScW303). Esta señal no se observó en la levadura control (ScW303). Se utilizó como control de carga la proteína VDAC (Canal aniónico dependiente de voltaje) cuya señal se detecta a 25 kDa. El medio de cultivo empleado para infectar a la levadura fue Mitsuhashi- Maramarosch suplementado con 10% Suero Bovino Fetal. Una vez infectada, la levadura crecía en YPD con 1% SBF y 1 mM de citrato férrico amoniacal, y la infección se perdía al omitir dichos suplementos (Figura 9). LV Figura 9. La infección de Wolbachia en ScW303 depende de la correcta suplementación del medio. Microscopía confocal de la levadura Saccharomyces cerevisiae W303 infectada con Wolbachia (wScW303) cultivada en un medio sin Suero Bovino Fetal ni citrato férrico amoniacal a días 3, 7, 10 y 14. En la primera columna se muestra la fluorescencia obtenida por la hibridación del gen 16S rDNA de Wolbachia con una sonda marcada con Quasar 670; la segunda columna muestra el campo claro y la tercera es una sobreposición de las imágenes. Se utilizó como control negativo a ScW303 (sin infectar) de 14 días cultivada en medio YPD y como control positivo a wScW303 de 14 días cultivada en medio YPDS: YPD suplementado con 1% de Suero bovino fetal y 1 mM de citrato férrico amoniacal. El inoculo de los cultivos infectados (wScW303, líneas 1, 2, 3, 4 y 6) fue tomada de la misma caja petri, la diferencia radica en que no se agrego SBF y citrato férrico amoniacal a los precultivos y a los cultivos del cultivo de las líneas 1, 2, 3 y 4. LVI A pesar de que la cepa de levadura fue tomada del EuroScarf, se comprobó su identidad para descartar la contaminación por otra levadura (Figura 10). Se amplificó un segmento de del gen 5.8S rRNA. La secuencia del fragmento amplificado se encuentra en el Anexo 1 y el análisis por BLAST coincide con la secuencia de S. cerevisiae. Se utilizaron los mismos oligonucleótidos para amplificar el fragmento de 350 pb del gen 5.8S rRNA de Yarrowia lipolytica E129. Se utilizó esta levadura porque amplificaba un fragmento de diferente peso molecular al amplificado por S. cerevisiae. Se utilizó Escherichia coli DH5-α como control negativo ya que al ser un procarionte no posee los mismos genes ribosomales que una eucarionte. Figura 10. Comprobación de la identidad de S. cerevisiae. PCR del gen 5.8S rRNA de S. cerevisiae. Carril 1, marcador 1kb plus (Invitrogen); carril 2, ScW303; carril 3, wScW303, carril 4: Yarrowia lipolytica, Carril 5: Escherichia coli DH5-α. Con el fin de comprobar que Wolbachia se encontraba dentro de la levadura y no adherida a su pared celular, teñimos la pared de las levaduras ScW303 y wScW303 previamente fijadas e hibridadas con la sonda 16S rDNA con calcoflúor y la observamos en un microscopio confocal (Figura 11 y 12). El calcoflúor es un colorante que se une a la celulosa y a la quitina de la pared celular de las levaduras. Las bacterias no tienen estos componentes en sus membranas, por lo que no se tiñen con el calcoflúor. Se realizaron cortes en Z y al hacer una reconstrucción de las imágenes se observó a la bacteria dentro de la levadura (Figura 12, Películas S1 y S2). LVII w S cW 30 3 S cW 30 3 w S cW 30 3 S cW 30 3 Figura 11. La levadura wScW303 teñida con Calcoflúor e hibridada contra la sonda 16Sr DNA de Wolbachia. Microscopía confocal de Saccharomyces cerevisiae W303 (ScW303) y S. cerevisiae W303 infectada (wScW303) hibridadas con la sonda 16S rDNA de Wolbachia y teñida con calcoflúor. En la primera columna se observa la pared celular de la levadura teñida con calcoflúor. En la segunda columna la fluorescencia obtenida por la hibridación del gen 16S Calcoflúor Quasar 670 Campo claro Calcoflúor /Quasar 670 Calcoflúor/Quasar 670/ Campo claro LVIII rDNA de Wolbachia con una sonda marcada con Quasar 670. En la tercera columna se muestra el campo claro. Las siguientes columnas muestran la sobreposición de las imágenes de calcoflúor con Quasar 670 y calcoflúor con Quasar 670 y campo claro. Figura 12. Reconstrucción de los cortes en Z de la levadura wScW303 teñida con Calcoflúor e hibridada contra la sonda 16Sr DNA de Wolbachia. Imágenes tomadas de las películas S1 y S2 que muestran la reconstrucción de los cortes en Z obtenidos por microscopía confocal de S. cerevisiae W303 infectada con Wolbachia (wScW303) hibridada con la sonda 16S rDNA de Wolbachia y teñida con calcoflúor. Observamos la presencia de los cuerpos bacterianos en la levadura infectada por microscopía electrónica de transmisión (Figura 13). En cultivos de 14 días, las levaduras control ScW303 (Figura 13a), tienen una membrana intacta pero sin organelos LIX distinguibles; es decir, perdieron la mayoría de las estructuras mitocondriales probablemente porque las células se encuentran en fase estacionaria tardía. Figura 13. Microscopía Electrónica de Transmisión de ScW303 y wScW303. Las imágenes de microscopía electrónica de transmisión confirman la ubicación intracelular de cuerpos parecidos a bacterias. Se tomaron imágenes de cultivos de 14 días con (a) ScW303 y (b-d) wScW303. Las imágenes muestran la presencia de cuerpos similares a bacterias (BLB: Bacteria- like-bodies) (*) que no están presentes en las levaduras control (a) y mitocondrias (m) cuyas crestas se pueden identificar fácilmente. En cambio, la levadura wScW303 mostró otra morfología. En la mayoría de las células, (ej. 13b) la membrana estaba intacta y podían observarse mitocondrias (M) y cuerpos bacterianos (*) dentro de la levadura. Esta tinción nos permite observar las crestas mitocondriales permitiéndonos apreciar la diferencia entre las mitocondrias y las bacterias. Otras levaduras en la muestra wScW303 exhibieron membranas dañadas (ej. Figura 13c), conservando parcialmente las estructuras similares a las bacterias. La flecha en la figura 13c señala uno de los cuerpos bacterianos cuya membrana está dañada. Finalmente, encontramos algunas levaduras gemando, en las que se observan LX los cuerpos bacterianos en la gema (Figura 13d). Esta población no apareció en los cultivos de la levadura control (Figura 13a). No podemos asegurar que sean bacterias aún, para esto necesitaríamos realizar una inmunotinción con oro acoplado a un anticuerpo primario contra Wolbachia. Además de la ausencia de estos cuerpos en las levaduras control, podemos comparar la morfología de las bacterias con la reportada por otros autores y son muy parecidas (Figura 1, Figura 13). Figura 14. Acercamientos de fotografías tomada por Microscopía Electrónica de Transmisión de wScW303. Se emplearon cultivos de 14 días con wScW303. Las imágenes muestran acercamientos de cuerpos similares a bacterias y mitocondrias cuyas crestas se pueden identificar fácilmente. 1 μm 1 μm LXI a 8.4.1 Evolución de la infección de Wolbachia en S. cerevisiae W303 Monitoreamos el efecto de Wolbachia en el crecimiento de la levadura durante 18 días y la cantidad de Wolbachia por célula de levadura a diferentes tiempos para determinar en qué momento teníamos mayor cantidad de Wolbachia. a b c Figura 15. Crecimiento de S. cerevisiae infectada con Wolbachia utilizando como fuente de carbono galactosa y glucosa. Aumento de densidad óptica (600 nm) de ScW303 (negro) y wScW303 (gris) utilizando como fuente de carbono (a) galactosa y (b y c) glucosa. Se realizaron 3 mediciones de 3 experimentos independientes. Se graficó el promedio de estos ± desviación estándar. Realizamos curvas de crecimiento determinando el aumento de la densidad óptica (D.O.) de cultivos de ScW303 y wScW303 utilizando glucosa y galactosa al 2% como fuentes de carbono (Figura 15a y b). Las cepas ScW303 y wScW303 exhibieron un crecimiento similar y monofásico usando galactosa como fuente de carbono, alcanzando la fase estacionaria a las 16 horas (Figura 15a). En medios con dextrosa, en la levadura control se observó un crecimiento bifásico debido a que en la fase diáuxica (10-12 horas) la levadura pasó de un metabolismo fermentativo a uno aeróbico. En la cepa wScW303 se observó un mínimo adelanto de la fase diáuxica a 6 horas (Figura Glucosa Glucosa Galactosa LXII 15b). En el medio con dextrosa como fuente de carbono se observó una ligera disminución de la densidad óptica de los cultivos de la cepa no infectada a los 16 días, y a los 14 días para la cepa infectada (Figura 15c). La viabilidad celular se observó con el kit Baclight que tiñe todo el DNA presente en la muestra de verde mientras que el DNA de las células cuya integridad membranal está comprometida se tiñe de rojo. La supervivencia de las células bajó en las células infectadas después de 14 días de cultivo (Figura 16 a y b). a b Figura 16. Efecto de Wolbachia sobre la viabilidad de Saccharomyces cerevisiae W303. (a) Viabilidad de los cultivos de levadura estimada con el kit de viabilidad celular Baclight. Se realizaron 3 mediciones de 3 experimentos independientes y se graficó su promedio ± desviación estándar. (b) Microfotografías de la levadura ScW303 (primera columna) y wScW303 (segunda columna) tomadas a 14, 16 y 18 días, que muestran la degradación de la membrana de la levadura infectada. A los 14 días hay 84.19 ± 1.21 % y 71.20 ± 3.39 % de células vivas para ScW303 y wScW303, respectivamente. A los 16 días, la viabilidad de la levadura infectada disminuyó drásticamente (78.61 ± 2.06 % y 45.37 ± 10.77 % para ScW303 y wScW303). Finalmente, a los 18 días de cultivo ambas cepas presentaron alta mortandad (viabilidad de 50.57 ± 2.07 % y 9.66 ± 2.51 % para ScW303 y wScW303) por lo que decidimos no llevar los cultivos más allá de 14 días (Figura 16a). Las fotografías de las levaduras a estos tiempos muestran degradación de la membrana de las levaduras infectadas (Figura 16b). LXIII a ScW303 wScW303 b Figura 17. Evolución de la infección de S. cerevisiae W303 con Wolbachia. (a) Western Blot contra la proteína wsp de Wolbachia (proteína wsp detectada a 37 kDa); y contra VDAC Día LXIV utilizado como control de carga (detectado a 25 kDa). ScW303 levadura control, wScW303 levadura infectada. Muestras tomadas a 1, 3, 5, 7, 10 y 14 días de cultivo en YPDS. (c-) ScW303, (c+) W303 infectada en medio sólido (b) Imágenes obtenidas por microscopía confocal de ScW303 levadura control, wScW303 levadura infectada a diferentes días. En el primer carril se muestra la fluorescencia obtenida por la hibridación del gen 16S rDNA de Wolbachia con una sonda marcada con Quasar 670; el segundo carril muestra el campo claro y el tercer carril es una sobreposición de las imágenes, en la que se observa la sonda dentro de la línea celular. Monitoreamos el aumento de Wolbachia en la levadura hasta 14 días por Western Blot (Figura 17a). El aumento gradual de la cantidad de Wolbachia (en función de la cantidad de proteína wsp detectada) se puede observar a partir del día 3 y aumentó considerablemente hasta el día 10 y 14. Se realizó la hibridación del gen 16S rDNA con una sonda marcada con Quasar a los mismos tiempos del cultivo y se observó una correlación en el aumento de fluorescencia del Quasar 670 entre 7 y 14 días (Figura 17b). La bacteria fue detectable a partir del día 7 y aumentó hasta el día 14. Figura 18. Viabilidad de Wolbachia durante la infección en S. cerevisiae W303. RT-qPCR para el transcrito del gen (□) 18S rRNA de la levadura control, (■) de la levadura infectada. y del transcrito del gen wsp de Wolbachia ●. Para comprobar la viabilidad de la bacteria se realizó un RT-qPCR del gen wsp. Se utilizó como control el gen ribosomal 18S rRNA de la levadura. El transcrito bacteriano fue detectado a partir del día 3 y hasta el día 14 (Figura 18). Las bajas concentraciones de transcrito detectadas en los primeros días pueden deberse a que la actividad transcripcional de la levadura este opacando a la de la bacteria. Finalmente, a los 16 días, las cantidades de transcrito obtenido disminuyeron, probablemente debido a la muerte del hospedero y a la sensibilidad de Wolbachia a las condiciones de cultivo. En una revisión de los métodos con los que se ha cuantificado a Wolbachia en líneas celulares (Tabla 5) se señala que lo más común es contar por microscopía la señal LXV de fluorescencia emitida por la bacteria. Los métodos empleados fueron tinción con SYTO 9 e hibridación con sondas marcadas (FISH). Únicamente la segunda es específica para Wolbachia. Al contar puntos marcados con la sonda o los cuerpos bacterianos presentes en las imágenes tomadas por microscopía electrónica de trasmisión, encontramos de 1 a 6 cuerpos bacterianos por levadura, aunque no todas las levaduras se encuentran infectadas (Figura 7) indicando que la transferencia no es perfecta. Tabla 5. Densidad de la infección con Wolbachia de diferentes hospederos Hospedero Método Wb/célula Rendimiento* Ref. Aedes albopictus C/wStr Microscopía (SYTO) 50-100 .85-1.7 *1010 w/L (Baldridge y cols., 2014) Aedes albopictus Aa23 Microscopía (FISH) 40-65 (10-30 D) 0.67-1.1 *1010 w/L (Khoo y cols., 2013) Aedes, C7- C10B, C7- C10R Microscopía (FISH) 10-60 (40-100 D) 0.16-1.0 *1010 w/L (Khoo y cols., 2013) Aedes albopictus C/wStr Citometría de flujo 500 (6-10) 8.3 *1010 w/L (Fallon, 2014) *Cálculo basado en una cantidad de 106 células de Aa23 en una caja de 60 mm (Fallon, 2008). ** Considerando 2.4 x 109 levaduras/mL contado con la Cámara de Neubauer. NR: No reportado, BB: Bead beater, Centrif.: Centrifugación La utilización de las levaduras como hospederos nos da muchas ventajas sobre las líneas celulares. La primordial para nuestro trabajo es la facilidad de cultivo y el aumento en la cantidad de biomasa. El número de Wolbachia por levadura es menor que el número de Wolbachia por célula de insecto (Figura 13, Tabla 5), sin embargo la cantidad de levaduras que se obtienen de un cultivo de un matraz de un litro es mayor que el que se obtiene de células en un litro de cultivo de línea celular aumentando así el rendimiento de la bacteria. El cultivo de las líneas celulares, además, se realiza en cajas de Petri o frascos de Roux (para un litro son 17 Frascos de Roux de 225 cm2) que deben incubarse en la cámara de CO2 (volumen limitado) y que necesitan por lo menos 30 días para crecer. En cambio, la levadura se cultiva en matraces de un litro en una temperatura constante durante 14 días. La levadura se cultiva en YPD que cuesta menos LXVI que el medio mínimo de Eagle suplementado. Al reducir y simplificar el material utilizado se reducen enormemente los costos del proyecto. Finalmente, la levadura es más robusta que la célula de insecto, por lo que da una mayor protección contra cambios ambientales, cambios de pH, de concentración de oxígeno y de temperatura. Al ser capaces de infectar diversas levaduras tenemos acceso a una gran variedad de cepas y mutantes lo que ofrece la posibilidad de explorar los efectos de Wolbachia sobre su hospedero. 8.5 Actividad fermentativa de ScW303 y wScW303 En la curva de crecimiento utilizando glucosa como fuente de carbono (Figura 15b y c) puede observarse un pequeño desplazamiento de la fase diáuxica en la cepa ScW303 infectada con Wolbachia. Si esto es cierto, entonces la fermentación de la levadura infectada debe estar aumentada en fases tempranas del crecimiento. a b Figura 19. Fermentación en S. cerevisiae W303 infectada con Wolbachia. (a) Consumo de glucosa en cultivos de ScW303 y wScW303. (b) Actividad fermentativa de cultivos de ScW303 y wScW303 a 6 y 8 horas.Se realizaron 3 determinaciones en 3 experimentos independientes y se graficó el promedio de éstos ± desviación estándar. P<0.05. Para comprobar que había un efecto en la fermentación de la levadura se cuantificó el consumo de glucosa que fue más lento en los cultivos de ScW303 que en los cultivos dewScW303: la cepa infectada consumió un poco más rápido la glucosa en el medio (Figura 19a). Los ensayos a diferentes tiempos indicaron que la fermentación aumentó en los cultivos infectados a las 6 horas con respecto al control (Figura 19b). A las 8 horas, la capacidad fermentativa de los controles aumentó, mientras que los de la levadura infectada disminuyeron. Es poco probable que Wolbachia haya consumido LXVII directamente la glucosa, ya que no posee las enzimas glucolíticas necesarias, pero sí puede haber consumido el glicerol-3-fosfato, las hexosas fosfatadas o el ácido pirúvico generado por el hospedero como se ha propuesto (da Rocha Fernandes y cols., 2014; Voronin y cols., 2016). Otra posibilidad es que haya modificado el metabolismo del hospedero y éste consuma los sustratos a mayor velocidad. 8.6 Efecto de Wolbachia sobre la cadena respiratoria de S cerevisiae Evaluamos la influencia de Wolbachia sobre la función mitocondrial de la levadura a 14 días de cultivo, donde la cantidad de Wolbachia fue significativa y a un día en donde la actividad mitocondrial debe ser óptima (Tabla 6). Se observa una disminución en la velocidad de consumo de oxígeno en el estado III en la levadura control a los 14 días, lo que significa una pérdida de la capacidad respiratoria máxima, que se traduce en un CR menor. Este fenómeno no ocurrió en las levaduras infectadas de 14 días: el consumo de oxígeno en el estado III se mantuvo, lo que podría indicarnos que la actividad respiratoria de las mitocondrias del hospedero, agregada a la de la bacteria, le permite mantener por mayor tiempo una alta capacidad respiratoria, pero también el acoplamiento. Tabla 6. Control respiratorio de ScW303 y wScW303 Cepa Estado IV* Estado III** CR Día 1 ScW303 25.2 3.1 52.5 6.8 2.1 0.15 wScW303 27.4 4.6 65.4 9.0 2.4 0.2 Día 14 ScW303 22.6 5.1 29.0 6.3 1.3 0.2 wScW303 34.3 5.1 73.3 11.1 2.1 0.1 * Etanol ** ADP Se determinó el consumo de oxígeno en los extractos de la levadura no infectada e infectada utilizando diferentes sustratos e inhibidores de la cadena transportadora de electrones para indirectamente elucidar si la respiración era de la mitocondria o de la bacteria (Figura 20). En el extracto ScW303 de 14 días, el consumo de oxígeno fue semejante al de los extractos de un día, excepto para los valores obtenidos con NADH, que mostraron un consumo de oxígeno menor que en el de 1 día. LXVIII Figura 20. Consumo de oxígeno de la fracción mitocondrial de S. cerevisiae control o infectada con Wolbachia con uno y 14 días de cultivo. El consumo de oxígeno se determinó en un volumen final de 1.5 mL en un OROBOROS equipado con un electrodo de Clark. Se LXIX utilizó una concentración de 5 mM de cada sustrato: glicerol-3-fosfato (G3P), piruvato-malato (PM), succinato (Succ). Donde se indica, se agregó: CCCP 0.5 μM, rotenona (Rot) 0.1 μM, antimicina A (Ant A) 0.1 μM, cianuro (CN-) 1 mM o flavona 0.15 mM. Se añadieron 0.5 mg prot / mL de mitocondrias (M). Los datos representan la media ± SEM de n = 4. Prueba T * p <0.005, ** p <0.001 para ScW303 contra la levadura wScW303 en el mismo día. Prueba T - / + p <0.05 - - / ++ p <0.001 (-, disminución; +, aumento) para ScW303 en el día uno frente al día 14 de cultivo o wScW303 en el día uno frente al día 14 de cultivo. En lo que se refiere al consumo de oxígeno del extracto mitocondria-Wolbachia de wScW303, se afectó de diferentes maneras: El consumo de oxígeno utilizando Glicerol-3-fosfato se vió aumentado en la fracción de wScW303 a 1 y 14 días. Utilizando piruvato-malato y succinato como sustratos: el consumo de oxígeno de la fracción mitocondria-bacteria de wScW303 fue mayor al del extracto de ScW303 en 14 días. Es de notar que al utilizar como sustrato piruvato-malato en los extractos de ScW303 y wScW303 de 1 día y ScW303 de 14 días no se observó consumo de oxígeno; sin embargo, a los 14 días de cultivo de las levaduras infectadas aumentó el consumo de oxígeno. También observamos que al agregar rotenona no hubo inhibición de la respiración, indicando que un posible complejo I de Wolbachia no es responsable de este consumo. Utilizando NADH como sustrato, el consumo de oxígeno fue menor que el de las muestras con un día de cultivo (wScW303) pero mayor que el del extracto de la levadura no infectada (ScW303) de 14 días. Por otra parte, el aumento en el consumo de oxígeno en los extractos de wScW303, en mayor o menor grado, con todos los sustratos, fue todavía más claro ante la adición de CCCP, lo que indica un aumento de la capacidad respiratoria, pero también que tiene, un componente importante de acoplamiento. Todo indica que, o bien Wolbachia participa en la generación de energía, o favorece la generación de ésta por las mitocondrias del hospedero. En los extractos de las levaduras infectadas se observó un patrón similar de consumo de oxígeno utilizando todos los sustratos, lo que indica que la cadena transportadora de electrones en las levaduras no infectadas e infectadas es la misma o semejante. Tratando de elucidar si los componentes de la CTE eran de bacterias o de levaduras, ensayamos la actividad de los complejos en geles de poliacrilamida nativos (BN-PAGE) y geles claros nativos de alta resolución (hr-CN-PAGE) (Figura 21). Los pesos moleculares de los complejos respiratorios mitocondriales y bacterianos son diferentes (Tabla 2), por lo que al realizar la electroforesis en geles nativos esperábamos ver bandas diferentes en caso de que ambos organismos LXX expresasen su cadena respiratoria. Una levadura posee en promedio tres mitocondrias cuando se cultiva en un medio con glucosa como fuente de carbono. La levadura infectada posee entre 2 y 3 células de Wolbachia por levadura, y esperábamos por lo tanto ver una proporción que aproximase el 50% de proteínas mitocondriales con respecto a las de la bacteria. Figura 21. BN-PAGE y hrCN-PAGE de ScW303 con y sin Wolbachia a 1 y 14 días. Electroforesis en geles nativos azules (BN) y claros de alta resolución (hrCN) de BHM (mitocondrias de corazón de bovino), S. cerevisiae ScW303 y S. cerevisiae infectada con LXXI Wolbachia (wScW303) de uno y 14 días. Las bandas indicadas se secuenciaron y los resultados se encuentran en el Anexo C. Las actividades de Complejo II, citocromo c oxidasa y ATPasa mostraron los mismos patrones de bandas, aunque con diferente intensidad, lo que sugiere que los únicos complejos respiratorios presentes eran los de levadura y que Wolbachia únicamente estaba modificando la expresión o actividad mitocondrial. Por otro lado, en el gel de actividad para NADH deshidrogenasa se observó una banda diferencial (1N) únicamente en los extractos de wScW303 de 14 días. Esta banda, así como las de la actividad de succinato deshidrogenasa, citocromo c oxidasa y ATPasa se cortaron y se secuenciaron. La secuencia de las bandas de actividad (Indicadas en la Figura 21) 1N, 2N, 1S, mostró que todas las proteínas de CTE pertenecían a S. cerevisiae: no se encontraron proteínas de los complejos respiratorios de Wolbachia. Sólo en la banda secuenciada 1A correspondiente a actividad de ATPasa se detectaron las subunidades a y b de la subunidad F1 de la ATPasa de Wolbachia (ver anexo C). Los espectros diferenciales de las fracciones mitocondriales muestran una cantidad de citocromos b y c similares en ScW303 y en wScW303. Sin embargo, a los 14 días la cantidad de citocromos a de ScW303 disminuyó drásticamente, mientras que la cantidad de citocromos a de wScW303 se mantuvo constante (Figura 22, Tabla 7). Figura 22. Espectros diferenciales de membranas de ScW303 y wScW303. 15 mg/mL de membranas de la fracción mitocondria-Wolbachia se resuspendieron en Tris-HCl 50 mM pH 7.4 en un volumen final de 200μL. Se realizaron barridos de 500 nm a 630 nm de una muestra reducida con hidrosulfito de sodio (ditionita) y se le restó una muestra oxidada con persulfato de amonio. Se observan los citocromos c (550 nm), b (560 nm) y a (604 nm). LXXII Tabla 7. Concentración de citocromos (nmol/mg proteína) en la fracción mitocondria-Wolbachia de ScW303 y wScW303 Citocromo a +a3 Citocromo b Citocromo c +c1 ScW303 1 D 1.61 ±0.25 3.78 ± 0.23 2.34 ± 0.65 wScW303 1 D 1.54 ± 0.34 3.85 ± 0.42 2.19 ± 0.24 ScW303 14 D 0.27 ± 0.18 3.18 ± 0.90 1.01 ± 0.99 wScW303 14 D 1.14 ± 0.30 3.59 ± 1.37 2.05 ± 1.40 8.7 Cultivo de Wolbachia en diferentes cepas de Saccharomyces cerevisiae rho0 Con el fin de probar si Wolbachia era capaz de consumir oxígeno, infectamos a S. cerevisiae W303 rho0 (Figura 23). Primero, esta cepa resultó ser sensible al oxígeno, por lo que se cultivó en cajas de Petri, perdiendo la ventaja del volumen de cultivo en medios líquidos. Al realizar los controles de infección por Wolbachia (PCR, FISH y WB) nos percatamos de que la infección era muy débil y la infección se perdía al resembrar. Se intentó infectar la cepa ScD723-10B rho0, también con resultados negativos, a pesar de que la infección en ScNB40 fue posible (Figura 7). Figura 23. Infección de S. cerevisiae rho°. (a) FISH contra el gen 16S rDNA de Wolbachia en las cepas de S. cerevisiae W303 rho0, y 723-10B rho0 control e infectadas con Wolbachia. Serie LXXIII superior: levaduras control; serie inferior: levaduras infectadas con Wolbachia. La cantidad de Quasar 670 (rosa) indica la densidad de infección en cada cultivo. A pesar de que la infección en las cepas rho0 era muy baja y no se mantenía en el cultivo al resembrar las levaduras, se determinó el consumo de oxígeno en células completas y en extractos mitocondria/bacteria de la primera infección y no se observó consumo de oxígeno (Figura 24 a y b). a b Figura 24. Consumo de oxígeno de la fracción mitocondrial de S. cerevisiae rho0 control o infectada con Wolbachia con uno y 14 días de cultivo. El consumo de oxígeno se determinó en un volumen final de 1.5 mL en un OROBOROS equipado con un electrodo de Clark. Condiciones experimentales iguales a las empleadas en la Figura 20. Se añadieron 0.5 mg prot/mL de mitocondrias (M) o 50 mg de peso húmedo de levadura. Los datos representan la media ± SEM de n = 4. Prueba T * p <0.005,** p <0.001. 8.8 Wolbachia aislada no expresa una cadena respiratoria activa Para eliminar separar a Wolbachia de las mitocondrias seguimos el protocolo descrito en la sección 7.23. Aislamos Wolbachia de cultivos de 50 a 100 mL de ScW303 y wScW303 (Figura 25). Se observaron dichas muestras en el microscopio electrónico de transmisión y se observó que en los controles, cuya biomasa era significativamente menor, se observaban pequeñas vesículas cuyo tamaño era inferior al esperado en la bacteria (Figura 25 a y b). En cambio, en las muestras aisladas a partir de wScW303 se observaron numerosos cuerpos bacterianos, vesículas y fragmentos de mitocondrias (Figura 25 c, d y e). Wolbachia puede sobrevivir ex-vivo durante 7 días (Rasgon y cols., 2006) por lo que las muestras se incubaron a 27ºC en una incubadora de 5% CO2 en MEM, 10% SBF, 100 g/mL de anfotericina B de 48 a 96 horas (figura 25) con el fin de eliminar cualquier actividad mitocondrial remanente. LXXIV Figura 25. Microscopía Electrónica de Transmisión de la fracción con Wolbachia aisalda de ScW303 y wScW303. Imágenes tomadas de la fracción aislada de ScW303 (a) y (b) y de wScW303 (c, d y e). En las imágenes tomadas a partir de la wScW303 podemos observar cuerpos bacterianos con doble membrana y mitocondrias degradas (flecha). a b c d e LXXV Después de 48 horas no se detectó respiración con piruvato, malato, glutamato, glicerol-3-fosfato, succinato o glucosa en células integras o permeabilizadas (Figura 26). a b c d Figura 26. Consumo de oxígeno de Wolbachia aislada. Condiciones experimentales iguales a las empleadas en la Figura 19. i ScW303: fracción que contiene a Wolbachia de ScW303; i wScW303: fracción que contiene a Wolbachia de wScW303. Se añadieron 0.5 mg prot/ mL de bacteria. Los datos representan la media ± SEM de n = 4. Prueba T * p <0.005. 8.9 Hidrólisis de ATP por Wolbachia aislada Se detectó la actividad ATPasa sensible a oligomicina en bacterias aisladas (Figura 27), lo que podría indicarnos que Wolbachia pueda captar de alguna manera el LXXVI ATP del hospedero y puede hidrolizarlo, tal vez para energizar sus sistemas de secreción SST2 o/y SST4. Wolbachia es un endosimbionte obligado, y los dos últimos experimentos fueron realizados en bacteria aislada e incubada varios días en un medio extracelular, lo que podría significar que el metabolismo de Wolbachia puede ser diferente al observado en un medio intracelular. Figura 27. Wolbachia aislada hidroliza ATP. Se añadieron 0.05 mg prot/ mL de bacteria aislada de wScW303 o la fracción equivalente a la bacteria ScW303 en un volumen final de 100 μL. Dónde se indica (+O), se agregaron 3 μg/mL de oligomicina. Los datos representan la media ± SEM de n = 4. Prueba T * p <0.005. 8.10 Wolbachia aislada a partir de levaduras mantiene su capacidad infectiva pero no modifica el consumo de oxígeno de la línea celular. Inoculamos una muestra de Wolbachia extraída de wScW303 en la línea celular C6/C36 con el fin de observar si permanecía infectiva después de permanecer de dos a seis meses como endoparásito de levaduras. La línea celular C6/C36 es una línea celular derivada de Aedes albopictus (ATCC CRL-1660) que soporta el parasitismo de Wolbachia (Baldridge y cols., 2014). Preferimos la línea celular C6/C36 sobre la Aa23Tet, porque la primera jamás había sido expuesta a Wolbachia o a tetraciclina. La infección por Wolbachia se evaluó mediante tinción específica usando FISH (Figura 28, Película S3). LXXVII a b Figura 28. Infección de C6/C36 por Wolbachia. (a) FISH (Quasar 670-pink) de la línea celular wC6/C36. Las imágenes de luz / Quasar 670 muestran hibridación dentro de la línea celular infectada. La línea celular no infectada C6/C36 no tiene ninguna marca de hibridación. (b) Oximetría de la línea celular C6/C36 control y C6/C36 infectada con Wolbachia wAlbB. Las condiciones fueron similares a las empleadas en la figura 13. Se emplearon 4 millones de células por trazo. n=4, *p<0.05. LXXVIII No se realizaron oximetrías comparando la línea celular Aa23 con Aa23tet, ya que la tetraciclina aumenta las actividades mitocondriales de los hospederos expuestos a ésta (Ballard y cols., 2007). Como la cepa C6/C36 nunca estuvo expuesta a Wolbachia o a tetraciclina se determinó el consumo de oxígeno en C6/C36 y la wC6/C36 y se encontraron diferencias significativas (p<0.05) (Figura 28b). Cabe destacar que el consumo de oxígeno es muy bajo a comparación con el obtenido en la fracción Wolbachia/mitocondria de levadura, pero congruente con lo reportado para otras líneas celulares (Loyola-Machado y cols., 2017). Este experimento realza la importancia de nuestro modelo sintético en donde se obtiene suficiente biomasa para lograr aislar tanto la fracción Wolbachia/mitocondria y evaluar el efecto sobre el metabolismo energético del hospedero, como a la bacteria aislada y poder evaluar su metabolismo aerobio. LXXIX 9. DISCUSIÓN El primer reto enfrentado en el proyecto para cumplir con el objetivo de estudiar el metabolismo aeróbico de Wolbachia, fue aumentar la cantidad de biomasa disponible para trabajar. Siguiendo los métodos empleados para cultivar otros endosimbiontes en medio axénicos, se intentó cultivar Wolbachia en medios ricos utilizando como medios base MEM, BHI y MM suplementados con aminoácidos, solutos compatibles, colesterol, catalasa, suero bovino fetal y eritrocitos de rata, borrego y humano. En esta etapa del proyecto encontramos que varios de estos medios pueden mantener a Wolbachia viva, pero no se reproduce y no hay aumento de la biomasa. Los resultados obtenidos no eran relevantes ya que Rasgon y cols., (2006) reportaron que Wolbachia podía sobrevivir afuera de un hospedero durante 7 días en MEM suplementado son SBF en una atmosfera de 5% de CO2. Wolbachia es una bacteria endosimbionte obligada comúnmente reportada en artrópodos y en nemátodos (Bandi y cols., 1999; Fenn y cols., 2004). En reportes recientes se ha detectado Wolbachia en humanos inmunocomprometidos (Chen y cols., 2015) y en plantas (Li y cols., 2017), demostrando que Wolbachia es una bacteria parásita con una gran facilidad de infección a nuevos hospederos por lo que sugerimos cultivar a Wolbachia como endobacteria en la levadura Saccharomyces cerevisiae. En el área de biotecnología las endosimbiosis artificiales se han propuesto como microrreactores, en dónde una bacteria huésped produce un metabolito necesario para su hospedero y que a su vez es precursor de algún otro compuesto que el hospedero puede sintetizar y que por lo general tiene algún uso humano (Hosoda y cols., 2011a; Hosoda y cols., 2011b; Momeni y cols., 2011). Las endosimbiosis artificiales también se han propuesto como modelos para estudiar la evolución de organismos independientes a organelos celulares (Brenner y cols., 2008; French, 2017; Frey-Klett y cols., 2011; Mee y cols., 2012) y finalmente, se ha propuesto el uso de hospederos artificiales para el cultivo de endosimbiontes y endoparásitos obligados (Stewart, 2012). Este trabajo es uno de los primeros en demostrar que el cultivo de endobacterias obligadas en hongos levaduriformes es posible. La facilidad en el cultivo y el manejo de la levadura puede aumentar la biomasa bacteriana obtenida facilitando el estudio del metabolismo de la bacteria y su interacción con el hospedero. Las levaduras son más robustas que las líneas celulares, por lo que se disminuyen los requerimientos nutricionales de los cultivos y se protege al endosimbionte contra cambios ambientales. Otra ventaja de la levadura utilizada es que son aerobias facultativas, es decir, pueden LXXX crecer a altas concentraciones de oxígeno, en condiciones microaeróbicas o anaeróbicas dependiendo de lo que necesitemos y no requieren forzosamente de una incubadora de CO2 (Baldridge y cols., 2014; Gasch, 2002; Gasch y cols., 2002; Khoo y cols., 2013) . Finalmente, todas las líneas celulares empleadas para cultivar a Wolbachia son adherentes, es decir están limitadas a crecer en la superficie de las cajas petri ó frascos de Roux. Las líneas celulares tienen un rendimiento de 3x106 de células en 75 mL, mientras que un cultivo de 24 horas de S. cerevisiae tiene 9*107 células por mL. A pesar de que en esta tesis se presenta una propuesta novedosa, hay que recordar que el sistema Wolbachia/S. cerevisiae es un modelo artificial y por lo tanto las interacciones observadas pueden diferir de las que ocurren en la naturaleza. Además hay que ajustar las condiciones de cultivo dependiendo del huésped, del hospedero, de los posibles mecanismos de infección y del objetivo del experimento. Escherichia coli puede cultivarse como endoparásito de amoebas (Hosoda y cols., 2011a), y recientemente el grupo iGEM Marburg se ha dedicado a establecer una endosimbiosis artificial y cultivar la bacteria como endosimbionte de S. cerevisiae. (http://2016.igem.org/Team:Marburg/PEG_Method/Results) El objetivo primordial de este proyecto es hacer microbiorreactores para la producción de terpenoides con alto valor comercial como por ejemplo el limoneno. En este proyecto lograron introducir a E. coli en S. cerevisiae mediante una fusión entre la membrana del hospedero, quitando la pared celular con zimoliasa y la bacteria encapsulada en poli etilenglicol. Confirman la introducción de la bacteria a la levadura haciendo cortes en Z de la levadura teñida con calcoflúor y con E. coli marcada con una RFP (proteína roja fluorescente). En este caso aprovechan la facilidad de manejo de E. coli. Este proyecto fue descontinuado ya que, aunque lograron introducir la bacteria a la levadura, esta última lisó a E. coli, evitando una simbiosis estable. Lamentablemente no hay ningún artículo al respecto por lo que no hay métodos experimentales ni resultados de este evento. Esta reportado que los lisosomas de S. cerevisiae W303 generados como respuesta ante una invasión bacteriana lisan a E. coli y otras bacterias como Xantamonas oryzae y Shigella flexneri, (Yoon y cols., 2009) . A diferencia de E. coli, a la fecha, no se ha logrado transformar a Wolbachia utilizando técnicas convencionales de biología molecular ni utilizando los sistemas de CRISPR-cas (datos no publicados de Thiem S., Proyecto MICL02352, Departamento de entomología, Universidad de Michigan), por lo que el uso de Wolbachia como bacteria endosimbionte en un microrreactor no sería práctico. Sin embargo, los resultados LXXXI presentes en esta tesis y aquellos reportados por el equipo Marburg pueden utilizarse con otras bacterias y levaduras, por ejemplo, se podrían utilizar con Burkholderia sp, que puede cultivarse ex-vivo, tiene mecanismos de transmisión horizontal y vertical y es capaz de adaptarse a la vida intracelular (Partida-Martinez y cols., 2005; Scherlach y cols., 2006). Al igual que en las líneas celulares, dependiendo del linaje de las levaduras observamos diferentes densidades de infección. En esta tesis se utilizaron tres cepas diferentes de Saccharomyces cerevisiae: ScBY, ScW303 y ScD273-10B. Wolbachia fue capaz de colonizar las cepas de S. cerevisiae W303 y D273-10B efectivamente mientras que la infección en la cepa BY fue menor. Las cepas que soportan la infección de Wolbachia respiran más y tienen una menor sensibilidad a especies reactivas de oxígeno (Gutierrez-Aguilar y cols., 2014; Montanari y cols., 2014). Montanari y cols. (2014) evalúan la capacidad de diferentes cepas de S. cerevisiae de formar colonias después de ser cultivadas en YPD. ScW303 tiene un 100% de supervivencia después de cultivarse durante 30 días, mientras que ScD273-10B tiene una supervivencia del 50% a los 5 días y el cultivo el incapaz de formar colonias después de 22 días de cultivo. En líneas celulares la infección por Wolbachia se reporta después de 15 y hasta 100 días de cultivo. Cultivar a Wolbachia en levadura nos ha permitido publicar el primer artículo en dónde se evalúa la actividad metabólica de la bacteria aislada y su relación con el metabolismo del hospedero con experimentos bioquímicos y no solo evaluando la expresión diferencial de los genomas y los proteomas, los cuáles, nos sirvieron de referencia para desarrollar los experimentos (Uribe-Alvarez y cols., 2018). Además la levadura es más robusta que las líneas celulares, son más tolerantes al estrés ambiental como la temperatura, desecación, pH, antibióticos y osmóticos. estrés, etc. que las líneas celulares. Los medios utilizados son más baratos y al cultivarse en frascos de vidrio que se pueden esterilizar hay una gran reducción de material plástico empleado. La levadura puede crecer en aerobiosis por lo que la limitación de espacio ya no es un problema, sin embargo al fermentar también pueden cultivarse en micro y anaerobiosis en caso de ser necesario. Además, la infección de S. cerevisiae nos da la ventaja de que, dado que es una de las levaduras más estudiadas, hay bibliotecas mutantes completas disponibles, así se puede estudiar el propósito de la bacteria en su hospedero, eligiendo una levadura con una mutación que imita la condición de este y evaluando si la infección con Wolbachia revierte el efecto de la mutación. LXXXII En este trabajo buscamos estudiar la cadena transportadora de electrones de Wolbachia porque estudios previos sugieren que esta bacteria contribuye a la actividad respiratoria del hospedero e inclusive es capaz de sustituirla (Darby y cols., 2012; Darby y cols., 2014; Strubing y cols., 2010). Wolbachia es una α-proteobacteria filogenéticamente cercana a la mitocondria, por lo que la posibilidad de que remplazara o cooperara con la actividad respiratoria era una idea atractiva. En contraste el grupo del Dr. Sullivan describe a este endosimbionte como una bacteria con capacidades metabólicas limitadas, completamente dependiente del hospedero y sugiere que en vez de aportar energía directamente al hospedero, aporta únicamente grupos hemo y riboflavina(Pietri y cols., 2016). Durante el análisis del genoma de la cepa wAlbB (Mavingui y cols., 2012) encontramos que Wolbachia carece de las subunidades nuoC y nuoD del Complejo I de la cadena transportadora de electrones (Anexo B). Estas subunidades son dos de las cuatro necesarias para la unión de la ubiquinona al complejo I (Figura 3) (Sazanov, 2015). Del complejo II, hace falta el gen sdhD que es necesario para la formación del sitio de unión a la ubiquinona. Del Complejo III únicamente hay un gen que corresponde a la proteína fierro-azufre (Mavingui y cols., 2012). Todas las subunidades necesarias para el funcionamiento del complejo IV y de la ATPasa (no posee subunidad inhibidora ζ) están presentes en el genoma. El genoma reportado para wAlbB tiene 1.29 Mpb y en general los genomas de Wolbachia de artrópodo tienen un tamaño de 1.4 Mpb, por lo existe la posibilidad de que el genoma no esté completo o que en la cepa wAlbB se hayan perdido algunos genes presentes en otras cepas (ver Anexo B). Wolbachia de Culex pipientis (Klasson y cols., 2008), que es la más parecida a wAlbB, posee todos los genes necesarios para sintetizar una cadena transportadora de electrones funcional (Anexo B). La recopilación de todos los posibles componentes de la cadena transportadora de electrones de diferentes grupos de Wolbachia se encuentra en la Figura 3 (Rosas-Lemus, 2016), sin embargo, estos varían enormemente de acuerdo a la especie de la cual se aisló Wolbachia (Anexo B). Debido a la información contrastante decidimos explorar si Wolbachia contribuye al consumo de oxígeno en el hospedero, si posee su propia CTE y si es capaz de consumir oxígeno. En la fracción mitocondria-Wolbachia de levaduras infectadas observamos un aumento en el consumo de oxígeno y en el acoplamiento de la CTE a los 14 días. Aprovechando la diferencia en los pesos moleculares de estos pudimos definir que el aumento en el consumo de oxígeno a los 14 días en levaduras infectadas es LXXXIII responsabilidad de la mitocondria y no de la bacteria. Esto coincide con lo observado en la microscopía electrónica de transmisión, en dónde las levaduras control no presentan mitocondrias mientras que en las levaduras infectadas éstos organelos están conservados. El aumento en el consumo de oxígeno por parte del hospedero puede ser resultado de la suplementación de nutrientes por parte de la bacteria como se observa para el SOPE (Primary endosymbiont of Sytophilus oryzae) del gorgojo de arroz (Heddi y cols., 1999; Heddi A, 1993); o puede ser una respuesta inespecífica del hospedero a la infección de la bacteria. Por lo tanto, la posibilidad de que Wolbachia esté donando riboflavina o grupos hemo a su hospedero artificial permanece latente y constituye una de nuestras principales perspectivas. Finalmente aislamos Wolbachia aprovechando la capacidad que tiene de sobrevivir ex-vivo y ésta no presentó consumo de oxígeno bajo ninguna de las condiciones examinadas. Podemos concluir que Wolbachia no presenta CTE propia y por lo tanto no consume oxígeno. Estos resultados también cuestionan la propuesta de que Wolbachia pueda donar ATP al hospedero ya que a pesar de tener las vías de síntesis de nucleótidos, al no tener CTE no puede generar el gradiente necesario ´para fosforilar el ADP. Otro motivo por el cual esta teoría esta desacreditada es la falta de un mecanismo definido por el cual Wolbachia pueda donar ATP a la célula (Krause y cols., 1985; Winkler, 1976). Dependiendo del experimento planeado, la metodología para aislar a Wolbachia puede modificarse. En nuestro caso, necesitábamos eliminar los fragmentos de mitocondria que podían dar falsos positivos en los experimentos de oximetría. El paso crítico de este protocolo es romper y centrifugar las células empleando medios suplementados con suero bovino fetal y mantener la esterilidad. Por ejemplo, para este experimento podemos filtrar las células por una membrana de 0.8 μm y deshacernos de la mayoría de las levaduras, pero como las levaduras crecen en microaerobiosis agregamos anfotericina B para evitarlo. Si usamos las bacterias obtenidas de la levadura para infectar otras levaduras, es necesario filtrar las células con una membrana de 0.45 μm para asegurar que no haya levadura. Si se agrega anfotericina B, es probable que afecte el crecimiento de la levadura receptora. Filtrar las células por membranas de 0.45 μm provoca que se pierda una gran cantidad de bacterias. Wolbachia aislada no sobrevive en una atmósfera aerobia, por lo que podría especularse que necesita de la mitocondria para reducir la cantidad de oxígeno en su entorno (Potter y cols., 2016). También es más sensible a especies reactivas de oxígeno LXXXIV que su hospedero y necesita una atmósfera con 5% CO2 para sobrevivir ex-vivo (Fallon y cols., 2013). La posibilidad de que Wolbachia entre al citoplasma de hospedero para escapar del oxígeno atmosférico no excluye el hecho de que también utilice algún sustrato del hospedero como fuente de energía. Actualmente se han liberado mosquitos infectados con Wolbachia en muchas partes del mundo; inhibe la transmisión de diferentes arboviruses (Brownlie y cols., 2009b; Hedges y cols., 2008; Hoffmann y cols., 2011; Moreira y cols., 2009; Mousson y cols., 2010; Pan y cols., 2012; Raquin y cols., 2015) modificando el metabolismo del hospedero y compitiendo por los nutrientes (colesterol y aminoácidos principalmente) disponibles en el hospedero. Se sabe ya que algunas cepas de Wolbachia (wMelPop acortan la vida de sus hospederos en un 50% y tienen efectos dañinos sobre ellos(McMeniman y cols., 2009), pero no se ha explorado cómo causa la muerte prematura, ni qué pasa con el metabolismo del hospedero. Hacen falta estudios para detectar los posibles efectos de la bacteria sobre el hospedero, en especial sobre su posible intercambio de material genético y proteínas y su facilidad para adaptarse a nuevos hospederos. Con nuestros resultados y los de genomas obtenidos por otros grupos de investigación, podemos proponer que en vez de suministrar ATP al hospedero, Wolbachia absorbe el ATP de éste en forma de intermediarios fosforilados de la glucólisis (piruvato o fructosa-6-fosfato y la fructosa 1,6-difosfato por medio de un transportador de hexosas fosfato). Después, utilizando el ATP generado en la segunda fase de la glucólisis y el ciclo de Krebs, genera un potencial transmembranal utilizando la ATP sintasa de manera reversa (ninguna Wolbachia posee la subunidad inhibidora ζ de la ATPasa). Finalmente, este potencial transmembranal es utlizado para energizar los transportadores de aminoácidos (simportadores aa/H+) ya que según los reportes de los genomas complementarios de Wolbachia y sus hospederos, no es capaz de sintetizar aminoácidos y debe de tomarlos forzosamente del hospedero. Dado que no se encontraron aumentadas las proteínas propias de Wolbachia, no pareciera difícil que en su genoma existan factores capaces de interactuar, o bien con el genoma nuclear o mitocondrial de la levadura y modificar la expresión de algunos componentes implicados en el metabolismo energético. LXXXV 10. CONCLUSIONES En este trabajo se desarrolló un novedoso sistema de parasitismo artificial infectando a la levadura S. cerevisiae con el endosimbionte obligado Wolbachia sp. Las cepas W303 y D723-10B resultaron ser más susceptibles a la infección por Wolbachia que la cepa BY. La infección con Wolbachia en las cepas W303 rho° y D723-10B rho° fue inestable, indicando la importancia en la integridad del genoma mitocondrial para la infección por Wolbachia. La transferencia (vertical/horizontal) de Wolbachia en los cultivos de S. cerevisiae no es perfecta. En wScW303, el 72 % del cultivo de levadura se encuentra infectado con un máximo de 6 bacterias por levadura. Wolbachia secuestra el metabolismo de S. cerevisiae W303: A las 6 horas de cultivo, la actividad fermentativa de la levadura aumenta, provocando un aumento de biomasa y un adelanto en la fase diáuxica. A 14 días de cultivo, la actividad respiratoria mitocondrial se ve anormalmente elevada en la levadura infectada. Finalmente, a los 16 días, las levaduras infectadas mueren abruptamente. Durante la infección en la levadura, no se detectaron proteínas de la cadena transportadora de electrones de Wolbachia. Se desarrolló un método para aislar a Wolbachia y se determinó que la bacteria aislada no consume oxígeno. Bajo las condiciones probadas en esta tesis, Wolbachia no presenta una CTE y por lo tanto no parece ser capaz de generar energía para el hospedero. LXXXVI 11. PERSPECTIVAS Wolbachia aumenta la tasa de respiración del hospedero infectado, sin embargo parece no contribuir con consumo de oxígeno. El análisis de los genomas del hospedero y del huésped sugieren que Wolbachia podría esta suplementando riboflavina y/o grupos hemos al hospedero, lo que provocaría un aumento en la actividad de la cadena transportadora de electrones. En nuestro grupo de investigación se propone infectar levaduras con mutaciones en las enzimas de las vías de síntesis de riboflavina para determinar si Wolbachia es capaz de revertir parcial o totalmente el efecto de dichas mutaciones. Las cepas de S. cerevisiae ∆rib no crecen en medios sin riboflavina. Si la infección con Wolbachia pueda revertir este fenómeno sería un indicativo de que Wolbachia suplementa a su hospedero con riboflavina. Los grupos FMN y FAD+ de los complejos respiratorios de la levadura se sintetizan a partir de riboflavina, por lo que una cepa carente de la vía de síntesis de riboflavina tiene una respiración nula. Si Wolbachia suplementa estos grupos, la levadura ∆rib podrá respirar y se podrá comprobar que Wolbachia puede suplementar con riboflavina al hospedero. A pesar de que en esta tesis se encontró que Wolbachia no posee una CTE con la capacidad de suplementar ATP al hospedero, no se exploró el metabolismo de Wolbachia. Por lo que se propone medir el aumento en el potencial transmembranal al agregar diferentes sustratos, principalmente sustratos fosforilados, ya que Wolbachia carece de las primeras enzimas de la glucólisis y posee transportadores de hexosas fosfato; y piruvato que ha sido propuestos como el sustrato principal de Wolbachia según el análisis de los genomas reportados a la fecha. Después proponemos definir si la F1F0-ATPasa carece de la subunidad inhibidora como se ha reportado para las α- proteobacterias endocelulares obligadas y que está de acuerdo con los genomas reportados. Posteriormente podemos analizar si en efecto la ATPasa puede hidrolizar el ATP para generar un potencial transmembranal que eventualmente puede utilizar para transportar aminoácidos, que, según todos los genomas reportados, Wolbachia es incapaz de sintetizar sus propios aminoácidos. Los mecanismos de transmisión horizontal de Wolbachia están poco estudiados. Este año se publicó el primer reporte que indica que Wolbachia utiliza el sistema de endocitosis mediada por de clatrina de las líneas celulares. En nuestro laboratorio buscamos definir el mecanismo de transferencia horizontal de Wolbachia entre levaduras. LXXXVII Wolbachia es capaz de manipular la endocitosis, el metabolismo y la longevidad de sus diferentes hospederos por lo que es de suma importancia explorar las modificaciones que provoca la infección con Wolbachia sobre las vías de señalización de rho GTPasas y mTor, responsables de proliferación, apoptosis y envejecimiento del hospedero. La activación o inhibición de estas vías de señalización puede evaluarse sencillamente con experimentos de proliferación y Western Blots contra las diferentes moléculas implicadas en las vías de señalización. LXXXVIII 12. BIBLIOGRAFÍA. Aguilar-Uscanga, B. y cols. (2003). "A study of the yeast cell wall composition and structure in response to growth conditions and mode of cultivation." Lett Appl Microbiol 37(3): 268-274. Ahmed, M. Z. y cols. (2016). "Evidence for common horizontal transmission of Wolbachia among butterflies and moths." BMC Evol Biol 16(1): 118. Akman, L. y cols. (2002). "Genome sequence of the endocellular obligate symbiont of tsetse flies, Wigglesworthia glossinidia." Nat Genet 32(3): 402-407. Alsmark, C. M. y cols. (2004). "The louse-borne human pathogen Bartonella quintana is a genomic derivative of the zoonotic agent Bartonella henselae." Proc Natl Acad Sci U S A 101(26): 9716-9721. Amuzu, H. E. y cols. (2016). "Wolbachia-Based Dengue Virus Inhibition Is Not Tissue-Specific in Aedes aegypti." PLoS Negl Trop Dis 10(11): e0005145. Andersson, S. G. y cols. (1998). "The genome sequence of Rickettsia prowazekii and the origin of mitochondria." Nature 396(6707): 133-140. Anraku, Y. (1987). Biochemistry and Molecular Biology of the Escherichia Coli Aerobic Respiratory Chain. Cytochrome Systems: Molecular Biology and Bioenergetics. Papa, S., Chance, B. yErnster, L. Boston, MA, Springer US: 565-574. Anraku, Y. (1988). "Bacterial electron transport chains." Annu Rev Biochem 57: 101-132. Avrahami-Moyal, L. y cols. (2012). "Overexpression of PDE2 or SSD1-V in Saccharomyces cerevisiae W303-1A strain renders it ethanol-tolerant." FEMS Yeast Res 12(4): 447-455. Bakhtiari, N. y cols. (1999). "Structure/function of the beta-barrel domain of F1- ATPase in the yeast Saccharomyces cerevisiae." J Biol Chem 274(23): 16363- 16369. Baldridge, G. D. y cols. (2014). "Proteomic profiling of a robust Wolbachia infection in an Aedes albopictus mosquito cell line." Mol Microbiol 94(3): 537-556. Ballard, J. W. y cols. (2007). "Tetracycline treatment influences mitochondrial metabolism and mtDNA density two generations after treatment in Drosophila." Insect Mol Biol 16(6): 799-802. Bandi, C. y cols. (1999). "Wolbachia genomes and the many faces of symbiosis." Parasitol Today 15(11): 428-429. LXXXIX Bandi, C. y cols. (2001). "Wolbachia in filarial nematodes: evolutionary aspects and implications for the pathogenesis and treatment of filarial diseases." Vet Parasitol 98(1-3): 215-238. Belda, E. y cols. (2012). "Metabolic networks of Sodalis glossinidius: a systems biology approach to reductive evolution." PLoS One 7(1): e30652. Berden, J. A. y cols. (1970). "The reaction of antimycin with a cytochrome b preparation active in reconstitution of the respiratory chain." Biochim Biophys Acta 216(2): 237-249. Bianciotto, V. y cols. (1996). "An obligately endosymbiotic mycorrhizal fungus itself harbors obligately intracellular bacteria." Appl Environ Microbiol 62(8): 3005-3010. Bianciotto, V. y cols. (2002). "Arbuscular mycorrhizal fungi: a specialised niche for rhizospheric and endocellular bacteria." Antonie Van Leeuwenhoek 81(1-4): 365- 371. Bjorkholm, B. y cols. (2000). "Helicobacter pylori entry into human gastric epithelial cells: A potential determinant of virulence, persistence, and treatment failures." Helicobacter 5(3): 148-154. Blagrove, M. S. y cols. (2013). "A Wolbachia wMel transinfection in Aedes albopictus is not detrimental to host fitness and inhibits Chikungunya virus." PLoS Negl Trop Dis 7(3): e2152. Bradford, M. M. (1976). "A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding." Anal Biochem 72: 248-254. Brattig, N. W. y cols. (2004). "The major surface protein of Wolbachia endosymbionts in filarial nematodes elicits immune responses through TLR2 and TLR4." J Immunol 173(1): 437-445. Brenner, K. y cols. (2008). "Engineering microbial consortia: a new frontier in synthetic biology." Trends Biotechnol 26(9): 483-489. Brownlie, J. C. y cols. (2009a). "Evidence for metabolic provisioning by a common invertebrate endosymbiont, Wolbachia pipientis, during periods of nutritional stress." PLoS Pathog 5(4): e1000368. Brownlie, J. C. y cols. (2009b). "Symbiont-mediated protection in insect hosts." Trends Microbiol 17(8): 348-354. Buchner, P. (1965). "Endosymbiosis of Animals with Plant Microorganims." Mycologia 60(2): 466-469. XC Cabrera-Orefice, A. y cols. (2014). "The branched mitochondrial respiratory chain from Debaryomyces hansenii: components and supramolecular organization." Biochim Biophys Acta 1837(1): 73-84. Capaldi, R. A. (1990). "Structure and assembly of cytochrome c oxidase." Arch Biochem Biophys 280(2): 252-262. Caragata, E. P. y cols. (2013). "Dietary cholesterol modulates pathogen blocking by Wolbachia." PLoS Pathog 9(6): e1003459. Caragata, E. P. y cols. (2014). "Competition for amino acids between Wolbachia and the mosquito host, Aedes aegypti." Microb Ecol 67(1): 205-218. Carroll, J. y cols. (2003). "Analysis of the subunit composition of complex I from bovine heart mitochondria." Mol Cell Proteomics 2(2): 117-126. Cecchini, G. (2003). "Function and structure of complex II of the respiratory chain." Annu Rev Biochem 72: 77-109. Chang, H. H. y cols. (2015). "Complete Genome Sequence of "Candidatus Sulcia muelleri" ML, an Obligate Nutritional Symbiont of Maize Leafhopper (Dalbulus maidis)." Genome Announc 3(1). Chen, X. P. y cols. (2015). "Detection of Wolbachia genes in a patient with non- Hodgkin's lymphoma." Clin Microbiol Infect 21(2): 182 e181-184. Chiquete-Felix, N. y cols. (2009). "In guinea pig sperm, aldolase A forms a complex with actin, WAS, and Arp2/3 that plays a role in actin polymerization." Reproduction 137(4): 669-678. Chrostek, E. y cols. (2017). "Horizontal Transmission of Intracellular Insect Symbionts via Plants." Front Microbiol 8: 2237. da Rocha Fernandes, M. y cols. (2014). "The modulation of the symbiont/host interaction between Wolbachia pipientis and Aedes fluviatilis embryos by glycogen metabolism." PLoS One 9(6): e98966. Dale, C. y cols. (1999). "Sodalis gen. nov. and Sodalis glossinidius sp. nov., a microaerophilic secondary endosymbiont of the tsetse fly Glossina morsitans morsitans." Int J Syst Bacteriol 49 Pt 1: 267-275. Dale, C. y cols. (2006). "Molecular interactions between bacterial symbionts and their hosts." Cell 126(3): 453-465. Darby, A. C. y cols. (2012). "Analysis of gene expression from the Wolbachia genome of a filarial nematode supports both metabolic and defensive roles within the symbiosis." Genome Res 22(12): 2467-2477. XCI Darby, A. C. y cols. (2014). "Integrated transcriptomic and proteomic analysis of the global response of Wolbachia to doxycycline-induced stress." ISME J 8(4): 925- 937. Davies, K. M. y cols. (2012). "Structure of the yeast F1Fo-ATP synthase dimer and its role in shaping the mitochondrial cristae." Proc Natl Acad Sci U S A 109(34): 13602-13607. de Boer, W. y cols. (2004). "Collimonas fungivorans gen. nov., sp. nov., a chitinolytic soil bacterium with the ability to grow on living fungal hyphae." Int J Syst Evol Microbiol 54(Pt 3): 857-864. Degli Esposti, M. (1998). "Inhibitors of NADH-ubiquinone reductase: an overview." Biochim Biophys Acta 1364(2): 222-235. Degnan, P. H. y cols. (2005). "Genome sequence of Blochmannia pennsylvanicus indicates parallel evolutionary trends among bacterial mutualists of insects." Genome Res 15(8): 1023-1033. Dimijian, G. G. (2000). "Evolving together: the biology of symbiosis, part 1." Proc (Bayl Univ Med Cent) 13(3): 217-226. Dobson, S. L. y cols. (2002). "Characterization of Wolbachia host cell range via the in vitro establishment of infections." Appl Environ Microbiol 68(2): 656-660. Douglas, A. E. (2015). "Multiorganismal insects: diversity and function of resident microorganisms." Annu Rev Entomol 60: 17-34. Drose, S. y cols. (2008). "The mechanism of mitochondrial superoxide production by the cytochrome bc1 complex." J Biol Chem 283(31): 21649-21654. Dryer RL, T. A., Routh JI (1956). "The determination of phosphorus and phosphatase with N-phenyl-p-phenylendiamine." J Biol Chem 225: 177-183. Dubois, A. y cols. (2007). "Helicobacter pylori is invasive and it may be a facultative intracellular organism." Cell Microbiol 9(5): 1108-1116. Dutra, H. L. y cols. (2016). "Wolbachia Blocks Currently Circulating Zika Virus Isolates in Brazilian Aedes aegypti Mosquitoes." Cell Host Microbe. Elliott, A. y cols. (2013). "Coxiella burnetii interaction with neutrophils and macrophages in vitro and in SCID mice following aerosol infection." Infect Immun 81(12): 4604-4614. Emelyanov, V. V. (2003). "Common evolutionary origin of mitochondrial and rickettsial respiratory chains." Arch Biochem Biophys 420(1): 130-141. Evans, O. y cols. (2009). "Increased locomotor activity and metabolism of Aedes aegypti infected with a life-shortening strain of Wolbachia pipientis." J Exp Biol 212(Pt 10): 1436-1441. XCII Fallon, A. M. (2008). "Cytological properties of an Aedes albopictus mosquito cell line infected with Wolbachia strain wAlbB." In Vitro Cell Dev Biol Anim 44(5-6): 154-161. Fallon, A. M. (2014). "Flow cytometric evaluation of the intracellular bacterium, Wolbachia pipientis, in mosquito cells." J Microbiol Methods 107: 119-125. Fallon, A. M. y cols. (2013). "The oxidizing agent, paraquat, is more toxic to Wolbachia than to mosquito host cells." In Vitro Cell Dev Biol Anim 49(7): 501- 507. Fenn, K. y cols. (2004). "Are filarial nematode Wolbachia obligate mutualist symbionts?" Trends Ecol Evol 19(4): 163-166. Foster, J. y cols. (2005). "The Wolbachia genome of Brugia malayi: endosymbiont evolution within a human pathogenic nematode." PLoS Biol 3(4): e121. French, K. E. (2017). "Engineering Mycorrhizal Symbioses to Alter Plant Metabolism and Improve Crop Health." Front Microbiol 8: 1403. Frey-Klett, P. y cols. (2011). "Bacterial-fungal interactions: hyphens between agricultural, clinical, environmental, and food microbiologists." Microbiol Mol Biol Rev 75(4): 583-609. Garcia-Trejo, J. J. y cols. (2016). "The Inhibitory Mechanism of the zeta Subunit of the F1FO-ATPase Nanomotor of Paracoccus denitrificans and Related alpha- Proteobacteria." J Biol Chem 291(2): 538-546. Gasch, A. P. (2002). "Yeast genomic expression studies using DNA microarrays." Methods Enzymol 350: 393-414. Gasch, A. P. y cols. (2002). "The genomics of yeast responses to environmental stress and starvation." Funct Integr Genomics 2(4-5): 181-192. Geier, B. M. y cols. (1995). "Kinetic properties and ligand binding of the eleven- subunit cytochrome-c oxidase from Saccharomyces cerevisiae isolated with a novel large-scale purification method." Eur J Biochem 227(1-2): 296-302. Genty, L. M. y cols. (2014). "Wolbachia infect ovaries in the course of their maturation: last minute passengers and priority travellers?" PLoS One 9(4): e94577. Gil, R. y cols. (2003). "The genome sequence of Blochmannia floridanus: comparative analysis of reduced genomes." Proc Natl Acad Sci U S A 100(16): 9388-9393. Glaser, R. L. y cols. (2010). "The native Wolbachia endosymbionts of Drosophila melanogaster and Culex quinquefasciatus increase host resistance to West Nile virus infection." PLoS One 5(8): e11977. XCIII Gornall, A. G. y cols. (1949). "Determination of serum proteins by means of the biuret reaction." J Biol Chem 177(2): 751-766. Green, D. E. y cols. (1959). "Studies on the elecron transport system. XIV. The isolation and properties of soluble cytochrome c1." Biochim Biophys Acta 31(1): 34-46. Gutierrez-Aguilar, M. y cols. (2014). "Effects of ubiquinone derivatives on the mitochondrial unselective channel of Saccharomyces cerevisiae." J Bioenerg Biomembr 46(6): 519-527. Hagerhall, C. (1997). "Succinate: quinone oxidoreductases. Variations on a conserved theme." Biochim Biophys Acta 1320(2): 107-141. Heddi, A. y cols. (1999). "Four intracellular genomes direct weevil biology: nuclear, mitochondrial, principal endosymbiont, and Wolbachia." Proc Natl Acad Sci U S A 96(12): 6814-6819. Heddi A, L. F., Nardon P (1993). "Effect of endocytobiotic bacteria on mitochondrial enzymatic activities in the weevil Sitophilus oryzae (Coleoptera: Curculionidae)." Insect Biochemistry and Molecular Biology 23(3): 8. Hedges, L. M. y cols. (2008). "Wolbachia and virus protection in insects." Science 322(5902): 702. Hoffman, M. T. y cols. (2010). "Diverse bacteria inhabit living hyphae of phylogenetically diverse fungal endophytes." Appl Environ Microbiol 76(12): 4063-4075. Hoffmann, A. A. y cols. (2011). "Successful establishment of Wolbachia in Aedes populations to suppress dengue transmission." Nature 476(7361): 454-457. Hosoda, K. y cols. (2011a). "Cooperative adaptation to establishment of a synthetic bacterial mutualism." PLoS One 6(2): e17105. Hosoda, K. y cols. (2011b). "Designing symbiosis." Bioeng Bugs 2(6): 338-341. Hughes, G. L. y cols. (2011). "Wolbachia infections are virulent and inhibit the human malaria parasite Plasmodium falciparum in Anopheles gambiae." PLoS Pathog 7(5): e1002043. Hughes, G. L. y cols. (2012). "Wolbachia strain wAlbB enhances infection by the rodent malaria parasite Plasmodium berghei in Anopheles gambiae mosquitoes." Appl Environ Microbiol 78(5): 1491-1495. Hussain, M. y cols. (2013). "Effect of Wolbachia on replication of West Nile virus in a mosquito cell line and adult mosquitoes." J Virol 87(2): 851-858. XCIV Ingledew, W. J. y cols. (1984). "The respiratory chains of Escherichia coli." Microbiol Rev 48(3): 222-271. Iturbe-Ormaetxe, I. y cols. (2011). "A simple protocol to obtain highly pure Wolbachia endosymbiont DNA for genome sequencing." J Microbiol Methods 84(1): 134-136. Iwata, S. (1998). "Structure and function of bacterial cytochrome c oxidase." J Biochem 123(3): 369-375. Iwata, S. y cols. (1998). "Complete structure of the 11-subunit bovine mitochondrial cytochrome bc1 complex." Science 281(5373): 64-71. Jeyaprakash, A. y cols. (2000). "Long PCR improves Wolbachia DNA amplification: wsp sequences found in 76% of sixty-three arthropod species." Insect Mol Biol 9(4): 393-405. Johnson, K. N. (2015). "The Impact of Wolbachia on Virus Infection in Mosquitoes." Viruses 7(11): 5705-5717. Johnston, K. L. y cols. (2010). "Lipoprotein biosynthesis as a target for anti- Wolbachia treatment of filarial nematodes." Parasit Vectors 3: 99. Jonckheere, A. I. y cols. (2012). "Mitochondrial ATP synthase: architecture, function and pathology." J Inherit Metab Dis 35(2): 211-225. Juarez, O. y cols. (2004). "The mitochondrial respiratory chain of Ustilago maydis." Biochim Biophys Acta 1658(3): 244-251. Kambris, Z. y cols. (2010). "Wolbachia stimulates immune gene expression and inhibits plasmodium development in Anopheles gambiae." PLoS Pathog 6(10): e1001143. Kang, S. W. y cols. (2009). "Symbiotic relationship between Microbacterium sp. SK0812 and Candida tropicalis SK090404." J Microbiol 47(6): 721-727. Kerscher, S. y cols. (2008). "The three families of respiratory NADH dehydrogenases." Results Probl Cell Differ 45: 185-222. Kerscher, S. y cols. (2001). "Exploring the catalytic core of complex I by Yarrowia lipolytica yeast genetics." J Bioenerg Biomembr 33(3): 187-196. Kerscher, S. J. y cols. (1999). "A single external enzyme confers alternative NADH:ubiquinone oxidoreductase activity in Yarrowia lipolytica." J Cell Sci 112 ( Pt 14): 2347-2354. Khoo, C. C. y cols. (2013). "Infection, growth and maintenance of Wolbachia pipientis in clonal and non-clonal Aedes albopictus cell cultures." Bull Entomol Res 103(3): 251-260. XCV Klasson, L. y cols. (2008). "Genome evolution of Wolbachia strain wPip from the Culex pipiens group." Mol Biol Evol 25(9): 1877-1887. Kobialka, M. y cols. (2016). "Sulcia symbiont of the leafhopper Macrosteles laevis (Ribaut, 1927) (Insecta, Hemiptera, Cicadellidae: Deltocephalinae) harbors Arsenophonus bacteria." Protoplasma 253(3): 903-912. Krause, D. C. y cols. (1985). "Cloning and expression of the Rickettsia prowazekii ADP/ATP translocator in Escherichia coli." Proc Natl Acad Sci U S A 82(9): 3015- 3019. Laemmli, U. K. (1970). "Cleavage of structural proteins during the assembly of the head of bacteriophage T4." Nature 227(5259): 680-685. Lamarque, D. y cols. (2003). "Pathogenesis of Helicobacter pylori infection." Helicobacter 8 Suppl 1: 21-30. Lamelas, A. y cols. (2011). "New clues about the evolutionary history of metabolic losses in bacterial endosymbionts, provided by the genome of Buchnera aphidicola from the aphid Cinara tujafilina." Appl Environ Microbiol 77(13): 4446-4454. Lange, C. y cols. (2002). "Crystal structure of the yeast cytochrome bc1 complex with its bound substrate cytochrome c." Proc Natl Acad Sci U S A 99(5): 2800- 2805. Langworthy, N. G. y cols. (2000). "Macrofilaricidal activity of tetracycline against the filarial nematode Onchocerca ochengi: elimination of Wolbachia precedes worm death and suggests a dependent relationship." Proc Biol Sci 267(1448): 1063-1069. Lehninger (2013). Principles of Biochemistry. New York, W. H. FREEMAN. Lehninger, A. L., David L. Nelson, and Michael M. Cox. (2000). Lehninger Principles of Biochemistry, New York: Worth Publishers. Levine, M. M. (1987). "Escherichia coli that cause diarrhea: enterotoxigenic, enteropathogenic, enteroinvasive, enterohemorrhagic, and enteroadherent." J Infect Dis 155(3): 377-389. Li, S. J. y cols. (2017). "Plantmediated horizontal transmission of Wolbachia between whiteflies." ISME J 11(4): 1019-1028. Lo Nathan, C. M., Salati Emanuela, Bazzocchi Chiara, Bandi (2002). " How many Wolbachia supergroups exist?" Molecular Biology and Evolution 19(3): 341–346. Lopez-Madrigal, S. y cols. (2011). "Complete genome sequence of "Candidatus Tremblaya princeps" strain PCVAL, an intriguing translational machine below the living-cell status." J Bacteriol 193(19): 5587-5588. XCVI Loreto, E. L. y cols. (2016). "Risks of Wolbachia mosquito control." Science 351(6279): 1273. Loyola-Machado, A. C. y cols. (2017). "The Symbiotic Bacterium Fuels the Energy Metabolism of the Host Trypanosomatid Strigomonas culicis." Protist 168(2): 253- 269. Lu, L. y cols. (2003). "Rsf1p, a protein required for respiratory growth of Saccharomyces cerevisiae." Curr Genet 43(4): 263-272. Lumini, E. y cols. (2007). "Presymbiotic growth and sporal morphology are affected in the arbuscular mycorrhizal fungus Gigaspora margarita cured of its endobacteria." Cell Microbiol 9(7): 1716-1729. Malke, H. (1964). "Production of Aposymbiotic Cockroaches by Means of Lysozyme." Nature 204: 1223-1224. Mason, T. L. y cols. (1973). "Cytochrome c oxidase from bakers' yeast. I. Isolation and properties." J Biol Chem 248(4): 1346-1354. Matthew, C. Z. y cols. (2005). "The rapid isolation and growth dynamics of the tsetse symbiont Sodalis glossinidius." FEMS Microbiol Lett 248(1): 69-74. Mavingui, P. y cols. (2012). "Whole-genome sequence of Wolbachia strain wAlbB, an endosymbiont of tiger mosquito vector Aedes albopictus." J Bacteriol 194(7): 1840. McCutcheon, J. P. y cols. (2009). "Origin of an alternative genetic code in the extremely small and GC-rich genome of a bacterial symbiont." PLoS Genet 5(7): e1000565. McCutcheon, J. P. y cols. (2012). "Extreme genome reduction in symbiotic bacteria." Nat Rev Microbiol 10(1): 13-26. McCutcheon, J. P. y cols. (2011). "An interdependent metabolic patchwork in the nested symbiosis of mealybugs." Curr Biol 21(16): 1366-1372. McLeod, M. P. y cols. (2004). "Complete genome sequence of Rickettsia typhi and comparison with sequences of other rickettsiae." J Bacteriol 186(17): 5842-5855. McMeniman, C. J. y cols. (2009). "Stable introduction of a life-shortening Wolbachia infection into the mosquito Aedes aegypti." Science 323(5910): 141-144. McMeniman, C. J. y cols. (2010). "A virulent Wolbachia infection decreases the viability of the dengue vector Aedes aegypti during periods of embryonic quiescence." PLoS Negl Trop Dis 4(7): e748. Mee, M. T. y cols. (2012). "Engineering ecosystems and synthetic ecologies." Mol Biosyst 8(10): 2470-2483. XCVII Melnikow, E. y cols. (2013). "A potential role for the interaction of Wolbachia surface proteins with the Brugia malayi glycolytic enzymes and cytoskeleton in maintenance of endosymbiosis." PLoS Negl Trop Dis 7(4): e2151. Metcalf, J. A. y cols. (2014). "Recent genome reduction of Wolbachia in Drosophila recens targets phage WO and narrows candidates for reproductive parasitism." PeerJ 2: e529. Mitchell, P. (1966). "Chemiosmotic coupling in oxidative and photosynthetic phosphorylation." Biol Rev Camb Philos Soc 41(3): 445-502. Momeni, B. y cols. (2011). "Using artificial systems to explore the ecology and evolution of symbioses." Cell Mol Life Sci 68(8): 1353-1368. Montanari, A. y cols. (2014). "Strain-specific nuclear genetic background differentially affects mitochondria-related phenotypes in Saccharomyces cerevisiae." Microbiologyopen 3(3): 288-298. Montecucco, C. y cols. (2001). "Living dangerously: how Helicobacter pylori survives in the human stomach." Nat Rev Mol Cell Biol 2(6): 457-466. Morales-Rios, E. y cols. (2010). "A novel 11-kDa inhibitory subunit in the F1FO ATP synthase of Paracoccus denitrificans and related alpha-proteobacteria." FASEB J 24(2): 599-608. Morales-Rios, E. y cols. (2015). "Structure of ATP synthase from Paracoccus denitrificans determined by X-ray crystallography at 4.0 A resolution." Proc Natl Acad Sci U S A 112(43): 13231-13236. Moreira, L. A. y cols. (2009). "A Wolbachia symbiont in Aedes aegypti limits infection with dengue, Chikungunya, and Plasmodium." Cell 139(7): 1268-1278. Moss, C. y cols. (2003). "Intracellular bacteria associated with the ascidian Ecteinascidia turbinata: phylogenetic and in situ hybridisation analysis." Marine Biology 143(1): 99-110. Moulder, J. W. (1991). "Interaction of chlamydiae and host cells in vitro." Microbiol Rev 55(1): 143-190. Mousson, L. y cols. (2010). "Wolbachia modulates Chikungunya replication in Aedes albopictus." Mol Ecol 19(9): 1953-1964. Mowery, P. C. y cols. (1977). "Inhibition of mammalian succinate dehydrogenase by carboxins." Arch Biochem Biophys 178(2): 495-506. Nakabachi, A. y cols. (2006). "The 160-kilobase genome of the bacterial endosymbiont Carsonella." Science 314(5797): 267. Noda, H. y cols. (2002). "In vitro cultivation of Wolbachia in insect and mammalian cell lines." In Vitro Cell Dev Biol Anim 38(7): 423-427. XCVIII O'Neill, S. L. y cols. (1997). "In vitro cultivation of Wolbachia pipientis in an Aedes albopictus cell line." Insect Mol Biol 6(1): 33-39. Omsland, A. y cols. (2013). "Bringing culture to the uncultured: Coxiella burnetii and lessons for obligate intracellular bacterial pathogens." PLoS Pathog 9(9): e1003540. Omsland, A. y cols. (2014). "Chlamydial metabolism revisited: interspecies metabolic variability and developmental stage-specific physiologic activities." FEMS Microbiol Rev 38(4): 779-801. Osyczka, A. y cols. (2005). "Fixing the Q cycle." Trends Biochem Sci 30(4): 176-182. Pan, X. y cols. (2012). "Wolbachia induces reactive oxygen species (ROS)- dependent activation of the Toll pathway to control dengue virus in the mosquito Aedes aegypti." Proc Natl Acad Sci U S A 109(1): E23-31. Partida-Martinez, L. P. y cols. (2007a). "Rhizonin, the first mycotoxin isolated from the zygomycota, is not a fungal metabolite but is produced by bacterial endosymbionts." Appl Environ Microbiol 73(3): 793-797. Partida-Martinez, L. P. y cols. (2005). "Pathogenic fungus harbours endosymbiotic bacteria for toxin production." Nature 437(7060): 884-888. Partida-Martinez, L. P. y cols. (2007b). "Endosymbiont-dependent host reproduction maintains bacterial-fungal mutualism." Curr Biol 17(9): 773-777. Pena, A. y cols. (1977). "A novel method for the rapid preparation of coupled yeast mitochondria." FEBS Lett 80(1): 209-213. Pietri, J. E. y cols. (2016). "The rich somatic life of Wolbachia." Microbiologyopen 5(6): 923-936. Potter, M. y cols. (2016). "Monitoring Intracellular Oxygen Concentration: Implications for Hypoxia Studies and Real-Time Oxygen Monitoring." Adv Exp Med Biol 876: 257-263. Ramsay, R. R. y cols. (1981). "Reaction site of carboxanilides and of thenoyltrifluoroacetone in complex II." Proc Natl Acad Sci U S A 78(2): 825-828. Rao, R. U. y cols. (2002). "Brugia malayi: effects of antibacterial agents on larval viability and development in vitro." Exp Parasitol 101(1): 77-81. Raquin, V. y cols. (2015). "Native Wolbachia from Aedes albopictus Blocks Chikungunya Virus Infection In Cellulo." PLoS One 10(4): e0125066. Rasgon, J. L. y cols. (2006). "Survival of Wolbachia pipientis in cell-free medium." Appl Environ Microbiol 72(11): 6934-6937. XCIX Robinson, G. C. y cols. (2013). "The structure of F(1)-ATPase from Saccharomyces cerevisiae inhibited by its regulatory protein IF(1)." Open Biol 3(2): 120164. Rosas-Lemus, M., Uribe-Alvarez, C., Contreras-Zentella M., Luévano-Martínez, L.A., Chiquete-Félix, N., Espinosa-Simón, E. Muhlia-Almazán, A., Escamilla-Marván, E., Uribe-Carvajal, S. (2016). Oxygen: From Toxic Waste to potimal (Toxic) Fuel of Life. Sabree, Z. L. y cols. (2009). "Nitrogen recycling and nutritional provisioning by Blattabacterium, the cockroach endosymbiont." Proc Natl Acad Sci U S A 106(46): 19521-19526. Salmanian, A. H. y cols. (2008). "Yeast of the oral cavity is the reservoir of Heliobacter pylori." J Oral Pathol Med 37(6): 324-328. Salzberg, S. L. y cols. (2009). "Genome sequence of the Wolbachia endosymbiont of Culex quinquefasciatus JHB." J Bacteriol 191(5): 1725. Saniee, P. y cols. (2013a). "Immunodetection of Helicobacter pylori-specific proteins in oral and gastric Candida yeasts." Arch Iran Med 16(11): 624-630. Saniee, P. y cols. (2013b). "Localization of H.pylori within the vacuole of Candida yeast by direct immunofluorescence technique." Arch Iran Med 16(12): 705-710. Sato, Y. y cols. (2010). "Detection of betaproteobacteria inside the mycelium of the fungus Mortierella elongata." Microbes Environ 25(4): 321-324. Sazanov, L. A. (2015). "A giant molecular proton pump: structure and mechanism of respiratory complex I." Nat Rev Mol Cell Biol 16(6): 375-388. Sazanov, L. A. y cols. (2006). "Structure of the hydrophilic domain of respiratory complex I from Thermus thermophilus." Science 311(5766): 1430-1436. Scientific, G. T. (2017). Growth and maintenance of insect cell lines USER GUIDE: 42. Schagger, H. (2002). "Respiratory chain supercomplexes of mitochondria and bacteria." Biochim Biophys Acta 1555(1-3): 154-159. Schägger, H. (1994). Denaturing electrophoretic techniques. A Practical Guide to Membrane Protein Purification Schagger, G. V. J. a. H. San Diego, California, Academic Press: 166. Scherlach, K. y cols. (2006). "Antimitotic rhizoxin derivatives from a cultured bacterial endosymbiont of the rice pathogenic fungus Rhizopus microsporus." J Am Chem Soc 128(35): 11529-11536. Schneiker, S. y cols. (2007). "Complete genome sequence of the myxobacterium Sorangium cellulosum." Nat Biotechnol 25(11): 1281-1289. C Schofield, M. M. y cols. (2015). "Identification and analysis of the bacterial endosymbiont specialized for production of the chemotherapeutic natural product ET-743." Environ Microbiol 17(10): 3964-3975. Schonbaum, G. R. y cols. (1971). "Specific inhibition of the cyanide-insensitive respiratory pathway in plant mitochondria by hydroxamic acids." Plant Physiol 47(1): 124-128. Shevchenko, A. y cols. (2006). "In-gel digestion for mass spectrometric characterization of proteins and proteomes." Nat Protoc 1(6): 2856-2860. Shih, K. M. y cols. (1998). "Culture of mosquito cells in Eagle's medium." In Vitro Cell Dev Biol Anim 34(8): 629-630. Shiny, C. y cols. (2009). "Serum antibody responses to Wolbachia surface protein in patients with human lymphatic filariasis." Microbiol Immunol 53(12): 685-693. Siavoshi, F. y cols. (2005a). "Helicobacter pylori endemic and gastric disease." Dig Dis Sci 50(11): 2075-2080. Siavoshi, F. y cols. (2005b). "Detection of Helicobacter pylori-specific genes in the oral yeast." Helicobacter 10(4): 318-322. Smith, A. E. y cols. (2000). "The mechanical properties of Saccharomyces cerevisiae." Proc Natl Acad Sci U S A 97(18): 9871-9874. Smith, P. M. y cols. (2012). "Reprint of: Biogenesis of the cytochrome bc(1) complex and role of assembly factors." Biochim Biophys Acta 1817(6): 872-882. Solmaz, S. R. y cols. (2008). "Structure of complex III with bound cytochrome c in reduced state and definition of a minimal core interface for electron transfer." J Biol Chem 283(25): 17542-17549. Steffens, G. C. y cols. (1987). "Cytochrome c oxidase is a three-copper, two-heme-A protein." Eur J Biochem 164(2): 295-300. Stenmark, P. y cols. (2003). "A prokaryotic alternative oxidase present in the bacterium Novosphingobium aromaticivorans." FEBS Lett 552(2-3): 189-192. Stepkowski, T. y cols. (2001). "Reduction of bacterial genome size and expansion resulting from obligate intracellular lifestyle and adaptation to soil habitat." Acta Biochim Pol 48(2): 367-381. Stewart, E. J. (2012). "Growing unculturable bacteria." J Bacteriol 194(16): 4151- 4160. Stolpe, S. y cols. (2004). "The Escherichia coli NADH:ubiquinone oxidoreductase (complex I) is a primary proton pump but may be capable of secondary sodium antiport." J Biol Chem 279(18): 18377-18383. CI Storey, B. T. (1976). "Respiratory Chain of Plant Mitochondria: XVIII. Point of Interaction of the Alternate Oxidase with the Respiratory Chain." Plant Physiol 58(4): 521-525. Strubing, U. y cols. (2010). "Mitochondrial genes for heme-dependent respiratory chain complexes are up-regulated after depletion of Wolbachia from filarial nematodes." Int J Parasitol 40(10): 1193-1202. Sukumaran, S. K. y cols. (2003). "Entry and intracellular replication of Escherichia coli K1 in macrophages require expression of outer membrane protein A." Infect Immun 71(10): 5951-5961. Sun, F. y cols. (2005). "Crystal structure of mitochondrial respiratory membrane protein complex II." Cell 121(7): 1043-1057. Sun, X. Y. y cols. (2015). "Copper Tolerance and Biosorption of Saccharomyces cerevisiae during Alcoholic Fermentation." PLoS One 10(6): e0128611. Tamames, J. y cols. (2007). "The frontier between cell and organelle: genome analysis of Candidatus Carsonella ruddii." BMC Evol Biol 7: 181. Taylor, M. J. y cols. (1999). "Wolbachia bacteria of filarial nematodes." Parasitol Today 15(11): 437-442. Terradas, G. y cols. (2017). "The RNAi pathway plays a small part in Wolbachia- mediated blocking of dengue virus in mosquito cells." Sci Rep 7: 43847. Tortosa, P. y cols. (2008). "Chikungunya-Wolbachia interplay in Aedes albopictus." Insect Mol Biol 17(6): 677-684. Trumpower, B. L. (1990). "Cytochrome bc1 complexes of microorganisms." Microbiol Rev 54(2): 101-129. Tsukihara, T. y cols. (1996). "The whole structure of the 13-subunit oxidized cytochrome c oxidase at 2.8 A." Science 272(5265): 1136-1144. Unden, G. y cols. (1997). "Alternative respiratory pathways of Escherichia coli: energetics and transcriptional regulation in response to electron acceptors." Biochim Biophys Acta 1320(3): 217-234. Uribe-Alvarez, C. y cols. (2016). "Staphylococcus epidermidis: metabolic adaptation and biofilm formation in response to different oxygen concentrations." Pathog Dis 74(1): ftv111. Uribe-Alvarez, C. y cols. (2018). "Wolbachia pipientis grows in Saccharomyces cerevisiae evoking early death of the host and deregulation of mitochondrial metabolism." Microbiologyopen: e00675. CII Uribe-Carvajal, S., Guerrero-Castillo, S., King-Diaz, B., Hennsen, B.L. (2008). "Allelochemicals targeting the phospholipid bilayer and the proteins of biological membranes." Allelopathy Journal 21(1): 1-24 Vallenet, D. y cols. (2009). "MicroScope: a platform for microbial genome annotation and comparative genomics." Database (Oxford) 2009: bap021. Vieira-Silva, S. y cols. (2010). "The systemic imprint of growth and its uses in ecological (meta)genomics." PLoS Genet 6(1): e1000808. Voronin, D. y cols. (2016). "Glucose and Glycogen Metabolism in Brugia malayi Is Associated with Wolbachia Symbiont Fitness." PLoS One 11(4): e0153812. Walker, J. E. (1992). "The NADH:ubiquinone oxidoreductase (complex I) of respiratory chains." Q Rev Biophys 25(3): 253-324. Walker, T. y cols. (2011). "The wMel Wolbachia strain blocks dengue and invades caged Aedes aegypti populations." Nature 476(7361): 450-453. Watt, I. N. y cols. (2010). "Bioenergetic cost of making an adenosine triphosphate molecule in animal mitochondria." Proc Natl Acad Sci U S A 107(39): 16823- 16827. Weiss, E. (1973). "Growth and physiology of rickettsiae." Bacteriol Rev 37(3): 259- 283. Werren, J. H. (1997). "Biology of Wolbachia." Annu Rev Entomol 42: 587-609. Werren, J. H. y cols. (2008). "Wolbachia: master manipulators of invertebrate biology." Nat Rev Microbiol 6(10): 741-751. White, P. M. y cols. (2017). "Mechanisms of Horizontal Cell-to-Cell Transfer of Wolbachia spp. in Drosophila melanogaster." Appl Environ Microbiol 83(7). White, T. J., Bruns, T. Lee, S. J. W. T., Taylor, J. W. (1990). "Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics." PCR protocols: a guide to methods and applications 18(1): 315-322. WHO, W. H. O. (2016). World Malaria Report 2016, License: CC BY-NC-SA 3.0 IGO: 186. WHO, W. H. O. (2017). Dengue and severe Dengue Fact Sheet. Winkler, H. H. (1976). "Rickettsial permeability. An ADP-ATP transport system." J Biol Chem 251(2): 389-396. Winner, H. I. (1969). "The transition from commensalism to parasitism." Br J Dermatol 81: Suppl 1:62+. CIII Wittig, I. y cols. (2010). "Mass estimation of native proteins by blue native electrophoresis: principles and practical hints." Mol Cell Proteomics 9(10): 2149- 2161. Wittig, I. y cols. (2006). "Blue native PAGE." Nat Protoc 1(1): 418-428. Wood, D. O. y cols. (2012). "Establishment of a replicating plasmid in Rickettsia prowazekii." PLoS One 7(4): e34715. Wu, D. y cols. (2006). "Metabolic complementarity and genomics of the dual bacterial symbiosis of sharpshooters." PLoS Biol 4(6): e188. Wu, M. y cols. (2004). "Phylogenomics of the reproductive parasite Wolbachia pipientis wMel: a streamlined genome overrun by mobile genetic elements." PLoS Biol 2(3): E69. Xia, D. y cols. (1997). "Crystal structure of the cytochrome bc1 complex from bovine heart mitochondria." Science 277(5322): 60-66. Yang, X. H. y cols. (1986). "Purification of a three-subunit ubiquinol-cytochrome c oxidoreductase complex from Paracoccus denitrificans." J Biol Chem 261(26): 12282-12289. Yankovskaya, V. y cols. (2003). "Architecture of succinate dehydrogenase and reactive oxygen species generation." Science 299(5607): 700-704. Yoon, J. y cols. (2009). "Characterization of antimicrobial activity of the lysosomes isolated from Saccharomyces cerevisiae." Curr Microbiol 59(1): 48-52. Yoshikawa, S. y cols. (1990). "Infrared evidence of cyanide binding to iron and copper sites in bovine heart cytochrome c oxidase. Implications regarding oxygen reduction." J Biol Chem 265(14): 7945-7958. Zannoni, D. (2008). Respiration in Archaea and Bacteria: Diversity of Prokaryotic Respiratory Systems, Springer Netherlands. Zarco-Zavala, M. y cols. (2014). "The zeta subunit of the F1FO-ATP synthase of alpha-proteobacteria controls rotation of the nanomotor with a different structure." FASEB J 28(5): 2146-2157. Zendehdel, N. y cols. (2005). "Helicobacter pylori reinfection rate 3 years after successful eradication." J Gastroenterol Hepatol 20(3): 401-404. Zhang, Z. y cols. (1998). "Electron transfer by domain movement in cytochrome bc1." Nature 392(6677): 677-684. Zhou, W. y cols. (1998). "Phylogeny and PCR-based classification of Wolbachia strains using wsp gene sequences." Proc Biol Sci 265(1395): 509-515. CIV Zhu, J. y cols. (2016). "Structure of mammalian respiratory complex I." Nature 536(7616): 354-358. Zickermann, V. y cols. (2000). "The NADH oxidation domain of complex I: do bacterial and mitochondrial enzymes catalyze ferricyanide reduction similarly?" Biochim Biophys Acta 1459(1): 61-68. Zickermann, V. y cols. (2015). "Structural biology. Mechanistic insight from the crystal structure of mitochondrial complex I." Science 347(6217): 44-49. Zouache, K. y cols. (2012). "Chikungunya virus impacts the diversity of symbiotic bacteria in mosquito vector." Mol Ecol 21(9): 2297-2309. CV 12. Anexos Anexo A. Abreviaturas ANT Translocador de adenin nucleótidos AntA Antimicina A AOX Oxidasa alterna BN-PAGE Electroforesis azul nativa en geles de poliacrilamida BHI Medio corazón-cerebro BHM Mitocondria de corazón de bovino CCCP Carbonilcianuro m-clorofenilhidrazona CitFe Citrato Férrico Amoniacal CN-PAGE Electroforesis clara nativa en geles de poliacrilamida COX Citocromo c oxidasa CR Control respiratorio CTE Cadena transportadora de electrones DAB 3´,5´-diaminobencidina DMSO Dimetilsulfóxido DO Densidad óptica DOC Desoxicolato de sodio EIM Espacio Intermembranal FAD Flavinadenindinucleótido FISH Hibridación in-situ con sondas fluorescentes FMN Mononucleótido de flavina G3P Glicerol-3-fosfato G6P Gluoca-6-fosfato hrCN-PAGE Electroforesis clara nativa de alta resolución en geles de poliacrilamida HEPES Ácido (4-(2-hidroxietil)-1-piperazinaetanosulfónico LM n-dodecil--D-maltósido M Mitocondria MAT Matriz mitocondrial Mbp Millones de pares de bases CVI MEM Medio Mínimo de Eagle MES Ácido 2-(N-morfolino) etanosulfónico MM Medio Mitsuhashi-Maramorosh MMFeS Medio líquido Mitsuhashi-Maramorosh/Suero bovino fetal/Citrato férrico amoniacal MMFeSS Medio sólido Mitsuhashi-Maramorosh/Suero bovino fetal/Citrato férrico amoniacal NBT Bromuro de nitro-azul de tetrazolio NDH NADH deshidrogenasa NDH2 NADH deshidrogenasa tipo II O2 Oxígeno PDB ProteinDatabank PFK Fosfofructocinasa Pir-Mal Piruvato-Malato PK PiruvatoCinasa PTM Potencial transmembranal Q Quinona QH2 Quinol ROS Especies reactivas de oxígeno Rot Rotenona SBF Suero Bovino Fetal ScW303 Saccharomyces cerevisiae W303 Succ Succinato TEA Trietanolamina TEMED N,N,N´,N´-tetrametiletilendiamina UQ Ubiquinona VDAC Canal de aniones dependientes de voltaje wAlbB Wolbachia de AedesalbopictuswAlbB wBm Wolbachia de Brugiamalayi wScW303 Saccharomyces cerevisiae W303 infectada con Wolbachia YPD Extracto de levadura/peptona/dextrosa YPDS Extracto de levadura/peptona/dextrosa/SBF/Citrato Férrico Amoniacal C V II A ne xo B . C om pa ra ci ón d e ge no m as d e W o lb a ch ia u ti li za nd o la b as e de d at os G en os co pe /m et ab ol is m /m et ab ol ic pr of ile s. U R L : h ttp :// w w w .g en os co pe .c ns .f r/ ag c/ m ic ro sc op e/ m et ab ol is m /m et ab ol ic pr of il. ph p? su bm it= M ic ro C yc E le ct ro n T ra ns fe r pa th w ay s N A D H :u bi qu in on a re du ct as a E C 1 .6 .5 .3 W A L B B _v 1_ 50 00 05 : p ut at iv e m on ov al en t c at io n/ H + a nt ip or te r W A L B B _v 1_ 50 00 05 : N D U FA 12 p ro pi o de e uc ar io te s. C V II I w A lb B c ar ec e de lo s ge ne s de la s su bu ni da de s nu oC y n uo D Su cc in at o de sh id ro ge na sa E C 1 .3 .5 .1 w A lb B c ar ec e de l g en d e la s ub un id ad s dh C U b iq u in ol -C it oc ro m o c re du ct as a E C 1 .1 0. 2. 2 W A L B B _v 1_ 49 00 25 – p et a: u bi qu in ol -c yt oc hr om e c re du ct as e, ir on -s ul fu rs ub un it w A lb B c ar ec e de lo s ge ne s de la s su bu ni da de s pe t B y p et C C IX C it oc ro m o c ox id as a E C 1 .9 .3 .1 C it oc ro m o b d E C 1 .1 0. 3. - w A lb B c ar ec e de lo s ge ne s C X A ne xo C . S ec ue nc ia s d e ge ne s am pl if ic ad os Wolbachia de la línea celular Aa23 W sp 69 1 G T T G A tC T C T T T A G T A G C T G A T A C T G T T T C T T T A T T A A A A C T A G C A C C A T A A G A A C C A A A A T A A C G A G C A C C A G C A T A A A G C T T G A T T T C T G G G G T T A C A T C A T A A C T A A C A C C A G C T T T T G C T T G A T A A G C A A A A C C A A A T C C T T T T T G A T C T T T A A C T G C A C T A G C T T C T G A A G G A T T G C T G A T A T A T G C T G C A C C A A C A C C A A C A C C A A C G T A T G G A G T G A T A G G C A T A T C T T C A A T C G C T A T A T C G T A A T A A A C G T T A A C C A A T C C T G A A A A T A C T G C C A C A C T G T T T G C A A C A G T T G T T G G A G C A A A T G T T G C A C C A C C A A C G T C G T T T T T G T T T A G T T G T G A G T A A A G T C C C T C A A C A T C A A C C C T G A T A T C G T C C A T T T T A T A A C C A A A T G C A G C A C C A C C A G C C A T A A A A G A T G C T T T T A A A G G A T C A T G A A C T T C G G T T C C T T T T T T A T A T T C A A T G C C G T C A A T T C T T G T T T T A A A A G G T A A A A C T T C A C C A T T A T A T T G C A A A C G A A C A T A G T A G C T A G T T T C T T C A T C A C T Wolbachia de la línea celular Aa23 gen wsp W sp 81 N T N G C A T A N A T G G T G A A G T T T T A C C T T T T A A A A C A A G A A T T G A C G G C A T T G A A T A T A A A A A A G G A A C C G A A G T T C A T G A T C C T T T A A A A G C A T C T T T T A T G G C T G G T G G T G C T G C A T T T G G T T A T A A A A T G G A C G A T A T C A G G G T T G A T G T T G A G G G A C T T T A C T C A C A A C T A A A C A A A A A C G A C G T T G G T G G T G C A A C A T T T G C T C C A A C A A C T G T T G C A A A C A G T G T G G C A G T A T T T T C A G G A T T G G T T A A C G T T T A T T A C G A T A T A G C G A T T G A A G A T A T G C C T A T C A C T C C A T A C G T T G G T G T T G G T G T T G G T G C A G C A T A T A T C A G C A A T C C T T C A G A A G C T A G T G C A G T T A A A G A T C A A A A A G G A T T T G G T T T T G C T T A T C A A G C A A A A G C T G G T G T T A G T T A T G A T G T A A C C C C A G A A A T C A A G C T T T A T G C T G G T G C T C G T T A T T T T G G T T C T T A T G G T G C T A G T T T T A A T A A A G A A A C A G T A T C A G C T A C T A A A G A G A T C A A C G T T C T T T A C A G C G C T G T T G G T G C A G A A G C T G G A ScW303 infectada con Wolbachia, genwspW sp 69 1 T T G A N C T C T T T A G T A G C T G A T A C T G T T T C T T T A T T A A A A C T A G C A C C A T A A G A A C C A A A A T A A C G A G C A C C A G C A T A A A G C T T G A T T T C T G G G G T T A C A T C A T A A C T A A C A C C A G C T T T T G C T T G A T A A G C A A A A C C A A A T C C T T T T T G A T C T T T A A C T G C A C T A G C T T C T G A A G G A T T G C T G A T A T A T G C T G C A C C A A C A C C A A C A C C A A C G T A T G G A G T G A T A G G C A T A T C T T C A A T C G C T A T A T C G T A A T A A A C G T T A A C C A A T C C T G A A A A T A C T G C C A C A C T G T T T G C A A C A G T T G T T G G A G C A A A T G T T G C A C C A C C A A C G T C G T T T T T G T T T A G T T G T G A G T A A A G T C C C T C A A C A T C A A C C C T G A T A T C G T C C A T T T T A T A A C C A A A T G C A G C A C C A C C A G C C A T A A A A G A T G C T T T T A A A G G A T C A T G A A C T T C G G T T C C T T T T T T A T A T T C A A T G C C G T C A A T T C T T G T T T T A A A A G G T A A A A C T T C A C C A T T A T A T T G C A A A C G A A C A T A G T A G C T A G T T T C T T C A T C A C T N A A T T N G N A C N N A C X I ScW303 infectada con Wolbachia, gen wspW sp 8 1 T A N A T G G T G A A G T T T T A C C T T T T A A A A C A A G A A T T G A C G G C A T T G A A T A T A A A A A A G G A A C C G A A G T T C A T G A T C C T T T A A A A G C A T C T T T T A T G G C T G G T G G T G C T G C A T T T G G T T A T A A A A T G G A C G A T A T C A G G G T T G A T G T T G A G G G A C T T T A C T C A C A A C T A A A C A A A A A C G A C G T T G G T G G T G C A A C A T T T G C T C C A A C A A C T G T T G C A A A C A G T G T G G C A G T A T T T T C A G G A T T G G T T A A C G T T T A T T A C G A T A T A G C G A T T G A A G A T A T G C C T A T C A C T C C A T A C G T T G G T G T T G G T G T T G G T G C A G C A T A T A T C A G C A A T C C T T C A G A A G C T A G T G C A G T T A A A G A T C A A A A A G G A T T T G G T T T T G C T T A T C A A G C A A A A G C T G G T G T T A G T T A T G A T G T A A C C C C A G A A A T C A A G C T T T A T G C T G G T G C T C G T T A T T T T G G T T C T T A T G G T G C T A G T T T T A A T A A A G A A A C A G T A T C A G C T A C T A A A G A G A T C A A C G T T C T T T A C A G C G C T G T T G G T G C A G A A G C T G G A N N A N N N Saccharomyces cerevisiae W303 5.8S rRNAIT S 1 T T T G T T T T G G C A A G A G C A T G A G A G C T T T T A C T G G G C A A G A A G A C A A G A G A T G G A G A G T C C A G C C G G G C C T G C G C T T A A G T G C G C G G T C T T G C T A G G C T T G T A A G T T T C T T T C T T G C T A T T C C A A A C G G T G A G A G A T T T C T G T G C T T T T G T T A T A G G A C A A T T A A A A C C G T T T C A A T A C A A C A C A C T G T G G A G T T T T C A T A T C T T T G C A A C T T T T T C T T T G G G C A T T C G A G C A A T C G G G G C C C A G A G G T A A C A A A C A C A A A C A A T T T T A T C T A T T C A T T A A A T T T T T G T C A A A A A C A A G A A T T T T C G T A A C T G G A A A T T T T A A A A T A T T A A A A A C T T T C A A C A A C G G A T C T C T T G G T T C T C G C A T C G A T G A A G A A C G C A G C G A A A T G C G A T A C G T A A T G T G A A T T G C A G A A T T C C G T G A A T C A T C G A A T C T T T G A A C G C A C A T T G C G C C C C T T G G T A T T C C A G G G G G C A T G C C T G T T T G A G C G T C A T T T C C T T C T C A A A C A T T C T G T T T G G T A G T G A G T G A T A C T C T T T G G A G T T A A C T T G A A A T T G C T G G C C T T T T C A T T G G A T G T T T T T T T T C C A A A G A G A G G T T T C T C T G C G T G C T T G A G G T A T A A T G C A A G T A C G G T C G T T T T A gG T T T T A C C A A C T G C G G C T A A T C T T T T T T T A T A C T G A Saccharomyces cerevisiae W303 5.8S rRNAIT S 1 T T G T T C G C C T A G A C G C T C T C T T C T T A T C G A T A A C G T T C C A A T A C G C T C A G T A T A A A A A A A G A T T A G C C G C A G T T G G T A A A A C C T A A A A C G A C C G T A C T T G C A T T A T A C C T C A A G C A C G C A G A G A A A C C T C T C T T T G G A A A A A A A A C A T C C A A T G A A A A G G C C A G C A A T T T C A A G T T A A C T C C A A A G A G T A T C A C T C A C T A C C A A A C A G A A T G T T T G A G A A G G A A A T G A C G C T C A A A C A G G C A T G C C C C C T G G A A T A C C A A G G G G C G C A A T G T G C G T T C A A A G A T T C G A T G A T T C A C G G A A T T C T G C A A T T C A C A T T A C G T A T C G C A T T T C G C T G C G T T C T T C A T C G A T G C G A G A A C C A A G A G A T C C G T T G T T G A A A G T T T T T A A T A T T T T A A A A T T T C C A G T T A C G A A A A T T C T T G T T T T T G A C A A A A A T T T A A T G A A T A G A T A A A A T T G T T T G T G T T T G T T A C C T C T G G G C C C C G A T T G C T C G A A T G C C C A A A G A A A A A G T T G C A A A G A T A T G A A A A C T C C A C A G T G T G T T G T A T T G A A A C G G T T T T A A T T G T C C T A T A A C A A A A G C A C A G A A A T C T C T C A C C G T T T G G A A T A G C A A G A A A G A A A C T T A C A A G C C T A G C A A G A C C G C G C A C T T A A G C G C A G G C C C G G C T G G A C T C T C C A T C T C T T G T C T T C T T G C C C A G T A A A A G C T C T C A T G C T C T T G C C A A A A C A A A A A A A T C C A T T T T C A A A A T T A T T A A A T T T C T T T A A T G A T C C T T C C G C A C G T C C X II D . P ro te ín as id en ti fi ca da s po r M S P ro te in as I de nt if ic ad as p os M S. B an da s co rt ad as a p ar ti r de g el es C N o r B N -P A G E . B as es d e da to s ut ili za da s, U ni p ro t W ol b ac hi a w A lb B /S c er ev is ia e 1A : A T P as a N U n us ed T ot al % C ov % C ov (5 0) % C ov (9 5) A cc es si on N am e Sp ec ie s P ep (9 5% ) 1 7. 98 7. 98 52 .8 3 10 .5 10 .5 H 0U 0X 5_ W O L P I A T P s yn th as e su bu ni t a lp ha W p ip ie nt is w A lb B 9 2 6. 62 6. 62 70 .9 33 .1 33 .1 H 0U 0S 7_ W O L P I A T P s yn th as e su bu ni t b et a W p ip ie nt is w A lb B 16 3 2 2 44 .7 1. 76 1. 76 H 0U 3S 8_ W O L P I N A D H -q ui no ne o xi do re du ct as e W p ip ie nt is w A lb B 1 % C ov ( 95 ): T he p er ce nt ag e of m at ch in g am in o ac id s fr om id en tif ie d pe pt id es h av in g co nf id en ce g re at er th an o r eq ua l t o 95 % d iv id ed b y th e to ta l n um be r of a m in o ac id s in th e se qu en ce . A cc es si on : T he a cc es si on n um be r fo r th e pr ot ei n. N am e: T he n am e of th e pr ot ei n. Sp ec ie s: T he s pe ci es f or th is p ro te in . P ep ti de s (9 5% ): T he n um be r of d is ti nc t p ep tid es h av in g at le as t 9 5% c on fi de nc e. M ul tip le m od if ie d an d cl ea ve d st at es o f th e sa m e un de rl yi ng p ep tid e se qu en ce a re c on si de re d di st in ct pe pt id es b ec au se th ey h av e di ff er en t m ol ec ul ar f or m ul as . M ul tip le s pe ct ra o f th e sa m e pe pt id e, d ue to r ep lic at e ac qu is iti on o r di ff er en t c ha rg e st at es , o nl y co un t o nc e. 1N : N A D H D H N a U n us ed T ot al % C ov % C ov (5 0) % C ov (9 5) A cc es si on N am e O S= Sa cc ha ro m yc es c er ev is ia e (s tr ai n A T C C 2 04 50 8 / S 28 8c ) Sp ec ie s P ep (9 5% ) 1 25 .2 7 25 .3 71 .4 8 47 .5 3 37 .8 3 sp |P 32 31 6| A C H 1_ Y E A S T A ce ty l- C oA h yd ro la se S . ce re vi si a e 18 2 23 .8 5 23 .9 47 .1 3 34 .2 6 33 .7 4 sp |P 07 27 5| P U T 2_ Y E A S T D el ta -1 -p yr ro li ne -5 -c ar bo xy la te d eh yd ro ge na se , m it oc ho nd ri al S . ce re vi si a e 19 3 23 .7 6 23 .8 62 .0 3 47 .8 5 47 .8 5 sp |P 06 16 8| IL V 5_ Y E A S T K et ol -a ci d re du ct oi so m er as e, m it oc ho nd ri al S . ce re vi si a e 17 4 22 .2 4 22 .2 79 .1 5 74 .9 1 56 .8 9 sp |P 04 84 0| V D A C 1_ Y E A S T M it oc ho nd ri al o ut er m em br an e pr ot ei n po ri n 1 S . ce re vi si a e 17 5 18 18 54 .0 6 25 .9 4 22 .9 7 sp |Q 00 71 1| S D H A _Y E A S T S uc ci na te d eh yd ro ge na se [ ub iq ui no ne ] fl av op ro te in s ub un it, m it oc ho nd ri al S . ce re vi si a e 12 6 16 .0 6 16 .1 55 .3 5 25 .4 7 22 .0 1 sp |P 18 23 9| A D T 2_ Y E A S T A D P ,A T P c ar ri er p ro te in 2 S . ce re vi si a e 10 C X II I 7 14 .5 4 14 .5 36 .4 7 28 .9 5 27 .0 7 sp |P 21 80 1| S D H B _Y E A S T S uc ci na te d eh yd ro ge na se [ ub iq ui no ne ] ir on -s ul fu r su bu ni t, m it oc ho nd ri al S . ce re vi si a e 7 8 14 14 42 .0 1 20 .9 20 .9 sp |P 08 41 7| F U M H _Y E A S T F um ar at e hy dr at as e, m it oc ho nd ri al S . ce re vi si a e 16 9 12 .0 5 12 .1 34 .7 3 29 .5 8 29 .5 8 sp |P 23 64 1| M P C P _Y E A S T M it oc ho nd ri al p ho sp ha te c ar ri er p ro te in S . ce re vi si a e 8 10 12 12 33 .9 4 16 .2 1 14 .0 7 sp |P 0C S9 0| H S P 77 _Y E A S T H ea t s ho ck p ro te in S S C 1, m it oc ho nd ri al O S . ce re vi si a e 7 11 10 .3 5 10 .4 24 .0 8 10 .3 5 8. 12 4 sp |P 49 09 5| G C S P _Y E A S T G ly ci ne d eh yd ro ge na se ( de ca rb ox yl at in g) , m it oc ho nd ri al S . ce re vi si a e 6 12 10 .1 10 .1 41 .8 3 18 .7 2 16 .3 3 sp |P 07 25 1| A T P A _Y E A S T A T P s yn th as e su bu ni t a lp ha , m it oc ho nd ri al S . ce re vi si a e 6 13 10 .0 5 10 .1 36 .1 2 19 .8 3 17 .3 3 sp |P 00 89 0| C IS Y 1_ Y E A S T C it ra te s yn th as e, m it oc ho nd ri al S . ce re vi si a e 7 14 10 10 37 .2 7 27 .6 4 27 .6 4 sp |P 33 30 3| S F C 1_ Y E A S T Su cc in at e/ fu m ar at e m it oc ho nd ri al tr an sp or te r S . ce re vi si a e 9 15 8. 52 8. 52 19 .3 5 11 .9 2 8. 97 6 sp |Q 01 57 4| A C S 1_ Y E A S T A ce ty l- co en zy m e A s yn th et as e 1 S . ce re vi si a e 4 16 8 8 59 .0 2 33 .0 3 22 .9 4 sp |Q 12 28 9| C R C 1_ Y E A S T M ito ch on dr ia l c ar ni tin e ca rr ie r S . ce re vi si a e 5 17 6. 22 6. 22 30 .8 6 14 .0 5 9. 20 8 sp |P 06 20 8| L E U 1_ Y E A S T 2- is op ro py lm al at e sy nt ha se S . ce re vi si a e 4 18 6 6 41 .6 7 9. 76 2 9. 76 2 sp |P 16 38 7| O D P A _Y E A S T P yr uv at e de hy dr og en as e E 1 co m po ne nt s ub un it a lp ha , m it oc ho nd ri al S . ce re vi si a e 3 19 6 6 6. 92 9 6. 92 9 6. 92 9 sp |P 00 40 1| C O X 1_ Y E A S T C yt oc hr om e c ox id as e su bu ni t 1 S . ce re vi si a e 5 20 5. 24 5. 24 23 .2 9 12 .9 5 8. 15 1 sp |P 07 34 2| IL V B _Y E A S T A ce to la ct at e sy nt ha se c at al yt ic s ub un it, m ito ch on dr ia l S . ce re vi si a e 3 21 5. 2 5. 2 26 .4 4 13 .4 1 13 .4 1 sp |P 34 22 7| P R X 1_ Y E A S T M it oc ho nd ri al p er ox ir ed ox in P R X 1 S . ce re vi si a e 3 22 5. 08 5. 08 17 .9 8 11 .7 4 7. 89 sp |Q 07 50 0| N D H 2_ Y E A S T E xt er na l N A D H -u bi qu in on e ox id or ed uc ta se 2 , m ito ch on dr ia l S . ce re vi si a e 3 23 4. 78 4. 78 50 .6 4 23 .1 6 15 .0 1 sp |P 16 54 7| O M 45 _Y E A S T M it oc ho nd ri al o ut er m em br an e pr ot ei n O M 45 S . ce re vi si a e 4 24 4. 55 4. 55 22 .5 9 16 .8 7 13 .8 6 sp |P 25 61 9| H S P 30 _Y E A S T 30 k D a he at s ho ck p ro te in S . ce re vi si a e 3 25 4. 52 4. 52 23 .7 7 10 .3 8 7. 10 4 sp |P 32 47 3| O D P B _Y E A S T P yr uv at e de hy dr og en as e E 1 co m po ne nt s ub un it b et a, m it oc ho nd ri al S . ce re vi si a e 2 26 4. 06 4. 06 37 .7 4 12 .4 7. 00 8 sp |P 40 49 5| L Y S 12 _Y E A S T H om oi so ci tr at e de hy dr og en as e, m it oc ho nd ri al S . ce re vi si a e 3 27 4. 03 4. 03 22 .6 1 8. 96 7 8. 96 7 sp |P 32 34 0| N D I1 _Y E A S T R ot en on e- in se ns iti ve N A D H -u bi qu in on e ox id or ed uc ta se , m it oc ho nd ri al S . ce re vi si a e 4 28 4 8. 04 21 .3 6 16 .1 8 12 .6 2 sp |P 04 71 0| A D T 1_ Y E A S T A D P ,A T P c ar ri er p ro te in 1 S . ce re vi si a e 5 29 4 4 19 .3 6 3. 32 9 3. 32 9 sp |P 33 41 6| H S P 78 _Y E A S T H ea t s ho ck p ro te in 7 8, m it oc ho nd ri al S . ce re vi si a e 2 30 4 4 18 .6 4 5. 39 8 5. 39 8 sp |P 19 41 4| A C O N _Y E A S T A co ni ta te h yd ra ta se , m it oc ho nd ri al S . ce re vi si a e 2 31 4 4 28 .5 7. 12 5 7. 12 5 sp |Q 12 44 3| R T N 2_ Y E A S T R et ic ul on -l ik e pr ot ei n 2 S . ce re vi si a e 2 32 4 4 27 .7 1 11 .4 5 11 .4 5 sp |P 00 35 9| G 3P 3_ Y E A S T G ly ce ra ld eh yd e- 3- ph os ph at e de hy dr og en as e 3 S . ce re vi si a e 3 33 4 4 62 .7 1 16 .9 5 16 .9 5 sp |P 07 25 5| C O X 9_ Y E A S T C yt oc hr om e c ox id as e su bu ni t 7 A S . ce re vi si a e 2 C X IV 34 4 4 24 .7 4 24 .7 4 24 .7 4 sp |Q 96 V H 5| M IC 10 _Y E A S T M IC O S c om pl ex s ub un it M IC 10 S . ce re vi si a e 2 35 3. 1 3. 1 21 .7 2. 86 2. 86 sp |P 20 96 7| O D O 1_ Y E A S T 2- ox og lu ta ra te d eh yd ro ge na se , m it oc ho nd ri al S . ce re vi si a e 3 36 3. 02 3. 02 17 .4 1 6. 00 9 3. 39 sp |P 32 19 1| G P D M _Y E A S T G ly ce ro l- 3- ph os ph at e de hy dr og en as e, m it oc ho nd ri al S . ce re vi si a e 2 37 2. 46 2. 46 19 .6 6 5. 12 8 5. 12 8 sp |P 39 52 2| IL V 3_ Y E A S T D ih yd ro xy -a ci d de hy dr at as e, m ito ch on dr ia l S . ce re vi si a e 2 38 2. 26 2. 26 24 .4 5 9. 82 2. 40 5 sp |P 09 62 4| D L D H _Y E A S T D ih yd ro lip oy l d eh yd ro ge na se , m it oc ho nd ri al S . ce re vi si a e 1 39 2. 16 2. 16 13 .5 3 8. 25 7 2. 98 2 sp |P 32 33 5| M S S 51 _Y E A S T P ro te in M S S5 1, m it oc ho nd ri al S . ce re vi si a e 1 40 2. 15 2. 15 23 .2 3 7. 40 7 3. 36 7 sp |P 40 47 1| A Y R 1_ Y E A S T N A D P H -d ep en de nt 1 -a cy ld ih yd ro xy ac et on e ph os ph at e re du ct as e S . ce re vi si a e 1 41 2. 08 2. 08 30 .1 8 10 .0 6 5. 03 sp |P 47 08 5| Y JX 8_ Y E A S T M E M O 1 fa m il y pr ot ei n Y JR 00 8W S . ce re vi si a e 1 42 2. 05 2. 05 13 .0 7 13 .0 7 13 .0 7 sp |P 25 61 3| A D Y 2_ Y E A S T A cc um ul at io n of d ya ds p ro te in 2 S . ce re vi si a e 2 43 2. 04 2. 04 26 .8 1 2. 74 2. 74 sp |P 00 83 0| A T P B _Y E A S T A T P s yn th as e su bu ni t b et a, m it oc ho nd ri al S . ce re vi si a e 1 44 2 4 16 .5 7 11 .4 5 11 .4 5 sp |P 00 35 8| G 3P 2_ Y E A S T G ly ce ra ld eh yd e- 3- ph os ph at e de hy dr og en as e 2 S . ce re vi si a e 4 2N : N A D H D H N U nu se d T ot al % C ov % C ov (5 0) % C ov (9 5) A cc es si on N am e O S= Sa cc ha ro m yc es c er ev is ia e (s tr ai n A T C C 2 04 50 8 / S 28 8c ) Sp ec ie s P ep (9 5% ) 1 18 .1 6 18 .2 43 .8 8 23 .2 5 20 .9 8 sp |P 19 88 2| H S P 60 _Y E A S T H ea t s ho ck p ro te in 6 0, m it oc ho nd ri al S . ce re vi si a e 9 2 16 .0 6 16 .1 34 .0 5 18 .9 8 18 .9 8 sp |P 00 83 0| A T P B _Y E A S T A T P s yn th as e su bu ni t b et a, m it oc ho nd ri al S . ce re vi si a e 9 3 12 .2 7 12 .3 38 .7 1 17 .3 17 .3 sp |Q 12 23 0| L S P 1_ Y E A S T Sp hi ng ol ip id lo ng c ha in b as e- re sp on si ve p ro te in L SP 1 S . ce re vi si a e 7 4 12 .0 4 12 27 .6 8 13 .1 5 13 .1 5 sp |P 0C S9 0| H S P 77 _Y E A S T H ea t s ho ck p ro te in S S C 1, m it oc ho nd ri al S . ce re vi si a e 7 5 11 .4 1 11 .4 24 .5 5 9. 76 9 9. 76 9 sp |P 19 41 4| A C O N _Y E A S T A co ni ta te h yd ra ta se , m it oc ho nd ri al S . ce re vi si a e 6 6 8. 02 8. 02 31 .1 9 17 .6 8 17 .6 8 sp |P 23 64 1| M P C P _Y E A S T M it oc ho nd ri al p ho sp ha te c ar ri er p ro te in S . ce re vi si a e 5 7 8 8 26 .8 6 14 .2 4 14 .2 4 sp |P 25 60 5| IL V 6_ Y E A S T A ce to la ct at e sy nt ha se s m al l s ub un it , m it oc ho nd ri al S . ce re vi si a e 5 8 6 6 19 .1 2 5. 83 5 5. 83 5 sp |P 07 21 3| T O M 70 _Y E A S T M ito ch on dr ia l i m po rt r ec ep to r su bu ni t T O M 70 S . ce re vi si a e 4 9 6 6 29 .2 9 24 .2 4 24 .2 4 sp |Q 12 33 5| P S T 2_ Y E A S T P ro to pl as t s ec re te d pr ot ei n 2 S . ce re vi si a e 5 10 5. 35 5. 35 41 .7 8 17 .8 1 14 .7 3 sp |P 32 60 2| S E C 17 _Y E A S T A lp ha -s ol ub le N SF a tt ac hm en t p ro te in S . ce re vi si a e 3 11 4. 95 4. 95 18 .0 8 11 .9 8. 23 8 sp |Q 12 36 3| W T M 1_ Y E A S T T ra ns cr ip tio na l m od ul at or W T M 1 S . ce re vi si a e 3 12 4. 29 6. 37 37 .4 6 16 .2 2 13 .8 6 sp |P 53 25 2| P IL 1_ Y E A S T Sp hi ng ol ip id lo ng c ha in b as e- re sp on si ve p ro te in P IL 1 S . ce re vi si a e 4 13 4. 03 4. 03 26 .5 7 8. 02 8. 02 sp |P 39 67 6| F H P _Y E A S T F la vo he m op ro te in S . ce re vi si a e 4 14 4. 01 4. 01 17 .0 6 5. 68 8 5. 68 8 sp |P 07 25 1| A T P A _Y E A S T A T P s yn th as e su bu ni t a lp ha , m it oc ho nd ri al S . ce re vi si a e 2 C X V 15 4 4 41 .3 9 11 .8 9 11 .8 9 sp |P 05 62 6| A T P F _Y E A S T A T P s yn th as e su bu ni t 4 , m it oc ho nd ri al S . ce re vi si a e 2 16 2. 2 2. 2 31 .6 1 18 .7 1 8. 38 7 sp |P 04 03 7| C O X 4_ Y E A S T C yt oc hr om e c ox id as e su bu ni t 4 , m it oc ho nd ri al S . ce re vi si a e 1 17 2. 05 2. 05 18 .1 8 16 .6 7 16 .6 7 sp |Q 2V 2P 9| Y D 19 A _Y E A S T U nc ha ra ct er iz ed p ro te in Y D R 11 9W -A S . ce re vi si a e 2 18 2. 04 2. 04 20 9. 56 5 9. 56 5 sp |Q 12 23 3| A T P N _Y E A S T A T P s yn th as e su bu ni t g , m it oc ho nd ri al S . ce re vi si a e 1 19 2 2 29 .5 4. 96 9 4. 96 9 sp |P 33 30 3| S F C 1_ Y E A S T Su cc in at e/ fu m ar at e m it oc ho nd ri al tr an sp or te r S . ce re vi si a e 1 20 2 2 13 .8 7 2. 93 3 2. 93 3 sp |P 60 01 0| A C T _Y E A S T A ct in S . ce re vi si a e 1 21 2 2 29 .4 1 9. 15 9. 15 sp |P 00 42 4| C O X 5A _Y E A S T C yt oc hr om e c ox id as e po ly pe pt id e 5A , m ito ch on dr ia l S . ce re vi si a e 1 1S : Su cc in at o D H N U n us ed T ot al % C ov % C ov (5 0) % C ov (9 5) A cc es si on N am e Sp ec ie s P ep (9 5% ) 1 48 .6 7 48 .7 79 .0 5 55 .8 1 54 .4 3 sp |P 0C S9 0| H S P 77 _Y E A S T H ea t s ho ck p ro te in S S C 1, m it oc ho nd ri al S . ce re vi si a e 42 2 44 .7 1 44 .7 71 .8 5 45 .3 7 45 .3 7 sp |P 19 41 4| A C O N _Y E A S T A co ni ta te h yd ra ta se , m it oc ho nd ri al S . ce re vi si a e 49 3 34 .2 34 .2 54 .9 39 .3 4 38 .9 9 sp |P 19 88 2| H S P 60 _Y E A S T H ea t s ho ck p ro te in 6 0, m it oc ho nd ri al S . ce re vi si a e 21 4 21 .7 5 21 .8 74 .1 8 37 .4 7 37 .2 2 sp |P 06 16 8| IL V 5_ Y E A S T K et ol -a ci d re du ct oi so m er as e, m it oc ho nd ri al S . ce re vi si a e 16 5 14 .4 3 14 .4 49 .2 7 23 .5 9 20 .4 6 sp |P 00 89 0| C IS Y 1_ Y E A S T C it ra te s yn th as e, m it oc ho nd ri al S . ce re vi si a e 10 6 8. 39 8. 39 50 .5 3 24 .0 3 22 .6 1 sp |P 04 84 0| V D A C 1_ Y E A S T M it oc ho nd ri al o ut er m em br an e pr ot ei n po ri n 1 S . ce re vi si a e 6 7 8 8 41 .7 11 .1 3 11 .1 3 sp |P 46 68 1| D L D 2_ Y E A S T D -l ac ta te d eh yd ro ge na se [ cy to ch ro m e] 2 , m ito ch on dr ia l S . ce re vi si a e 4 8 6. 42 6. 42 50 .1 6 25 .2 4 22 .0 8 sp |Q 07 62 9| Y D 21 8_ Y E A S T U nc ha ra ct er iz ed m em br an e pr ot ei n Y D L 21 8W S . ce re vi si a e 6 9 6. 01 6. 01 31 .7 6 11 .6 4 11 .6 4 sp |P 18 23 9| A D T 2_ Y E A S T A D P ,A T P c ar ri er p ro te in 2 S . ce re vi si a e 3 10 4. 44 4. 44 41 .7 6 8. 16 6 8. 16 6 sp |P 32 19 1| G P D M _Y E A S T G ly ce ro l- 3- ph os ph at e de hy dr og en as e, m it oc ho nd ri al S . ce re vi si a e 3 11 4. 01 4. 01 48 .0 5 7. 32 3 7. 32 3 sp |P 02 99 2| E F T U _Y E A S T E lo ng at io n fa ct or T u, m it oc ho nd ri al S . ce re vi si a e 2 12 4. 01 4. 01 27 .0 9 3. 68 8 3. 68 8 sp |P 15 10 8| H S C 82 _Y E A S T A T P -d ep en de nt m ol ec ul ar c ha pe ro ne H SC 82 S . ce re vi si a e 2 12 0 4 36 .5 3 3. 66 7 3. 66 7 sp |P 02 82 9| H S P 82 _Y E A S T A T P -d ep en de nt m ol ec ul ar c ha pe ro ne H SP 82 S . ce re vi si a e 2 13 3. 72 3. 72 17 .1 1 7. 22 4 5. 70 3 sp |P 54 78 3| A L O _Y E A S T D -a ra bi no no -1 ,4 -l ac to ne o xi da se S . ce re vi si a e 2 14 2. 05 2. 05 39 .9 2 6. 26 2 2. 74 sp |P 00 83 0| A T P B _Y E A S T A T P s yn th as e su bu ni t b et a, m it oc ho nd ri al S . ce re vi si a e 1 15 2 6 25 .6 5 9. 13 9. 13 sp |P 08 67 9| C IS Y 2_ Y E A S T C it ra te s yn th as e, p er ox is om al S . ce re vi si a e 3 16 2 2 38 .7 2 2. 38 5 2. 38 5 sp |P 07 25 1| A T P A _Y E A S T A T P s yn th as e su bu ni t a lp ha , m it oc ho nd ri al S . ce re vi si a e 1 17 2 2 28 .2 8 2. 18 7 2. 18 7 sp |Q 00 71 1| S D H A _Y E A S T S uc ci na te d eh yd ro ge na se [ ub iq ui no ne ] fl av op ro te in s ub un it, S . ce re vi si a e 1 C X V I m it oc ho nd ri al 17 0 2 17 .9 8 2. 20 8 2. 20 8 sp |P 47 05 2| S D H X _Y E A S T S uc ci na te d eh yd ro ge na se [ ub iq ui no ne ] fl av op ro te in s ub un it 2, m it oc ho nd ri al S . ce re vi si a e 1 1A : A T P as e N U n us ed T ot al % C ov % C ov (5 0) % C ov (9 5) A cc es si on N am e Sp ec ie s P ep (9 5% ) 1 45 .7 1 45 .7 81 .1 59 .2 7 52 .8 4 sp |P 07 25 1| A T P A _Y E A S T A T P s yn th as e su bu ni t a lp ha , m it oc ho nd ri al S . ce re vi si a e 39 2 34 .9 5 35 85 .9 1 71 .4 3 66 .5 4 sp |P 00 83 0| A T P B _Y E A S T A T P s yn th as e su bu ni t b et a, m it oc ho nd ri al S . ce re vi si a e 46 3 17 17 90 .7 6 41 .5 8 39 .1 3 sp |P 07 25 7| Q C R 2_ Y E A S T C yt oc hr om e b- c1 c om pl ex s ub un it 2, m it oc ho nd ri al S . ce re vi si a e 12 4 14 .2 9 14 .3 90 .8 65 .5 2 60 .3 4 sp |P 30 90 2| A T P 7_ Y E A S T A T P s yn th as e su bu ni t d , m it oc ho nd ri al S . ce re vi si a e 16 5 13 .9 7 14 80 .0 6 45 .0 2 36 .9 8 sp |P 38 07 7| A T P G _Y E A S T A T P s yn th as e su bu ni t g am m a, m it oc ho nd ri al S . ce re vi si a e 13 6 10 .1 7 10 .2 56 .2 9 26 .4 2 18 .5 5 sp |P 18 23 9| A D T 2_ Y E A S T A D P ,A T P c ar ri er p ro te in 2 S . ce re vi si a e 8 7 8 8 60 .1 8 20 .1 3 14 .4 4 sp |P 07 25 6| Q C R 1_ Y E A S T C yt oc hr om e b- c1 c om pl ex s ub un it 1, m it oc ho nd ri al S . ce re vi si a e 7 8 6. 88 6. 88 37 .5 4 20 .7 1 20 .7 1 sp |P 07 14 3| C Y 1_ Y E A S T C yt oc hr om e c1 , h em e pr ot ei n, m ito ch on dr ia l S . ce re vi si a e 4 9 6. 46 6. 46 48 .5 6 10 .4 9 7. 78 3 sp |P 00 17 5| C Y B 2_ Y E A S T C yt oc hr om e b2 , m ito ch on dr ia l S . ce re vi si a e 3 10 6. 06 6. 06 91 .9 4 91 .9 4 91 .9 4 sp |P 21 30 6| A T P 5E _Y E A S T A T P s yn th as e su bu ni t e ps ilo n, m it oc ho nd ri al S . ce re vi si a e 7 11 6. 04 6. 04 64 .6 6 31 .1 31 .1 sp |P 04 84 0| V D A C 1_ Y E A S T M it oc ho nd ri al o ut er m em br an e pr ot ei n po ri n 1 S . ce re vi si a e 7 12 6 6 55 .4 5 20 .7 9 20 .7 9 sp |Q 06 40 5| A T P K _Y E A S T A T P s yn th as e su bu ni t f , m it oc ho nd ri al S . ce re vi si a e 3 13 5. 97 5. 97 38 .9 1 12 .5 4 12 .5 4 sp |P 23 64 1| M P C P _Y E A S T M it oc ho nd ri al p ho sp ha te c ar ri er p ro te in S . ce re vi si a e 4 14 5. 9 5. 9 83 .0 2 24 .0 6 24 .0 6 sp |P 09 45 7| A T P O _Y E A S T A T P s yn th as e su bu ni t 5 , m it oc ho nd ri al S . ce re vi si a e 4 15 4. 82 4. 82 58 .7 2 12 .0 2 9. 49 6 sp |Q 12 42 8| P R P D _Y E A S T P ro ba bl e 2- m et hy lc itr at e de hy dr at as e S . ce re vi si a e 3 16 4. 4 4. 4 68 .0 3 27 .0 5 21 .7 2 sp |P 05 62 6| A T P F _Y E A S T A T P s yn th as e su bu ni t 4 , m it oc ho nd ri al S . ce re vi si a e 7 17 4. 19 4. 19 34 .6 6 7. 72 4 7. 72 4 sp |P 00 89 0| C IS Y 1_ Y E A S T C it ra te s yn th as e, m it oc ho nd ri al S . ce re vi si a e 4 18 4. 03 4. 03 42 9. 2 4. 8 sp |P 00 54 9| K P Y K 1_ Y E A S T P yr uv at e ki na se 1 S . ce re vi si a e 3 19 4 4 70 .0 3 14 .6 8 8. 56 3 sp |Q 12 28 9| C R C 1_ Y E A S T M ito ch on dr ia l c ar ni tin e ca rr ie r S . ce re vi si a e 2 20 4 4 46 .0 7 10 .9 2 5. 89 5 sp |P 02 99 4| E F 1A _Y E A S T E lo ng at io n fa ct or 1 -a lp ha S . ce re vi si a e 2 21 4 4 23 .1 3 4. 37 5 4. 37 5 sp |Q 00 71 1| S D H A _Y E A S T S uc ci na te d eh yd ro ge na se [ ub iq ui no ne ] fl av op ro te in s ub un it, m it oc ho nd ri al S . ce re vi si a e 2 21 0 1. 96 30 .7 6 2. 20 8 2. 20 8 sp |P 47 05 2| S D H X _Y E A S T S uc ci na te d eh yd ro ge na se [ ub iq ui no ne ] fl av op ro te in s ub un it 2, m it oc ho nd ri al S . ce re vi si a e 1 C X V II 22 4 4 34 .5 3. 73 3. 73 sp |P 38 24 8| E C M 33 _Y E A S T C el l w al l p ro te in E C M 33 S . ce re vi si a e 2 23 3. 89 3. 89 43 .4 8 9. 00 6 9. 00 6 sp |P 33 30 3| S F C 1_ Y E A S T Su cc in at e/ fu m ar at e m it oc ho nd ri al tr an sp or te r S . ce re vi si a e 4 24 3. 68 3. 68 58 .6 5 9. 77 4 9. 77 4 sp |P 21 80 1| S D H B _Y E A S T S uc ci na te d eh yd ro ge na se [ ub iq ui no ne ] ir on -s ul fu r su bu ni t, m it oc ho nd ri al S . ce re vi si a e 2 25 3. 37 3. 37 32 .4 1 7. 34 2 7. 34 2 sp |P 06 16 8| IL V 5_ Y E A S T K et ol -a ci d re du ct oi so m er as e, m it oc ho nd ri al S . ce re vi si a e 3 26 3. 17 3. 17 91 .5 3 16 .9 5 16 .9 5 sp |P 07 25 5| C O X 9_ Y E A S T C yt oc hr om e c ox id as e su bu ni t 7 A S . ce re vi si a e 2 27 3. 1 3. 1 30 .2 8 5. 50 5 5. 50 5 sp |Q 07 50 0| N D H 2_ Y E A S T E xt er na l N A D H -u bi qu in on e ox id or ed uc ta se 2 , m ito ch on dr ia l S . ce re vi si a e 2 28 2. 97 2. 97 20 .9 1 2. 66 3 2. 66 3 sp |P 20 96 7| O D O 1_ Y E A S T 2- ox og lu ta ra te d eh yd ro ge na se , m it oc ho nd ri al S . ce re vi si a e 2 29 2. 81 2. 81 45 .5 7 4. 12 8 4. 12 8 sp |P 0C S9 0| H S P 77 _Y E A S T H ea t s ho ck p ro te in S S C 1, m it oc ho nd ri al S . ce re vi si a e 3 30 2. 03 2. 03 64 .3 8 45 .6 3 45 .6 3 sp |Q 12 16 5| A T P D _Y E A S T A T P s yn th as e su bu ni t d el ta , m it oc ho nd ri al S . ce re vi si a e 5 % C ov ( 95 ): T he p er ce nt ag e of m at ch in g am in o ac id s fr om id en tif ie d pe pt id es h av in g co nf id en ce g re at er th an o r eq ua l t o 95 % d iv id ed b y th e to ta l n um be r of a m in o ac id s in th e se qu en ce . A cc es si on : T he a cc es si on n um be r fo r th e pr ot ei n. N am e: T he n am e of th e pr ot ei n. Sp ec ie s: T he s pe ci es f or th is p ro te in . P ep ti de s (9 5% ): T he n um be r of d is ti nc t p ep tid es h av in g at le as t 9 5% c on fi de nc e. M ul tip le m od if ie d an d cl ea ve d st at es o f th e sa m e un de rl yi ng p ep tid e se qu en ce a re c on si de re d di st in ct pe pt id es b ec au se th ey h av e di ff er en t m ol ec ul ar f or m ul as . M ul tip le s pe ct ra o f th e sa m e pe pt id e, d ue to r ep lic at e ac qu is iti on o r di ff er en t c ha rg e st at es , o nl y co un t o nc e. CXVIII Anexo E. Publicaciones. a) Artículos publicados 1. Uribe-Alvarez C, Chiquete-Félix N, Morales-García L, Bohórquez-Hernández A, Delgado- Buenrostro NL, Vaca L, Peña A, Uribe-Carvajal S. (2018). Wolbachia pipientis grows in Saccharomyces cerevisiae evoking early death of the host and deregulation of mitochondrial metabolism. Microbiology open. Accepted: May 15th. 2. Olicón-Hernández DR, Uribe-Alvarez C, Uribe-Carvajal S, Pardo JP, Guerra-Sánchez G. (2017). Response of Ustilagomaydisagainst the stress caused by three polycationic chitin derivatives.Molecules; 22(12): 1-11. 3. Pavón N, Cabrera-Orefice A, Gallardo-Pérez JC, Uribe-Alvarez C, Rivero-Segura NA, Vazquez-Martínez ER, Cerbón M, Martínez-Abundis E, Torres-Narvaez JC, Martínez-Memije R, Roldán-Gómez FJ, Uribe-Carvajal S. (2017). In female rat heart mitochondria, oophorectomy results in loss of oxidative phosphorylation. Journal of Endocrinology. 232(2):221-235. 4. Uribe-Alvarez C, Chiquete-Félix N, Contreras-Zentella M, Guerrero-Castillo S, Peña A, Uribe- Carvajal S. (2016). Staphylococcus epidermidis: metabolic adaptation and biofilm formation in response to different oxygen concentrations. FEMS Pathogens and Disease. 74(1):1-15. 5. Rosas-Lemus M, Uribe-Alvarez C, Chiquete-Felix N, Uribe-Carvajal S. (2014). In Saccharomyces cerevisiae fructose-1,6-bisphosphate contributes to the Crabtree effect through closure of the mitochondrial unspecific channel. Archives of Biochemistry and Biophysics. 555- 556:66-70. 6. Gutierrez-Aguilar M, López-Carbajal HM, Uribe-Alvarez C, Espinoza-Simón E, Rosas-Lemus M, Chiquete-Félix N, Uribe-Carvajal S. (2014). Effects of ubiquinone derivatives on the mitochondrial unselective channel of Saccharomyces cerevisiae.Journal of Bioenergetics and Biomembranes. 2014; 46(6):519-27. c) Capítulo de libro 1. Mónica Rosas Lemus, Cristina Uribe Alvarez, Martha Contreras Zentella, Luis Alberto Luévano Martínez, Natalia Chiquete Félix, N. Lilia Morales García, Adriana Muhlia Almazán, Edgardo Escamilla Marván and Salvador Uribe Carvajal. (2016). Oxygen: From Toxic Waste to Optimal (Toxic) Fuel of Life. Biochemistry, Genetics and Molecular Biology. "Free Radicals and Diseases", edited by Rizwan Ahmad, ISBN 978-953-51-2747-5, Print ISBN 978-953-51-2746-8, Published: October 26, 2016. CXIX d) Divulgación 1. Uribe-Alvarez C, Chiquete-Félix N, 2017. Las enfermedades transmitidas por vectores y el potencial uso de Wolbachia, una bacteria endocelular obligada, para erradicarlas. Revista de divulgación de la Facultad de Medicina. 60(6):51-55.1. 2. Espinoza-Simón E, Rosas-Lemus M, Cabrera-Orefice A, Uribe-Alvarez C, Chiquete-Félix, Uribe-Carvajal S. 2014. Oxígeno, para bien y para mal. Revista de divulgación de la Facultad de Medicina. 57(6):57-60. MicrobiologyOpen. 2018;e675.  |1 of 16 https://doi.org/10.1002/mbo3.675 www.MicrobiologyOpen.com  |  Construction of artificial ecosystems mimicking symbiotic relation- ships have been proposed to study ecology and evolution of symbi- oses (Hosoda et al., 2011; Momeni, Chen, Hillesland, Waite, & Shou, 2011), to engineer microbial consortia (Brenner, You, & Arnold, 2008; French, 2017; Frey- Klett et al., 2011; Mee & Wang, 2012), and to host uncultivable bacteria (Stewart, 2012). Synthetic mutualism of species that do not interact naturally has been established in co- culture between bacteria, yeast, amoeba, alga, cell lines, and tissues (Buchsbaum & Buchsbaum, 1934; Hosoda & Yomo, 2011; Hosoda                  Vilar, 2007). Several bacterial endosymbionts have been found in yeast (Kang, Jeon, Hwang, & Park, 2009; Saniee & Siavoshi, 2015) as !" #$ % | '!" *+< = | >?!" *+< = $@D"  EG%* O R I G I N A L A R T I C L E Wolbachia pipientis grows in Saccharomyces cerevisiae evoking early death of the host and deregulation of mitochondrial metabolism    1|    !1|"  #$ % &'1|  ($) * +,2|$ -"  .,$( $ $3| " /&2|$ $041|5,$    61 This is an open access article under the terms of the Creative Commons Attribution License, which permits use, distribution and reproduction in any medium, provided the original work is properly cited. © 2018 The Authors. MicrobiologyOpen published by John Wiley & Sons Ltd. *Cofirst authors. 1$?!NQ+ D' de Fisiología Celular, Universidad Nacional >X!+QZ [!!!+QZ  +QZ 2$?!\]^[<! $' D'!_']^ Celular, Universidad Nacional Autónoma de +QZ [!!!+QZ +QZ 3`!!!\!`\D+j$ _! !j'!'?'D `'!! q>X!+QZ x?  j!!+QZ +QZ $ 7$,& Antonio Peña and Salvador Uribe-Carvajal $?!NQ+ D' de Fisiología Celular, Universidad Nacional >X!+QZ [!!!+QZ  +QZ j'"?!{}Z '{} Z , . 8$ - $ $XN!>''!~' >!Q `'!!q>X !+QZ NE>!q"Dq # * !Dq # ['€q![< x]^ NE>!q" #=% and 344726  & Wolbachia '?'!% ‚} ' '?'  '''}<?] '}< ?Z?'' }'? !'`!'!]!]- neering the biochemistry and physiology of Wolbachia holds great promise for insect vector- borne disease eradication. Wolbachia is cultured in cell lines, which have long duplication times and are difficult to manipulate and study. The yeast strain Saccharomyces cerevisiae W303 was used successfully as an artificial host for Wolbachia wAlbB. As compared to controls, infected yeast lost viability early, proba- <''}<]!Z!?'?<< observed at late stages of growth. No respiratory chain proteins from Wolbachia were detected, while several Wolbachia F1F0- ATPase subunits were revealed. After 5 days outside the cell, Wolbachia remained fully infective against insect cells. 9 : ; <   5 ]' !'<'' Z!?'?< Saccharomyces cerevisiae, Wolbachia pipientis | URIBE- ALVAREZ ET AL. '}]'Z'<?! S. cerevisiae is widely used '!]''<!]<DS. cer- evisiae, it is possible to study processes such as the Crabtree effect '!   ' ƒ$„  ]   $  ‡ ! ! !  '?' Z 'E?}' ƒ  \]'  [?   N!  ‡ D !!   ' '! '''!<$q>!q>?ƒ>'„!]'  N‹ +<' $^  G‡ !}<!- }}'!Z'ƒ]]'''  =‡!< }}]'<Z?''!?'''Yarrowia lipolytica and the mammalian brown- fat mitochondrial uncoupling ?' ƒ`[~'‡ ƒN„['   ‡ x'    ' observed that Wolbachia grew in S. cerevisiae, the system was char- ! !  }}' } Wolbachia infection on its host were <! N]Wolbachia in insect cell cultures or in live hosts presents difficulties that have precluded detailed biochemistry and physiology '!'ƒ\!!]  #  Œ! _ + $'  2013). Here, we used the S. cerevisiae strain W303 as an alternative host for Wolbachia w>\ ! <!  'E!'< '<' D}! <'' !!   ' x' ?< '!}<]!Z!?'?- ylation activity observed at late stages of growth. Understanding Wolbachia and host- Wolbachia interactions holds great promise for medical, parasitological, and biotechnological applications. = |: >0:#:"0 : :5 =?|=@& - & Aa23 cell line (Aedes albopictus infected with wAlbB) (O’Neill et al., 1997) was kindly donated by Professor Anne Fallon (U. Minnesota) ! !  j]ˆ'  '' ! ƒ+j+  ] [[+ G#‡+j+' '??!' !!'-  ƒ  N!<   _  =‡ x ! ' }„ '!ƒ+?   μm) and stored in 200 ml aliquots at 4°C. Prior to use, heat- inactivated fetal bovine serum (FBS; 30 min at *G[‡'!!!}} ‚ƒ  =‡ x'']xx#  # ' ?!'' %[*‚[@2'?ƒj[@[[[@2 incubator or in Corning culture flasks, Shanghai, China). Subcultures ?}! " '? ‚}>'?}' cell line was treated with tetracycline to eliminate Wolbachia infec- ƒ> x‡ƒ$' +'! Œ \' @ˆq  ‡ =?=|    AA Viability of Aa23 cell line, Wolbachia or yeast was assessed using the BacLight live- dead staining kit (Molecular Probes, Carlsbad, CA). Ten microliters of cell suspension were stained according to the manufacturer suggested protocol and viewed in an epifluorescence qD@q'? =?@| ,-7$. $BWolbachia! $,  , 7 $8 , . The original idea was to find a system where Wolbachia would grow Z„x!' !'?''!}!'<' such as Sodalis and Coxiella }! ƒ$+!    @'!    ‡D'}!'?'!! improve survival in isolated Wolbachia, even if we never observed substantial growth. Some of these agents were: (1) Trehalose and other compatible solutes such as mannitol, glycerol and sucrose, †'?ƒ[ ! [  G ' D'  Lighthart, Crowe, & Crowe, 1995) and isolated proteins (Sampedro & Uribe, 2004) (2) Actin, which supports binding and movements of some endosymbionts in vivo. (3) Catalase which deactivates hy- !] ?Z! ƒ$  +!  ‡ ! ƒ#‡ \! } ] mammals, which has been used to grow Sodalis ƒ$  +!  1999) and increases Wolbachia'ƒ> ' +N  2015; McMeniman, Hughes, & O’Neill, 2011). Human blood was also effective. First, we tried growing Wolbachia using sheep blood. However, ''<! ''}Z  ''   | URIBE- ALVAREZ ET AL. had to be discarded often. On one occasion we obtained positive wsp gene amplification from a yeast colony grown in one of the agar plates. Out of curiosity, we studied the host, which turned out to be S. cerevisiae. From this accidental finding we decided to test a known strain of S. cerevisiae as an alternative host. We learned that, in order to support growth of Wolbachia, yeast culture media needed to be supplemented with blood, which eventually was sub- '!   }   Z '' ! none of the contamination problems. Neither compatible solutes, nor catalase nor actin enhanced growth. The second addition needed was bovine fetal serum, which was present in all original growth media but not in yeast culture media. FBS was titrated and !!?'] ‚ Among laboratory strains, infection was successful in W303 and q\#  }‚ \Ž'! ƒ_] ‡xS. cerevi- siae strain W303- 1A (MATα; ura3- 1; trp1Δ 2; leu2- 3,112; his3- 11,15; ! „  „ ‡ƒN„>]  #‡ Wolbachia '! !<'}}''}}Z?- 'ƒ''‡ =?C|Wolbachia w( infection of the Saccharomyces cerevisiae W303 yeast strain (wScW303) A first yeast infection was performed following a modified cell  } ? ƒ$'   ‡ > ?!'  performed under sterile conditions. The Aa23 cell line (containing Wolbachia) was grown in Corning cell culture flasks (225 cm2) as described in (Shih et al., 1998). After 20 days of culture, cells were scrapped and concentrated by centrifugation at 3,000g for 5 min. _]  ‘ 7'''?!! j]' !!Z!} ƒ* ‚E‡''- ]''!'ƒ'] N'   G‡x] was centrifuged at 3,000g for 10 min to remove unbroken cells. The supernatant was passed through a 2.7 μm syringe filter and the fil- trate containing bacteria was centrifuged at 16,500g for 10 min. The pellet was resuspended in 2 ml of Mitsuhashi- Maramorosch medium (MM) supplemented with 1 mmol L’ ammonium ferric citrate and ‚}'ƒ_\‡ƒ++__\‡D? <''        D}}Saccharomyces cerevisiae with Wolbachiaƒ‡_D…']Wolbachia G$q>'?}?!“' 670 (pink) was performed on 14 day old cultures of infected and control S. cerevisiae strains W303 (ScW303), BY (ScBY), and NB40 (ScNB40) ƒ‡>} #!<'?'} ?]}}!'!''?'<! (a) (b) | URIBE- ALVAREZ ET AL. ]”!Ž~$} '!!}]! 3,000g}[]<'Z<]'?- vents thickening of the cell wall (Aguilar- Uscanga & Francois, 2003;   >„+< \ j]]  ‡x induce contact between bacteria and yeast both bacteria (the whole '?‡!<' ƒG ]‡Z!!}]! 2,500g}  [ƒ$'  ‡\„}!<' were plated (all 2 ml) on a Petri dish containing MM supplemented with 1 mmol L’   }  ?' *‚ E !!  ?†]! <<' ! ‚ ] ƒ++ _„!‡ ! !  %[   *‚ [@2  ƒj[@  [ [ [@2  ]?‡} #!<' ƒ$+!  ‡ D} '}!<_D…!~[D}!<'''}! a fresh agar plate every month for up to 6 months, then yeast was discarded and a new sample was used. Some aliquots were added # ‚]< }!'!’= [ ''?' remained infective for nearly 10 months. To transfer Wolbachia from yeast to yeast, slight modifications to the protocol were made: An aliquot of 100 μl of yeast taken from  ]<„} '?   ? } }! <' ' ' !!  Ž~$_ ‚_\!?! Ž~$_„!] ?' ]*‚[@2. After 14 days, all cells grown in a Petri dish were collected and washed by centrifugation at 3,000g for 3 min at 20°C with sterile water and the pellet was suspended  ++x''?''Z!} ?'- } # *• G '']''!' ƒG ‚E‡ to disrupt yeast cells (note that beads were smaller than those used } '  '‡ $'?! <''  }]!   g for 10 min and the supernatant was centrifuged again 3,000g for 10 min. The washed supernatant was filtered through different 0.8–0.65–0.45 μm syringe filters. Again, we used filters with smaller ?'  ' '! }  ' !   ' ' } <' cells. The last filtrate was centrifuged at 16,500g for 10 min. The ?ƒG ]‡'''?!! ++__\!'! infect yeast from 3- h cultures as described above. The yeast–bac- Z'?!Ž~$_]?!! %[*‚[@2}'%!<'D}'!'] _D…!~[ =?G|  ,- &$8w(-infected Saccharomyces cerevisiae W303 D}!S. cerevisiae''†?Ž~$?' ’ am- monium ferric citrate agar plates. When transferring to liquid me- dium, a loophole from the desired strain was suspended in 100 ml of 'Ž~$!! =[   ?}#=~' !!Ž~$!!'!- tions for up to 14 days. When transferring from solid to solid media, ?}<''''?!! Ž~$'??! 1 mmol L’   }  ?' ‚ _\ ! ?!  Ž~$]>?'']< •†''?}!! maintain the infection. When it was desired to eliminate Wolbachia from yeast, tetracycline 30 μg/ml was added five consecutive times !'?'']'?}!ƒ$'  ‡ =?H|Wolbachia w( 8& $$8 H @HAedes albopictus cell line To determine whether Wolbachia cells retained its infective abil- ity after all treatments, Wolbachia were isolated from S. cerevisiae ]”!Ž~$_ ‚_\!<'!}} against a C6C36 insect cell line. =?I|Wolbachia 8&7 $ Jwsp).0  identification The Wolbachia wsp gene was amplified using the following prim- ers: wsp = _ ƒ*— xNNx[[>>x>>NxN>xN>>N>>>[ —‡ ! wsp G  ƒ*— >>>>>xx>>>[N[x>[x[[> —‡ ƒ\]  ˜  $'  & O’Neill, 1998) in a 25 μl reaction volume using recombinant Taq $q>?<'ƒx_'}‡~[?}' performed as reported elsewhere (Braig et al., 1998; Xi, Khoo, & $'  G‡x~[?!'?'! ‚]- ']!'!!!~[?!'?- }!']Nšjx~[?}ƒx_'}‡ ! '”!   + \]< `   D' } Cellular Physiology, UNAM. =?K|$ &&  A ,  $J5*L Wolbachia G$q>]!?!“'G%  dye (λem647, λZG% ‡ ‰  *—„>>x[[NN[[N>[[N>[[[„— ' '! } _D… ''<' ƒ…!!  N  !  ['   Nardon, 1999). One milliliter of the desired culture was centrifuged at 3,000g for Aa23, C6C36 and yeast, and 18,500g for purified Wolbachia for 5 min. Protocol was followed as reported elsewhere ƒN< \ ! \Z  #‡?'! in a FluoView FV- 1,000 Olympus confocal microscope, NA 1.4   › € D]'  <!   _Œ„Œ Olympus software. =?M|N& -.8$ & &$ & $ Fourteen day old infected and noninfected yeast samples were visu- !@<?'„_Œ _Œ„ '?'˜„- ]'  '! '] D' %   ! D] š '} Calcofluor- white (0.05 mmol L’   ‚$+@„ ’ Bicine Buffer) was used to stain fungus cell wall. =?O| $,  Primary antibodies: Mouse monoclonal Anti- Wolbachia Surface ~ q„  ' } \jD ''  qD>D$  qD… +' >„Œ$>['}>!<!<"…~   | URIBE- ALVAREZ ET AL. ?!>„'!<}š†'D'ƒ‰' N ~>‡ =?|< $ A loophole from yeast grown in solid media was suspended in 200 μl of water; otherwise, 200 μl from liquid culture samples were cen- trifuged at 3,000g for 5 min and washed twice in water. The pellet ''! μD~>}}ƒ *’ Tris•HCl pH 7.6, 150 mmol L’ q[  ‚q~„#  ‚'!!Z<   ‚$‡ supplemented with protease inhibitors 1 mmol L’ PMSF (Sigma- >!‡ ! [? ?'  † ƒ„[@„@‡ as recommended by the abcam protocol. Samples were lysed in a 'Œ[' ƒ''  D q [x‡ = ‚?!} '!}!]+„ŒZ Œ„ ƒ\' ] ‡} #[?'- fuged at 15,160g for 5 min. The supernatant was recovered and pro- tein concentration was measured by Bradford in a PolarStar Omega ƒ\+N @] N<‡ƒ\!}!  %G‡žG#Ÿ?' were diluted in a 4X buffer (500 mmol L’ x' ?…G=  ‚]<  ‚$   *‚„?„  !  ‚? ‡!!}*$E~>Nj'?}! ‚?<- acrylamide gels and electrotransferred to poly(vinylidenedifluoride) ' ' ?! ' ƒ[”„_Z   ‡ +'†!*‚\}!<†x\„x (50 mmol L’ Tris, 104 mmol L’  q[  ?… %G   ‚ x ‡ } 1 hr, and incubated overnight at 4°C with the primary antibody. Membranes were washed with TBS- T and incubated at 37°C for 1 hr with secondary antibody. Membranes were washed again and  !'  !?! < ' ']  j[ † ƒ>' \''  Nj  …‡ ƒ[”„_Z   ‡~Œ$_''??!'!!<?- ']!„'??]}} †!*‚\}!< milk in TBS- T and reprobed with a different antibody as indicated. =?=| -  $& $ - & $&$7A$8wScW303 D}'''''!<''''?<ƒxj+‡ following a protocol from (Sun et al., 2015). Briefly, 500 μl of cells were harvested from 100 ml cultures of infected and uninfected Saccharomyces cerevisiae cultures form the first unintentional in- fection (wSc) at 10 days and wScW303 of fourteen days. Yeast and Wolbachia samples were washed twice in distilled water at 740 g for 5 min for yeast and 23400 g for 10 min for bacteria in an j??!}}[}]*# *[?'}Z!  ‚+@4  #[ ] qZ !<  '?'  '! } *  !!  'Z ' ! !?…G=!€'!‡Ž' !'?!']\!\ ] ƒ\'?~!'  OK, USA, final volume 50 ml) with 0.425–0.6 mm glass beads dur- ing three 20 s pulses separated by 40 s resting periods in ice (Uribe, ] j'?^ >]   ‡x]'!}}< centrifuged to isolate mitochondria similar to described in (Peña, Piña, j' ~   %%‡\}< '}]! g for 5 min. The supernatant was centrifuged at 9,798g for 10 min and the ? ' ''?!!  +j„ }} ! }]!  3,000g for 5 min. Finally, the supernatant was centrifuged at 17,500g for 10 min. The resulting pellet was resuspended in minimal volume ! ?  ' '! < \ ƒN  *%‡ using a Beckman Coulter spectrophotometer at 540 nm. =?C|!A- A Mitochondrial high resolution respirometry was assessed in an @' Z<]? ƒ@' D' [?  D'†  >'‡ using 5 mmol L’  +j  G ’ mannitol pH 6.8, 10 mmol L’ KCl and 4 mmol L’ Pi at 30°C. Final volume in the closed cham- ber was 1.5 ml with a protein concentration of 0.5 mg prot/ml. Bacterial protein concentration of 0.5 mg prot/ml was used. The trace was started by the addition of 5 mmol L’ of the indicated ''" ]<„„?'?    q>$…  ?<„  ' ]]_[?ZDŒ- tion, 5 mmol L’ ascorbate (pH 7.6)- 0.05 mmol L’ x+~$''! ƒ`  ~   =*‡'?<''! using 0.5 μE  !' DD '?!  L’  >$~  !  ?'?<! ' ƒ`   =*‡ '?<''!}]- tions: 0.1 μmol L’ rotenone, 0.15 mmol L’ flavone, 0.1 μmol L’ antimycin A, and 2 mmol L’ cyanide (Uribe et al., 1985).0.5 μmol L’ [[[~'!!!'?$<!'] Oroboros Lab software. =?G|:& $7$  && ,  gel activities \]?''ƒ\q„~>Nj‡!]„' ?'' ƒ[q„~>Nj‡?}!'  ƒ‰]  | URIBE- ALVAREZ ET AL. Braun, & Schägger,2006; Wittig, Karas, & Schägger, 2007). Whole ''! ]!!<'!E]??' 1 mmol L’ ~+_![??'†ƒ„ [@„@‡!'†} #[+'}]! at 23,680g at 4°C for 1 hr. Protein concentration in the supernatants was determined by Bradford (1976). Between 0.1 and 0.15 mg of ?!!*‚• *‚?<<!]!]'‰ „[q~>Nj?'''?}!  ‚<'! !  *‚'!!Z<!!!!}} ƒ‰]  %‡žGŸN'} *>E ]\„!?''D„]q>$…„q\xZ!„ reductase (100 μ]?‡ '„q\xZ!„!'ƒ * μg protein), cytochrome cZ!' ƒ μg protein), and in- gel ATPase (100 μg protein) activities were done as reported previously (Uribe- >   G‡ μ] ? } '! \ … Mitochondria (BHM) were loaded in each gel as controls. =?H|" #" #5P#5 D!! !' } „[q ~>Nj  \q„~>Nj  <- < !]'!  '?!   …~[ j†'?[ # * ƒj†']  !! [< [>‡ ! <!   +>$D„x@_Ex@_ #=  ~' '''?ƒ>\Z _]+>‡ƒ† x'  … @' +  G‡`!!!NX ~X <+X [DqŒjx>Œ„D~qN!+E+'? ?!']~~ '}#  ƒ>\Z _] MA) against the Saccharomyces cerevisiae ATCC 204508 database (downloaded of Uniprot, 6721 protein sequences) and Wolbachia genus database (downloaded of Uniprot, 47781 protein sequences) using Paragon algorithm. @ |:5 "5 @?|!7$8 $B   AQ  8 &  host Saccharomyces cerevisiae<@O@77$ . $B of Wolbachia w( To study Wolbachia (wAlbB) large biomass yields plus a host that is easy to manipulate are needed. After testing different alternatives (see Methods), it was discovered that different S. cerevisiae strains were susceptible to infection and supported active Wolbachia proliferation. At 14 days of infection, Wolbachia grew efficiently in S. cerevisiae strains W303 (ScW303) and NB40 (ScNB40), while strain BY (ScBY) supported only a weak infection (Figure 1a). After #!<'  ?] } }! ' ! < _D… '] probes against the Wolbachia G $q> ' % =‚¡=%‚ } Sc‰ !* ‚¡ #‚}ScNB40, while in ScBY less than ‚'?'}_D…ƒ_] ‡ScW303 was chosen for further studies. Sc‰ ']}Z!- tive phosphorylation regardless of the carbon source, it is highly ''  Z! ''' ƒ@?    !  !   Barrientos, 2012) and it has a weak cell wall (Avrahami- Moyal et al., 2012). Strains used in this study are detailed in Table S1. @?=|0 $ 8  $$8Wolbachia in ScW303 was 8  &$8 -, ., 88  ,7, -$,8$$BJ . =L @?=?|0 $8Wolbachia$  8&7 $  gene (wsp) Both the Aa23 cell line (Figure 2a) and infected S. cerevisiae (wSc‰ ‡ ƒ_] ‡ ?}! G* ? }]' Z] '- ”' ‚!'}?}Wolbachia en- dosymbiont of Aedes albopictusƒq[\D!'"[ #  ‡ƒx  ‡~[?}!''!<„ treated Aa23 cell line (Figure 2a, Aa23 Tet) and in the noninfected yeast (Figure 2b, ScW303). Tetracycline used continuously in cell cultures is reported to kill Wolbachiaƒ$'  ‡ @?=?=|< ($A ,&,Wolbachia B7 S. cerevisiae D>  %†$?'?!]Wolbachia Surface protein (wsp) was revealed with anti wsp antibodies (Bei re- ''  qD…  +$‡ ƒ_]   > ‡ x' ! !'??! } ]   ?' } < ƒ>  x‡ Œ$>[ ƒŒ] !?!‡?''!'!]D non–infected yeast wsp was not detected, (Figure 2c, ScW303), while in infected yeast the wsp western blot signal was first detected at day 3 and increased gradually up to day 10, remaining stable until day 14 (Figure 2c, wScW303). (For images of original Western Blots, see Figure S1a). When tetracycline was added to the medium, the wsp sig- nal decreased, disappearing by day 10 (Figure S1b, wScW303Tet). @?=?@|$ -. $B, A,B  observed in infected S. cerevisiae $]  }' !<' }   ] ' } }! wScW303 were similar to the controls (Figure 3a). Then, begin- ning at day 14, wScW303 absorbance decreased. Cell wall degra- dation (Figure S2) and viability staining (Figure 3b) confirmed that wScW303 viability was rapidly lost during the late stages of the sta- tionary phase, from 14 to 18 days of culture. D !!  !] ]  '? < } both S. cerevisiae = q> !  Wolbachia wsp were tested. Transcription was high in S. cerevisiae from the first day, decreased at day fourteen and became negligible at days 16 and 18 (Figure 3c). D '  '? }  wsp from Wolbachia became de-  < } !<'  '! Z?<  !<  and remained constant until day 14. Then, at days 16 and 18, tran- scription decreased abruptly (Figure 3c). Transcription data in the Wolbachia/S. cerevisiae system indicated that Wolbachia activity grew later than S. cerevisiae ]Z !<'  beginning at 14 days both transcription activities decreased abruptly in parallel with the death of the host.   | URIBE- ALVAREZ ET AL. @?=?C|;&P,$A- $ -.B  observed by staining S. cerevisiaeB  &$8$  white and w(B R HIO \  '  !  x„~[ Z?' ']]'! that Wolbachia grew in the presence of S. cerevisiae becoming !!<' • #D!!Wolbachia was inside yeast, samples from infected and noninfected yeast '} #„!<!'<!!']Wolbachia '?} G $q>? !“'„G%  ƒ_D…‡x  the yeast cell wall was stained with Calcofluor white (Figure 4, Movie S1, Movie S2), Staining of the S. cerevisiae cell wall allowed observation of labeled bacteria inside yeast. Figure 4 shows  “'„G%  '!< wScW303 and not in Sc‰  +] }  [}  “'„G%  ! [ field (Light) images show bacteria are inside the cell (Figure 4). x!'''}„'?}!wScW303 sample show the intracellular location of different bacteria (mov- '   !  ‡ D  ??< } '   !   } !- pendent bacterial labels were detected, which we speculate, may come from bacteria inside heavily deteriorated host cells whose cell wall was not stained by Calcofluor (movies S1 and S2). @?=?G|:# -.,&,Wolbachia inside S. cerevisiae Transmission electron microscopy images further suggested the intracellular location of Wolbachia. Cultures of 10 and 14 days of control and infected S. cerevisiae<!D }!<' cells (Figure 5b–f, g), bacteria- like bodies (Figure 5, labeled *) that are not present in the uninfected yeast (Figure 5a and d) can be observed. At 10 days both infected and noninfected yeast present mitochondria, which can be identified by the presence of inner 'ƒ_]* !‡D' #!<„!- tures of ScW303 lost most mitochondrial structures, which suggest that these organelles are dysfunctional probably because cells are '<?'D'  #!<'„!}!wScW303 show Wolbachia plus mitochondria where the typical cristae pat- tern may be observed, suggesting abnormal preservation of mito- !}!<'ƒ_]*•]‡DwScW303 cultures, we can observe different cell images: most cells had an intact plasma membrane and contained mitochondria and bacteria- like bodies in- '!ƒ_]*‡@'Z!!]!' bacteria like structures were still present (Figure 5f). Among the whole population, we found some budding yeast, where bacteria- like bodies can be seem concentrated in the bud (Figure 5g). None of the latter populations was found in control ScW303 cultures. @?=?H|Wolbachia-infected yeast retained high - $&$, $! , 7$7$ A $&  A8$  $ -A$.7 $, >?'''}<!}}!<''Z- plored in our infected ScW303/w>\'<'x''<'Z! an abnormal preservation of mitochondria (Figure 5), so it was logi- Z?<x'? Wolbachia and aerobic metabolism in the host is a matter of con- troversy. Some authors have proposed that these endo- cellular or- ganisms possess an aerobic metabolism that contributes to overall activity (Strübing et al., 2010) while others suggest that Wolbachia ?'  ' < '??<]  ]?' } '- ?<?Z'ƒ$<  _ \!!] [         $}Wolbachia in Saccharomyces cerevisiae W303. (a) Agarose gel electrophoresis of the wsp~[?!'?!! 'G ?!> '"+ D] †?'$q>!! >  }! > x }! (b) Agarose gel electrophoresis of the wsp~[?!'}S. cerevisiae'"+ D] †?'$q>!! ScW303, uninfected original yeast; wSc‰  }!<'ƒ‡‰']''?!Œ$>[?'_' }'> }!! '!> ¢<„!Ž''?'†  * %  ! #!<'?'}>?'' †} !<Ž~$„ ‚]}!„wScW303. Negative control was a noninfected sample ScW303 (a) (b) (c) | URIBE- ALVAREZ ET AL.   # _'  * …!!   £]  ‡x' !!!Z!?'?<- tivities in our system, which preserved mitochondrial structure be- yond the stationary phase (Figure 5). When isolation of Wolbachia was attempted, it was found that the bacterium and mitochondria migrated together (Baldridge et al., #  `   =*‡ x'   ' !!!   Z- idative phosphorylation activity in the mitochondria/Wolbachia Z !  !   }  < '] !}}]'”'x}Z<]'? was measured using ethanol as a substrate (Table 1). We isolated the mitochondria/Wolbachia fraction from either one- day cultures        Wolbachia in calcofluor- labeled S. cerevisiaeD}!ƒwScW303) and noninfected (ScW303) S. cerevisiae'<!!  G$q>Wolbachia?ƒ“'G% ?†‡x <'''!}„ƒ[} ‡ confirm the endosymbiosis. Merge images are shown to evaluate the presence of Wolbachia inside yeast        S. cerevisiae growth, viability, and transcriptional activity in the absence and presence of Wolbachiaƒ‡N' of ScW303 and wSc‰ ]Ž~$ [   ?} =!<'ƒ‡Ž'<!}}!<'}”}!< microscopy with the BacLight viability kit. (c) Amplification of the wsp gene of Wolbachia! =q>]}S. cerevisiae of samples taken at different days of culture (a) (b) (c)   |URIBE- ALVAREZ ET AL. where there are very few Wolbachia cells or from 14- day cultures, where Wolbachia']ƒx ‡ D„!<' from ScW303 and wScW303 respiratory activities were very sim-  …   #!<'  ' } Z<] '? ! '?<' ƒ[‡!<!}}' }'" D- }! <'     } Z<] '? ! '?- <  !'!   Z?' } '     in contrast, wSc‰  ! ] ' } Z<] '? plus high respiratory controls, i.e. in 14- day old Wolbachia- infected <'Z!]Z!?'?<<  '' ?'}!'!<xj+}! cells (Table 1). @?=?I|7 &$8Wolbachia the &  A$8, 88 - $&$,  7 $ A &$-7!B7  , D  '!!EWolbachiaZ  '!'?- } ''' }  '?<  ?ZE< ƒx‡ D„!<''}Z<]'? were similar in infected and noninfected S. cerevisiaeƒ_]G‡D ]!!}}!<' Zq>$…!<- !]' ƒq$…   ~<„+‡  ' !'„x+~$‡ '  ']<!'!D'   #!<„!! fractions from Wolbachia- infected cells, respiratory activities in the presence of glycerol- 3- phosphate, pyruvate- malate, and succinate were increased in comparison to 1- day cultures. Since S. cerevisiae !'   ?Z D ! ?<„ !- ?! '? ' ''    !Z < '' †< } !q$… !-  ?Z D  Z! ' ?< ! < < >  !]  ' }   Z!' [?Z DŒ ! q>$…„!?! Z<] '? ' were still decreased as compared to mitochondria from one- day cultures (Figure 6). Other respiratory substrates, namely glu-  ! ]    '! < †' ƒ‰†  x  ==‡''<!!<!!'??Z<]- sumption. The respiratory activities measured indicate that the mitochondria/Wolbachia fractions from the infected and nonin- fected yeast consume the same substrates and are inhibited by the same respiratory chain inhibitors.         j'?<]'}}!!}!Saccharomyces cerevisiae at different times of incubation. Transmission electron microscopy images confirm the intracellular location of Wolbachia. 10- day images were taken with uninfected (a) Sc and infected (b–c) wSc; 14 day- old images were taken with (d) ScW303 and (e–g) wSc‰ D]''?'}„† bodies (*) that are not present in uninfected yeast and mitochondria (m) whose cristae can be easily identified (a) (d) (e) (f) (g) (b) (c) 5/J.P- -. 7 $L 5J.P- -. 7 $L  P/ $<ScW303 * ¡ * *¡G=  ¡  * $<wScW303 %#¡#G G*#¡ #¡  #$<'ScW303 G¡*  ¡G ¡  #$<'wScW303 # ¡* %¡   ¡  Z" G’ mannitol, 5 mmol L’ +j ?…G= #’ Pi, 10 mmol L’ KCl. As substrate, 5 mmol L’ _'DDD  ’ >$~      @Z<]'?'} mitochondrial fractions from 1 and 14 day- old cultures of Wolbachia- infected (wScW303) and noninfected (ScW303) Saccharomyces cerevisiae cells WI LE Y VCroDIologywpen Ñ 14 Days 1 Day mM wSc W303 O Sc W303 e wSc W303 O Sc W303 20 orto 5 Be, E l e 2 x* de 6 3 | M a el e 1, gi > ds 5 Y + “o 2 . 0 o * +l y +] el $ +| S o 2 + % % "ichea : 4 ¿ El % an * i z 38 8 8 $ 8 " 8.8.3.8 9 Z. 28 RR * 04d Su U p 3 jeu 30d 3 ¿ U N O 31eu 30d Su, o / o 3jeu * % % , O Its E % Rh 9 8 |? r T Y T T 1 r T T Y 1 S a e 3 3 2 8 2 8 g 8 2. 8 2 s e 10d Su, Uu/O3]eu 30d Su, U U 3 j e u 30d S u r U I /O 3 jeu 250 10d Sur, U U 31eu | URIBE- ALVAREZ ET AL.   |URIBE- ALVAREZ ET AL. @?=?K| , !7 -&$,  $,Q infected wSc<@O@$!A.&$-7 $&  AB mitochondrial x Z?'  ']]'!   Wolbachia has  Z '  '?  ' !  Wolbachia respiratory proteins may be damaged when the mitochondria/Wolbachia } ' '! ! Z?'!  Z<] xZ?'?''<} '!„]' in the mitochondria/bacterium fraction. As eukaryote and prokary- '?<?Z' D  DD  DDD ! DŒ!}} masses the contribution from each organism to a given activity would be easily detected by native gel electrophoresis. The in- gel ' }  ?Z } }! ! }! <' } ! #!<„!'<!!  '' - tivities were detected only at MWs corresponding to the mitochon- ! <' ƒx   _]%‡ ']]']    } ScW303/wAlbB system and under the specific conditions of growth reported here, Wolbachia!!Z?''<}'?< chain proteins. The above results suggest that mitochondria were '?'}'!Z<]'?<   q>$… !x~' < }  !EWolbachia '  !}} !'  '! x' ' Z?! '  ??'! +‰'  ' } }  >x~''" *#†$ for the eukaryote S. cerevisiae ! * †$ } ?†<' Escherichia coli and Paracoccus denitrificans ƒ\† „˜]  Ž +   š† † !]   +'„'  +]<  '   ‰†  *  ' et al., 2013; Schagger, 2002). However, the ATPase activity band ƒ_]%> x#‡'”Z!Z}<'! Wolbachia>x~'?'\q![q„~>Nj'' ! that if WolbachiaZ?'''<'??' ƒ'  ?''<‡  !  Z? !'  - centration was negligible when compared to the mitochondrial proteins and to its own F1F0- ATPase.         Wolbachia•!!}}'Z<]'?<}'!<'!…]„' '?< !<„!'}}!ƒ $<Sc‰ ‡!}!ƒ $<wScW303) yeast and 14 day- old cultures of noninfected ƒ #$<'Sc‰ ‡!}!ƒ #$<'wScW303) yeast. 5 mmol L’ from each substrate was added as indicated: glycerol- 3- phosphate ƒN~‡ q>$… ?<„ƒ~<„+‡ 'ƒ‡ !'„x+~$ƒ>'Ex+~$‡‰!!  *μmol L’ CCCP, 0.1 μmol L’ ƒ‡   μmol L’ antimycin A (Ant A), 1 mmol L’ cyanide (CN- ), and 0.15 mmol L’ flavone. 0.5 mg prot/ml of !ƒ+‡!!!$?'¡j+x'‘p < .005, **p < .001 for ScW303 versus wScW303 yeast on the same day. T test SPTp < .05 SS/TTp < .001 (S, decrease; T, increase) for ScW303 in day one versus day 14 cultures or wScW303 in day one versus day 14 cultures         Wolbachia•!!}}'<}!'?<?Z\q„~>Nj[''„'!]} ScW303 and wSc‰ ''!! #!<'D]q>$…„q\xZ!„!' '!x~'<'[q„~>Nj\q„~>Nj } #!<!}wScW303. Bands 1N, 2N, 1S, and 1A were sequenced (Table S4). Bovine heart mitochondria (BHM) were used as a control | URIBE- ALVAREZ ET AL. @?=?O|Wolbachia remains infective against insect cell lines After being cultured in a yeast cell, the question arose on whether Wolbachia remained viable and infective when isolated. To test this, Z!Wolbachia from wScW303, incubated it in isolation for 5 days and then infected a C6C36 insect cell line which was previ- ously reported to support bacterial infection (Baldridge et al., 2014). Aged Wolbachia infection was successful as assessed by specific ']']_D…ƒ_]=+‡ C | 5 55 N] ] !'<'   ' <!'  '' at high costs (Baldridge et al., 2014; Khoo et al., 2013). To circum- vent this problem, we built a synthetic host–endosymbiont system by artificially infecting the commonly used yeast Saccharomyces cerevisiae strain W303 with Wolbachia wAlbB from A. albopictus (Figures 1–5, Movies S1–S2). Culturing Wolbachia in yeast allowed ''!<?Z'?'!- terium. Using S. cerevisiae as an artificial host confers benefits such ']'']]'ƒN'  N' ‰„‰'  ‡ '}Z?'”!'! most importantly, the ease of manipulating and genetically engi- neering the host cell. Following our approach, it may be possible to construct other synthetic parasite- mutualistic systems for obligate endosymbionts. Our system requirements for a successful infec-  " '??] Ž~$   !  } '  ?'  '?! ] }  }}! j< }'† ! keeping the temperature between 28 and 30°C. These adjustments resulted in successful yeast infection and considerable Wolbachia yields in 14 days as compared with available methods that need up  !<'j}Saccharomyces/Wolbachia system is only a model of the interactions that occur in a naturally infected eukaryote cell, its manageability is outstanding and it may yield results that are not possible in cell lines. Since Wolbachia is an alpha- proteobacterium closely related to mitochondria, it seemed likely that the aerobic metabolic machin- ery of Wolbachia might mimic, enhance, or supplement the respira- tory activity from the host. (Strübing et al., 2010). However, under our conditions, Wolbachia respiratory chain proteins were not detectable, instead, we found an increase in host mitochondrial activity. Another obligate endosymbiont, the Sytophilus oryzae ~?j!'<ƒ@~j‡ ''?!' the mitochondrial activity in the host, probably by providing nu- trients such as riboflavin (Heddi, Lefebvre, & Nardon, 1993; Heddi et al., 1999). Several authors suggest that Wolbachia provides ri- boflavin or heme groups to their arthropod and nematode hosts ƒ\   $<  _'  * ‰ et al., 2009). This may vary with strains as Wolbachia from Brugia malayi (wBm) contains complete sets of riboflavin, heme and nucle- !'<'']'}'†'ƒ$<   _'  * ''  = ‰  #‡D  the host provides amino acid, proteins and a safe, stable environ- ƒ\   $<  _'  *  Wu et al., 2009). The possibility that Wolbachia ''@~j  !]}]?' '<Z?! Z?<''S. cerevisiae libraries have a mutant } ' < <   } !  '<'' pathways e.g. S. cerevisiae genome database (https://www.yeast- genome.org/). `!!''! Z?''}Wolbachia elec- tron transport proteins was not detected. The reported Wolbachia pipientis wAlbB genome (Mavingui et al., 2012) shows that some '?< ?Z ''  '']  ] nuoC and nuo$ }  } ?Z D ƒ  *‡  <  Wolbachia se- quenced genomes contain all the genes necessary for a functional electron transport chain (Klasson et al., 2008), so maybe under different growth conditions, hosts and Wolbachia strains, bacterial '?< ?' <  !! D ' ']]'!   Wolbachia strains should be tested in order to determine whether ''Z<] D!' Wolbachia infection resulted in activation of mi- !<!'<]?'D<'?- lated that such activation constitutes an advantage for Wolbachia !”]}Z<]<?'ƒ''„' et al., 2016) or because Wolbachia needs high ATP that an active mitochondria provides (Potter, Badder, Hoade, Johnston, & Morten, G‡D'!<']]'!<Z?'']?” that Wolbachia sensitivity to free radicals is higher than that of the host (Fallon et al., 2013) and it cannot survive outside a host cell '''†?*‚[@2'?ƒ']  G‡>'  ]]'?!' !'Z<]'  lead to loss of the Wolbachia}ƒ''‡x' ' possible that Wolbachia enters the cytoplasm to hide from high at- '?Z<]!?'' ' ''!}!<?'Z<]'         Wolbachia remains infective after being cultured in S. cerevisiae_D…ƒ“'G% „?†‡}wC6C36 cell line. Light/ “']''<!<'!}! The noninfected cell line C6C36 does not have any of the pink <!†!}!'Wolbachia   | URIBE- ALVAREZ ET AL. >!  !] }Z<]  ' Z<- }' ƒ''„'   G‡ D   Z<] '  '  ‚ ƒ μmol L’ ‡   Z<] ]'  ‚! #‚ƒ G• μmol L’ ) }!<'ƒ$‡'ƒ~  G‡…j x 'ƒ>  G‡‰'Z?'!Z<- ] Z<]''!'!"…j x 'Z?'!G‚Z<]ƒ* μmol L’ ‡Z<- ] ‚ƒ μmol L’ ‡ƒ>  G‡ $' Z?'!  ‚  *‚  Z<] !   Z<]*#‚!  ‚'?<ƒ~  G‡ D!!   ' Z<]]!   area surrounding the mitochondria in rat heart and hepatocytes,  Z<]  ]'   ƒN]  ‡ and 6 μmol L’ (Jones & Kennedy, 1982; Tamura, Oshino, Chance, & Silver, 1978). Thus, a mitochondrion- containing host such as cell lines and yeast would probably provide the endosymbiont with a microaerobic environment. The mechanism for the increase in host mitochondrial activity needs to be defined. D '   !'  } } S. cerevisiae strain W303 by Wolbachia w>\D}!?!} '!?}Z<]'?_Z- periments using other yeast and other Wolbachia strains are needed  } Z?Z! ?'?<?'  'E endosymbiont relationship. This system holds a large potential for different evaluations of biochemical and genetical processes in Wolbachia. Large biofermentors may be used to yield large amounts of biomass as required for different genomics and proteomics studies.  9<": % #:5 >    ' †!< !! < $ > _ }  University of Minnesota. The wsp antibody was a kind gift from \ '' [`> '  [@q>[Žx ~$ } !   \'<~$~]`q>++N'[@q>[Žx~$}- !\!'~$~]`q>+‰ received technical help from the Molecular Biology, the Microscopy !  [? `'  D_[  `q>+ +>$D„x@_ '”- ]'?}!<j^'['}`!!!NX  ~X<+X [DqŒjx>Œ„D~q +Q!„_ + ['„˜ q¥!+[ ]! }   '''+] >$ ƒ`„\!Z‡  $N¥„…? !N$<}'„[Q'ƒD_[ `q>+‡< read the manuscript. " :: 5  None declared.  : :  :  : 5 > ƒ G‡  % #*  Z<]  ''< ! } ?"EEE?'E?!'E %E  % #*E!'E % #*‚ D‚ @Z<]‚ [‚ >''<‚ ?‚ #‚ ƒ'‡?!} Aguilar-Uscnaga, B., & Francois, J. M. (2003). A study of the cell wall composition and structure in response to growth conditions and mode of cultivation. Letters in Applied Microbiology, 37(3), 268–274. ?'"EE!]E  #GE€ #% „%G*›  #Z >'„!]'  D  N‹   ~  +<'  >   $^  š ƒ G‡ Saccharomyces cerevisiae: A useful model host to study fundamental biology of viral replication. Virus Research, 120(1–2), 49–56. https:// doi.org/10.1016/j.virusres.2005.11.018 > …j ' [~ +N j>ƒ *‡j}}}? human blood feeding on Wolbachia density and dengue virus infec- tion in Aedes aegypti. Parasit Vectors, 8, 246. https://doi.org/10.1186/ s13071-015-0853-y >„+<  \  j]] $ƒ ‡@Z?''} ~$j $ „ŒSaccharomyces cerevisiae W303- 1A strain renders it ethanol- tolerant. FEMS Yeast Research, 12(4), 447–455. https://doi. ]E  E€ *G%„ G#  %*Z \† q „˜] š Ž \ + $+ ƒ ‡E function of the beta- barrel domain of F1- ATPase in the yeast Saccharomyces cerevisiae. Journal of Biological Chemistry, 274(23), 16363–16369. https://doi.org/10.1074/jbc.274.23.16363 \!!] N$ \!!] > ‰ \> …]]'  +†'†  T. W., & Fallon, A. M. (2014). Proteomic profiling of a robust Wolbachia infection in an Aedes albopictus mosquito cell line. Molecular Microbiology, 94(3), 537–556. https://doi.org/10.1111/mmi.12768 Bandi, C., Slatko, B., & O’Neill, S. L. (1999). Wolbachia genomes and the many faces of symbiosis. Parasitol Today, 15(11), 428–429. https:// doi.org/10.1016/S0169-4758(99)01543-4 \Z  š  !  +  ~'„\  q [  [  š   …  >  N<  š   _<„  ~ ƒ ‡ D ' !} } - tracellular bacteria related to Paenibacillus spp. in the mycelium }  < }]' Laccaria bicolor S238N. Applied and Environment Microbiology, 69(7), 4243–4248. https://doi. ]E  =E>j+G%# #„# #=  \ Œ N > š] ~  j \! N \} ~ (2004). Vertical transmission of endobacteria in the arbuscular my- }]'N]'?]]]}]- tive spores. Applied and Environment Microbiology, 70(6), 3600–3608. ?'"EE!]E  =E>j+% GG „G = # !\ ‰  š… † N> N† ~š >  j[ _]] +š ¦Œ  š> ƒ #‡Collimonas fungivorans gen. nov., sp. nov., a chitinolytic soil bacterium with the ability to grow on living fungal hyphae. International Journal of Systematic and Evolutionary Microbiology, 54(Pt 3), 857–864. https://doi. org/10.1099/ijs.0.02920-0 Bradford, M. M. (1976). A rapid and sensitive method for the quantifi-  } ] ”' } ? ]  ?? } protein- dye binding. Veterinary Parasitology, 98(1–3), 215–238. \] … ˜ ‰ $'  @ˆq ƒ =‡[]! }]!]€'}?} bacterial endosymbiont Wolbachia pipientis. Journal of Bacteriology, 180(9), 2373–2378. \  Ž  >! _…ƒ =‡j]]'- tia: A new frontier in synthetic biology. Trends in Biotechnology, 26(9), 483–489. https://doi.org/10.1016/j.tibtech.2008.05.004 \ š[ ['' \q ] + ‰'] šš D„@Z  D  +N  j >   @ˆq    ƒ ‡ j! }  provisioning by a common invertebrate endosymbiont, Wolbachia pipientis, during periods of nutritional stress. PLoS Pathogens, 5(4), e1000368. \'  \' +ƒ #‡>}'<''Science, 80(2079), 408–409. [”„_Z q …¥! š+ +Q! š> ˜?!„\'! >  []„X? > +€ >ƒ ‡D]?]'? !'  | URIBE- ALVAREZ ET AL. > }'  ?Z    ‰>  ! >? E  ?<'   ?< Reproduction, 137(4), 669–678. https://doi. ]E  * Ej~„ =„ * [ + ! $ [ š…ƒ G‡D'''?} preserving dry biomaterials? Biophysical Journal, 71(4), 2087–2093. https://doi.org/10.1016/S0006-3495(96)79407-9 $  [   +!  D ƒ ‡ !' ]  ! Sodalis glos- sinidius sp. nov., a microaerophilic secondary endosymbiont }  '' }< N'' '' '' International Journal of Systematic Bacteriology, 49 (Pt 1), 267–275. https://doi. org/10.1099/00207713-49-1-267 $< >[ >'] $ \ N  N …]' +> <  + ¦x< Œq ƒ ‡><''}]Z?'' } Wolbachia genome of a filarial nematode supports both metabolic and defensive roles within the symbiosis. Genome Research, 22(12), 2467–2477. https://doi.org/10.1101/gr.138420.112 $< >[ N >[ >'] $ …< [ › $ ‰']  š+ +†? \ƒ #‡D]!'?!?- teomic analysis of the global response of Wolbachia!Z<<„ induced stress. ISME Journal, 8(4), 925–937. https://doi.org/10.1038/ ismej.2013.192 $„  ] + $ >ƒ ‡x‰]![ effects: On the origin of cancer cell energy metabolism and of yeast glucose repression. Biochimica et Biophysica Acta, 1807(6), 568–576. https://doi.org/10.1016/j.bbabio.2010.08.010 $'     +'!  j š  Œ  ˜  \'     @ˆq    ƒ ‡[}Wolbachia host cell range via the in vitro establishment of infections. Applied and Environment Microbiology, 68ƒ ‡ G*G•GG ?'"EE!]E  =E>j+G= G*G„GG  _  > +  \!!]  N $  [  j +     [ + ƒ #‡ $?}'}!'Wolbachia levels in cultured mosquito cells. In Vitro Cellular & Developmental Biology – Animal, 50ƒ=‡ % %•% ?'"EE!]E  %E' G G„ #„%*=„Z _ >+  [+ [ j+ƒ ‡xZ!]]  ?”  '  Z  Wolbachia than to mosquito host cells. In Vitro Cellular & Developmental Biology – Animal, 49(7), 501–507. https://doi.org/10.1007/s11626-013-9634-0 _'  š  N  +    D  ‰  š  +†    D  q  ¦ Œ  x ƒ *‡ x Wolbachia genome of Brugia ma- layi" j!'<     ?] - tode. PLoS Biology, 3(4), e121. https://doi.org/10.1371/journal. pbio.0030121 _   j ƒ %‡ j]] < '<''   ? metabolism and improve crop health. Frontiers in Microbiology, 8, 1403. https://doi.org/10.3389/fmicb.2017.01403 _<„  ~  \'  ~  $  >  \  +  x††  +   Sarniguet, A. (2011). Bacterial- fungal interactions: Hyphens be- tween agricultural, clinical, environmental, and food microbiologists. Microbiology and Molecular Biology Reviews, 75(4), 583–609. https:// !]E  =E++\ „ N'  > ~ ƒ ‡ Ž' ] Z?'' '!' '] $q> - croarrays. Methods in Enzymology, 350, 393–414. https://doi. org/10.1016/S0076-6879(02)50976-9 N' > ~  ‰„‰' + ƒ ‡x]'} <' responses to environmental stress and starvation. Functional & Integrative Genomics, 2(4–5), 181–192. https://doi.org/10.1007/ s10142-002-0058-2 N< + \ $ ! + \Z šƒ #‡Wolbachia infect ovaries in the course of their maturation: Last minute pas- sengers and priority travellers? PLoS ONE, 9(4), e94577. https://doi. org/10.1371/journal.pone.0094577 N]  j ƒ ‡ @Z<] } }  '? D  [   ~ $ ‰]   ~ … …† ƒj!'‡  Hypoxia: Through the lifecycle (pp. 39–55). Boston, MA: Springer. https://doi. org/10.1007/978-1-4419-8997-0 N  > N ƒ *%‡ ?? ! ! !' }']?' DDD"\!Methods in Enzymology, 3, 447–454. N„['  >„@ $ [„@} > j'?'„ š š NQ„>] + Q„+^ > ¦`„ [€   ƒ ‡ ~<'] ?] } ! Z- idative phosphorylation. Studies in different yeast species. Journal of Bioenergetics and Biomembranes, 43(3), 323–331. https://doi. org/10.1007/s10863-011-9356-5 N„>] + X?„[€ …+ ̀ „> [ j'?„ X j ''„' + [”„_QZ q `„[€  ƒ #‡j}}'}”!'!'- lective channel of Saccharomyces cerevisiae. Journal of Bioenergetics and Biomembranes, 46(6), 519–527. https://doi.org/10.1007/ s10863-014-9595-3 …!! > N >+ ! [ [' … q! ~ (1999). Four intracellular genomes direct weevil biology: Nuclear, mitochondrial, principal endosymbiont, and Wolbachia. Proceedings of the National Academy of Sciences of the United States of America, 96(12), 6814–6819. https://doi.org/10.1073/pnas.96.12.6814 …!! > } _ q! ~ƒ ‡j}}}!<-   ! < '    Sitophilus oryzae (Coleoptera: Curculionidae). Insect Biochemistry and Molecular Biology, 23(3), 8. …}}  + x   >!  > j ƒ ‡ $'   ] hyphae of phylogenetically diverse fungal endophytes. Applied and Environment Microbiology, 76(12), 4063–4075. https://doi. ]E  =E>j+  =„  …'!  †  Ž Ž ] Ž '] > @  q ¦Ž xƒ ‡[?!?''} synthetic bacterial mutualism. PLoS ONE, 6(2), e17105. https://doi. org/10.1371/journal.pone.0017105 …'!  Ž xƒ ‡$']]'<''Bioengineered Bugs, 2(6), 338–341. https://doi.org/10.4161/bbug.2.6.16801 š† >D † š> !] šƒ ‡+! ATP synthase: Architecture, function and pathology. Journal of Inherited Metabolic Disease, 35(2), 211–225. https://doi.org/10.1007/ s10545-011-9382-9 š' $~ !< _Nƒ = ‡DZ<]'??<!]  ! >  ¦†' ~ƒ =‡N}Wolbachia strain wPip from the Culex pipiens group. Molecular Biology and Evolution, 25(9), 1877–1887. https://doi.org/10.1093/molbev/msn133   D  …'!    †    Ž        +     Yomo, T. (2013). Construction of bacteria- eukaryote synthetic mutualism. Biosystems, 113(2), 66–71. https://doi.org/10.1016/j. biosystems.2013.05.006 ' \ D' j ] \ [ š… [ +ƒ *‡ Trehalose and sucrose protect both membranes and proteins in in- tact bacteria during drying. Applied and Environment Microbiology, 61(10), 3592–3597.   ˜  ~]  ¨  X'  >  ~X<  x  q<  ~  †!    ¦ N<€¥  D ƒ ‡ >} ? '<'' ]  ] alga (Chlamydomonas), a bacterium (Azotobacter) and a fungus   | URIBE- ALVAREZ ET AL. (Alternaria‡"+?] !?<']  Folia Microbiologica (Praha), 55(4), 393–400. https://doi.org/10.1007/ s12223-010-0067-9  j N]  \ Œ \} ~ƒ G‡j! or bacterial endosymbionts? To be or not to be. New Phytologist, 170(2), *• =?'"EE!]E  E€ #G„= % G G%Z +]  ~  +  [ Œ  x„Œ  Œ  ‰''†„$ Wolbachia symbiont in Aedes aegypti disrupts mosquito egg development to a ]Z'”'}!'' blood. Journal of Medical Entomology, 48(1), 76–84. https://doi. ]E  G E+j  == + +x ‰] ……ƒ ‡j]]'<''!'< ecologies. Molecular BioSystems, 8(10), 2470–2483. https://doi. org/10.1039/c2mb25133g Momeni, B., Chen, C. C., Hillesland, K. L., Waite, A., & Shou, W. (2011). `']}'<''Z?]<!}'<- bioses. Cellular and Molecular Life Sciences, 68(8), 1353–1368. https:// doi.org/10.1007/s00018-011-0649-y +'„' j +]< +N ' >N ‰† šjƒ *‡ Structure of ATP synthase from Paracoccus denitrificans determined by X- ray crystallography at 4.0 A resolution. Proceedings of the National Academy of Sciences of the United States of America, 112(43), 13231–13236. https://doi.org/10.1073/pnas.1517542112 @? >  š ! j> ! N \' >ƒ ‡ Mitochondrial respiratory thresholds regulate yeast chronological } '? ! ' Z' <  ' Cell Metabolism, 16(1), 55–67. https://doi.org/10.1016/j.cmet.2012.05.013 @'!  >  [†  $ [  …  $  _'  j   Œ    ! $j ¦… >ƒ ‡…'„}]}  “ }  Coxiella burnetii. Proceedings of the National Academy of Sciences of the United States of America, 106(11), 4430– 4434. https://doi.org/10.1073/pnas.0812074106 @'!  >  [†  $ [  …  $  _'  j   Œ    !  $ j  ¦ …   > ƒ ‡ \]]    uncultured: Coxiella burnetii and lessons for obligate intracellular bacterial pathogens. PLoS Pathogens, 9(9), e1003540. https://doi. org/10.1371/journal.ppat.1003540 @ˆq  +~] + †' ~ \] … >!!' x N x' \ƒ %‡D}Wolbachia pipientis in an Aedes albopictus cell line. Insect Molecular Biology, 6(1), 33–39. ?'"EE!]E  #GE€ G*„ *= % *%Z ~!„+   ~   …†  [ ƒ *‡ ~] }]' ' !'<  } Z ?! Nature, 437(7060), 884–888. https://doi.org/10.1038/nature03997 ~  > ~  +˜ j' j ~  jƒ %%‡>!} the rapid preparation of coupled yeast mitochondria. FEBS Letters, 80(1), 209–213. ~ + \!!  …! Ž š' DN + šƒ G‡ +]  Z<] " D?' } j+ G%„ G ' N[ \' šŒ +]< +N _< D+ +  $ +  '  > N   ‰†  š j ƒ ‡ x ' } _ƒ ‡„ ATPase from Saccharomyces cerevisiae inhibited by its regulatory ? D_ƒ ‡ Open Biology, 3(2), 120164. https://doi.org/10.1098/ rsob.120164 ''„'  +  `„>  [  ['„˜  +  Q„ +^  >  [”„_QZ  q  j'?'„X  j  ¦ `„ [€ ƒ G‡@Z<]"}Z'?ƒxZ‡} }}D_!'!$'''Dx ]   ~ $  $$ q Œ  q… ƒ ‡ N '” }  Wolbachia endosymbiont of Culex quinq- uefasciatus JHB. Journal of Bacteriology, 191(5), 1725. https://doi. org/10.1128/JB.01731-08 ?! šN ` ƒ #‡x'„<'' ''!<x}''< Molecular and Cellular Biochemistry, 256–257(1–2), 319–327. https:// !]E  E\"+[\D =%=    ~ ' _ƒ *‡j!<?†}_Dx[„!- ti- H. pylori egg yolk immunoglobulin Y in Candida yeast for detection of intracellular H. pylori. Frontiers in Microbiology, 6, 113.  Ž q'  x'  ` + q' x x†   ¦@ …ƒ ‡$}?'!<- lium of the fungus Mortierella elongata. Microbes and Environments, 25ƒ#‡  • #?'"EE!]E  G#E€' +j #    > ƒ *‡ > ]  ? ??"  ! ' } '?< ?Z D Nature Reviews Molecular Cell Biology, 16(6), 375–388. https://doi.org/10.1038/nrm3997 ]]  … ƒ ‡ '?<  '??Z' } - dria and bacteria. Biochimica et Biophysica Acta, 1555(1–3), 154–159. https://doi.org/10.1016/S0005-2728(02)00271-2 † > x' … … š @' šŒ + +ƒ G‡D„ ]!]'}'''?}?'! proteomes. Nature Protocols, 1(6), 2856–2860.  + N!< > _ >+ƒ =‡[}'”' j]ˆ'!In Vitro Cellular & Developmental Biology – Animal, 34(8), 629–630. https://doi.org/10.1007/s11626-996-0010-1  ‰   Œ š+ ƒ %‡<? ]- neered yeast populations. Proceedings of the National Academy of Sciences of the United States of America, 104(6), 1877–1882. https:// doi.org/10.1073/pnas.0610575104 Siggers, K. A., & Lesser, C. F. (2008). The yeast Saccharomyces cerevisiae: > ' ! '<' }  !} ! - tion of bacterial virulence proteins. Cell Host & Microbe, 4(1), 8–15. https://doi.org/10.1016/j.chom.2008.06.004  >j ˜] ˜ x' [ +Z j +!!] > P. (2000). The mechanical properties of Saccharomyces cerevisiae. Proceedings of the National Academy of Sciences of the United States of America, 97(18), 9871–9874.  [ \]' D [?  N! @ƒ ‡D'•?- fusion: A look from yeast mitochondria. Current Medicinal Chemistry, 18(23), 3476–3484. https://doi.org/10.2174/092986711796642553   j š ƒ ‡ N]   Journal of Bacteriology, 194(16), 4151–4160. https://doi.org/10.1128/ JB.00345-12 £] ` '  …} > ~} +ƒ ‡+! ]' } „!?! '?<  ?Z'  ?„ regulated after depletion of Wolbachia from filarial nematodes. International Journal for Parasitology, 40(10), 1193–1202. https://doi. org/10.1016/j.ijpara.2010.03.004  ›Ž ˜ Ž   š \ ˜ _ …] ‰$ ˜ š[ (2015). Copper tolerance and biosorption of Saccharomyces cerevisiae during alcoholic fermentation. PLoS ONE, 10(6), e0128611. https:// doi.org/10.1371/journal.pone.0128611 x + @' q [ \   D> ƒ %=‡@?- ''}Z<]} Archives of Biochemistry and Biophysics, 191(1), 8–22. https://doi. org/10.1016/0003-9861(78)90062-0 Taylor, M. J., & Hoerauf, A. (1999). Wolbachia bacteria of filarial nema- todes. Parasitology Today, 15(11), 437–442. https://doi.org/10.1016/ S0169-4758(99)01533-1 | URIBE- ALVAREZ ET AL. ` >  š@ ~  >qƒ =*‡j}}'}„? on yeast membrane functions. Journal of Bacteriology, 161(3), 1195–1200. `  ] ~> j'?^ N >] N>ƒ  ‡j}}'} <Z  !'' <'Saccharomyces cer- evisiae and on isolated yeast mitochondria. Applied and Environment Microbiology, 56(7), 2114–2119. `„> [ [”„_QZ q ['„˜ + N„ Castillo, S., Peña, A., & Uribe-Carvajal, S. (2016). Staphylococcus epi- dermidis: Metabolic adaptation and biofilm formation in response  !}} Z<] ' Pathogens and Disease, 74(1), ftv111. https://doi.org/10.1093/femspd/ftv111 Werren, J. H. (1997). Biology of Wolbachia. Annual Review of Entomology, 42, 587–609. https://doi.org/10.1146/annurev.ento.42.1.587 ‰  š …  \!     [†  + j ƒ =‡ Wolbachia: Master ma- nipulators of invertebrate biology. Nature Reviews Microbiology, 6(10), 741–751. https://doi.org/10.1038/nrmicro1969 ‰†  … …   x  š ƒ ==‡ †' ?† !  ' cell: entry, growth and control of the parasite. Current Topics in Microbiology and Immunology, 138, 81–107. ‰] D \ …~ ª]] …ƒ G‡\~>NjNature Protocols, 1(1), 418–428. https://doi.org/10.1038/nprot.2006.62 ‰] D ' + ª]] …ƒ %‡…]' electrophoresis for in- gel funtional assays and fluorescence studies of ??Z'Molecular & Cellular Proteomics: MCP, 6(7), 1215–1225. https://doi.org/10.1074/mcp.M700076-MCP200 ‰ \ q š _' š Œ'  [<  D] š ¦†  B. (2009). The heme biosynthetic pathway of the obligate Wolbachia endosymbiont of Brugia malayi as a potential anti- filarial drug target. PLoS Neglected Tropical Diseases, 3(7), e475. https://doi.org/10.1371/ journal.pntd.0000475 ‰ +  Œ Œ š ] + $<  \ š[  ¦‰]! [ ƒ #‡~<]'}?!?' Wolbachia pipientis wMel: A streamlined genome overrun by mobile genetic elements. PLoS Biology, 2ƒ‡  jG ?'"EE!]E  % E journal.pbio.0020069 ›  ˜    [ [   $'    ƒ G‡ D'?} '} } Wolbachia into the mosquito disease vector Aedes albopictus. Proceedings. Biological sciences Royal Society, 273(1592), 1317–1322. https://doi.org/10.1098/rspb.2005.3405 5 00%# Additional supporting information may be found online in the ??]D}'!} *$B$&    &U`„>[ [”„_QZq  +'„N^ Wolbachia pipientis grows in Saccharomyces cerevisiae evoking early death of the host and deregulation of mitochondrial metabolism. MicrobiologyOpen. 2018;e675. https://doi.org/10.1002/mbo3.675 molecules Article Response of Ustilago maydis against the Stress Caused by Three Polycationic Chitin Derivatives Dario Rafael Olicón-Hernández 1, Cristina Uribe-Alvarez 2, Salvador Uribe-Carvajal 2, Juan Pablo Pardo 3 and Guadalupe Guerra-Sánchez 1,* 1 Instituto Politécnico Nacional, Escuela Nacional de Ciencias Biológicas, Departamento de Microbiología, Prolongación de Carpio y Plan de Ayala S/N, Col. Sto. Tomas, Del, Miguel Hidalgo, CP 11340 Ciudad de México, Mexico; magnadroh@hotmail.com 2 Universidad Nacional Autónoma de México, Instituto de Fisiología Celular, Circuito exterior S/N, Ciudad Universitaria, CP 04510 Ciudad de México, Mexico; curibe@email.ifc.unam.mx (C.U.-A.); suribe@ifc.unam.mx (S.U.-C.) 3 Universidad Nacional Autónoma de México, Facultad de Medicina, Departamento de Bioquímica, Circuito exterior S/N, Ciudad Universitaria, CP 04510 Ciudad de México, Mexico; pardov@bq.unam.mx * Correspondence: lupegs@hotmail.com; Tel.: +52-55-5729-6000 (ext. 62339) Received: 10 August 2017; Accepted: 13 October 2017; Published: 7 December 2017 Abstract: Chitosan is a stressing molecule that affects the cells walls and plasma membrane of fungi. For chitosan derivatives, the action mode is not clear. In this work, we used the yeast Ustilago maydis to study the effects of these molecules on the plasma membrane, focusing on physiologic and stress responses to chitosan (CH), oligochitosan (OCH), and glycol-chitosan (GCH). Yeasts were cultured with each of these molecules at 1 mg·mL−1 in minimal medium. To compare plasma membrane damage, cells were cultivated in isosmolar medium. Membrane potential (∆ψ) as well as oxidative stress were measured. Changes in the total plasma membrane phospholipid and protein profiles were analyzed using standard methods, and fluorescence-stained mitochondria were observed. High osmolarity did not protect against CH inhibition and neither affected membrane potential. The OCH did produce higher oxidative stress. The effects of these molecules were evidenced by modifications in the plasma membrane protein profile. Also, mitochondrial damage was evident for CH and OCH, while GCH resulted in thicker cells with fewer mitochondria and higher glycogen accumulation. Keywords: chitosan; oligochitosan; glycol-chitosan; Ustilago maydis; stress response 1. Introduction Ecological niches for fungi are numerous and varied. In nature, fungi can be found as saprophytic agents, as pathogenic or phytopathogenic parasites, as communities (mycorrhiza), or as symbionts [1]. Thus, fungi are exposed to different environmental stress conditions such as variations in pH, temperature, osmolarity, toxins, and natural or synthetic compounds that could damage their structure or disrupt their metabolism and yet, they survive [2]. Stress in fungi may be an external biotic or abiotic condition that interferes with optimal growth parameters and generates physiological responses [3]. These defense responses may involve overexpression of genes related to carbohydrate metabolism [4], the production of structural proteins [5], modifications in cell wall or membrane composition [6,7], changes in cell integrity [4], and the production of reactive oxygen species (ROS) [8]. One of the advantages of studying stress responses in fungi is that they are excellent models of eukaryotic responses against external or internal factors which could also be observed in plants and animals; indeed, very conserved defense mechanisms exist [9]. Molecules 2017, 22, 1745; doi:10.3390/molecules22121745 www.mdpi.com/journal/molecules Molecules 2017, 22, 1745 2 of 11 Chitosan (CH) elicits a strong stress response in fungi. It is a polycationic semi-natural carbohydrate with an average molecular weight of 50 kDa, constituted by the aminated sugars glucosamine (<90%) and N-acetyl glucosamine (>10%) [10]. The main source of chitosan is their extraction from chitin from insects and crustaceans; however, it also is an important constituent of green algae, yeasts, protozoa, as well as the cell walls of some fungi and used in the fabrication of environmentally friendly antimicrobial agents [11]. In this context, it was reported that CH and its derivatives are able to inhibit bacteria, fungi, and viruses that can generate diseases from the clinical and environmental point of view, mainly by boosting the immune systems of humans, animals, and plants, interfering with the normal metabolism of the pathogens, destroying cellular structures [12–14]. In acidic pH, the CH amino groups are protonated and thus, CH is polycationic. It is used to produce different antimicrobial agents [15], such as oligochitosan (OCH) and glycol-chitosan (GCH), also polycationic in nature, which are applied in different industries and research activities. The OCH (MW around 5 kDa) is smaller than chitosan [16], while GCH is produced by etherification of chitosan and ethylene glycol and is used in bio-gel fabrication [12]. In contrast to CH, which is soluble only at an acid pH, both OCH and GCH are soluble at pH 7.0. The polycationic nature of these compounds allows strong interactions with different fungal structures such as the cell wall, membrane lipids, proteins, and nucleic acids, probably triggering a stress response [17]. In eukaryotic cells, chitosan and its derivatives promote morphological mechanical alterations [15], increased ROS concentration [18,19], mitochondrial dysfunction [20], decreased metabolic processes [21], decreased septation, increased spore mitoses [22], and overexpression of genes related to oxidative stress [23]. Fungi react to these polycations through proteins involved in plasma membranes, respiration, ATP production, and mitochondrial organization. In Neurospora crassa, the generation of reactive oxygen species, cellular energy, and cellular membrane homeostasis was affected by chitosan [21]. Ustilago maydis is a basidiomycete and an ustilaginal fungus used as a model species in several biochemical and physiological studies. Due to its accessible genome, easy handling, ability to grow in defined media by budding and formation of compact colonies on plates, U. maydis is considered an ideal fungal model for cell and molecular biology studies [24]. We have previously described the effects of CH, OCH, and GCH on the development and morphology of Ustilago maydis [15]. Here, we characterize the response of U. maydis to each of these polycationic compounds and conclude that each chitosan derivative triggers a specific stress-like response in U. maydis. 2. Results 2.1. Growth of U. maydis at Different Osmolarities: Effects of CH, OCH, and GCH In hypo-osmotic medium, CH inhibits the growth of U. maydis, while OCH and GCH have no effects [15]. Here, when culturing the cells in an isosmotic medium, the same inhibition pattern was observed (Figure 1), i.e., OCH and GCH did not exhibit any effect, while CH fully inhibited U. maydis growth. 2.2. Cell Membrane Permeability Changes in U. maydis upon Addition of CH, OCH or GCH Since osmotic support to U. maydis did not prevent the chitosan effect, it was decided to determine whether the plasmatic membrane was intact. For this, the transmembrane electrical potential (∆ψ) in the cell was estimated using a cyanine derivative [25]; 2 µg·mL−1 of chitosan decreased ∆ψ by more than 50%. Higher concentrations further decreased ∆ψ (Figure 2I). The presence of different polycation compounds (OCH) and (GCH) did not produce changes in this physiological parameter (Figure 2II,III). Molecules 2017, 22, 1745 3 of 11 Figure 1. Growth of Ustilago maydis in minimal medium and in the presence of chitosan, oligochitosan or glycol-chitosan. Each agent was added to a final concentration of 1 mg·mL−1. Growth was measured as an increase in optical density at 600 nm. Figure 2. Changes in ∆ψ in response to different concentrations of CH, OCH or CGH. All concentrations are expressed in µg·mL−1. The numbers correspond to each antifungal tested, (I) CH; (II) OCH; (III) GCH. Additions were: A = cells; B = Antifungal. U. maydis, 25 mg wet weight. 2.3. Determination of ROS Released by U. maydis as a Response to CH, OCH or GCH The production/presence of ROS was measured directly (Amplex Red® method) and indirectly (catalase activity) after treatment with the different polycation compounds. During growth, the control cells produced 3.13 nmol H2O2 min−1 mg wet weight−1, and the catalase-specific activity was 1.87 U mg protein−1, indicating that some hydrogen peroxide is formed under the physiological conditions and normal growth. Cells treated with chitosan produced considerably less ROS (0.11 nmol H2O2 min−1 mg of cell wet weight−1) and showed a catalase activity of 0.56 U mg of protein−1. This is associated with immediate and total CH-mediated cell destruction [15]. The OCH treatment produced a statistically significant increase in ROS (16.6 nmol H2O2 min−1 mg of cell wet weight−1 and catalase activity of 7.97 U mg of protein−1), which means that it produced a greater amount of ROS compared to the other treatments. Cells grown in GCH did not show any differences in terms of ROS production (5.75 nmol H2O2 min−1 mg of cell wet weight−1 and 2.19 U mg of protein−1) compared to the control cells; this was corroborated by the results of Tukey´s test (Figure 3). Molecules 2017, 22, 1745 4 of 11 Figure 3. Quantification of ROS production by Ustilago maydis grown in the presence of CH, OCH or GCH. H2O2 production as measured with Amplex red® () and catalase activity (). Cells were incubated in minimal medium for 24 h at 128 rpm and the indicated antifungal agent was added at 1 mg·mL−1. Significance was evaluated by one-way ANOVA analysis and Tukey test (p < 0.05). The experiments were performed in triplicate (n = 3). * and ** indicate significant difference in H2O2 production and catalase activity, respectively, compared to control cells. 2.4. CH-, OCH-, or GCH-Mediated Damage of the Mitochondrial Structure in U. maydis Damages in the mitochondrial structure were observed by the use of Mitotracker green® (Invitrogen/Thermo Fisher Scientific, Waltham, MA, USA) via fluorescence microscopy. In all cases, background fluorescence was observed, but specific regions were stained with greater intensity when mitochondria were present, especially in the control cells (Figure 4A2). The mitochondrial staining of cells with CH and OCH (Figure 4B2,C2) showed irregular fluorescence distribution, suggesting high damage. Cells incubated in the presence of GCH exhibited a lower fluorescence intensity than the control cells (Figure 4D2), suggesting mitochondria loss. Figure 4. Phase contrast (1) and fluorescence (2) microscopy of U. maydis stained with MitoTracker® Green FM. An Eclipse E800 fluorescent microscope (Nikon Instruments Inc., Melville, NY, USA) with a fluorescein filter was used. The cells were growth in MM with the different treatment in a concentration of 1 mg mL−1. The intensity of the signal is according with the presence of the mitochondrial proteins. A = Control; B = Chitosan; C = Oligochitosan; D = Glycol-chitosan. Time of incubation of 24 h. Molecules 2017, 22, 1745 5 of 11 2.5. Chitin Derivatives Modify Total Phospholipid Contents As shown in Table 1, the phospholipid contents of the membrane fraction of yeast grown in the presence of chitin derivates were statistically decreased. The greatest decrease (44.72%) was induced by oligochitosan, followed by glycol-chitosan with an approximated decrease by 17.78% compared to the control. There was no data for chitosan, due to its inhibitory effect on yeast growth. Table 1. Total phospholipid concentration (mM phospholipids g of cells−1) in the membrane fraction of U. maydis growth under antifungal treatments. Antifungal Tested (1mg·mL−1) Total Phospholipid Concentration (mM Phospholipids g of Cells−1 Wet Weight) Control 4.54 ± 0.035 a Chitosan ND Oligochitosan 2.51 ± 0.12 b Glycol-chitosan 3.76 ± 0.043 c ND = Not determined. Different letters (a, b and c) indicate significant difference in one-way ANOVA evaluated by Tukey test (p < 0.05). The experiments were performed in triplicate (n = 3). 2.6. SDS-PAGE Analysis of U. maydis Membrane Proteins in the Absence and Presence of CH, OCH or GCH The SDS-PAGE analysis (Figure 5) was performed to observe the modification in the protein profile caused by the addition of chitin derivatives. In CH-treated cells, the decrease in the intensity of a band near 100 kDa, suggested as the electrophoretic mark of the plasma membrane H ± ATPase (band A) [26], was observed. The samples treated with OCH exhibited the largest changes, presenting a more intense protein band at approximately 90 kDa (band C), 57 kDa (Band D), and 14 kDa (band E). The A band was not neatly distinguished as observed in the control cells. Cells grown in glycol–chitosan showed a well-delimited band A, with greater banding intensity in a protein of near 83 kDa (Band G). Figure 5. SDS-PAGE of the membrane fraction of U. maydis after the different antifungal treatments. Oligochitosan and glycol–chitosan were added at 1 mg·mL−1. Chitosan was added at 10 µg·mL−1 due to the effect on cell growth. MW= Molecular weight marker (KDa); 1 = Control cell without antifungals; 2 = Cells treated with chitosan; 3 = Cells treated with oligochitosan; 4 = Cells treated with glycol–chitosan. Squares indicate differences in the bands pattern. Molecules 2017, 22, 1745 6 of 11 2.7. Effects of CH, OCH or GCH on the Accumulation of Glycogen by U. maydis In response to stress, bacteria and yeasts accumulate glycogen. The cells cultured in the presence of GCH accumulated glycogen as compared to the control (Figure 6A). No glycogen was detected by PAS staining of cells with CH and OCH (data not shown). Interestingly, cells with GCH showed an increased size compared to the control (Figure 6B). This abnormal glycogen accumulation suggests that metabolic changes may be activated to use the GCH as fuel storage, which induces cell thickening. Figure 6. PAS staining of U. maydis in the presence of GCH. A 1 mg·mL−1 of each antifungal compound was added. The positive schiff reaction was demonstrated by the presence of the purple compound derivate of the interaction between the basic fuchsin with aldehydes sugars. (A) = Control; (B) = Glycol-chitosan (100×). 3. Discussion Adverse external conditions trigger the stress defense response that comprises diverse metabolic modifications needed for survival [27]. In U. maydis, different chitin derivatives prompted different responses. As our results show, high osmolarity did not modify the effects of the different derivatives tested, indicating that the findings observed for the fungus do not solely result from osmotic stress [15]. This observation stands in contrast to the evidence reported by Zakrzewska et al. [28], who observed that 1M sorbitol protected Saccharomyces cerevisiae cells against chitosan. The authors state that the high-osmolarity glycerol pathway is crucial to establish fungal sensibility to chitosan. In this regard, U. maydis does exhibit important differences in the activation and control of this pathway, which would explain its sensitivity to chitosan, even in an isosmolar environment [28,29]. As reported before, chitosan promotes has a complete inhibitory effect on Ustilago maydis as a consequence of the interaction between specific sites in the plasma membrane and protonated free amino groups, constituting the main change of the polymer [15]. The modifications in cell permeability explain the depletion of the membrane potential and are consistent with observations in Rhizopus stolonifer at a chitosan concentration of 2000 µg·mL−1 [15,30]. However, in a non-susceptible model, such as Candida albicans, the effect of chitosan on the plasma membrane is completely the opposite: Peña et al. [31] described hyperpolarization of the cell membrane of C. albicans due to an alignment of internal charges with a subsequent increase in potential membrane when the yeast was in the presence of low chitosan concentrations [31]. Thus, it is evident that the effects of chitosan vary depending on the model [32]. In this study, OCH and GCH did not affect the plasma membrane potential. There is evidence of an enhancement of oxygen consumption in R stolonifer, C. albicans, and U. maydis by chitosan and oligochitosan [15,31,33]. This modification of the rate of oxygen consumption could be due to an increased use of ATP, involved in energy-depended defense against these polymers, or to the generation of reactive oxygen species [31]. Oxidative stress in the presence of OCH has previously been described in macrophages, plant cells, and fungi [16,18,34]. In the last case, it was proposed that chitin derivatives inhibited proteins involved in the generation of reducing power for the neutralization of intracellular ROS, such as glutathione S-transferase-4 [34]. Our results do not indicate whether the formation of ROS is part of the oligochitosan antifungal effect or simply a response to Molecules 2017, 22, 1745 7 of 11 the stress generated by these molecules. On the other hand, the addition of CH and OCH seems to disorganize the mitochondrial structure without affecting its function. In contrast, in U. maydis, GCH does affect mitochondrial function. Previously, we described the reduction in the oxygen consumption rate in U. maydis in the presence of GCH [15]. In the present work, we corroborated the affectation of the mitochondria by GCH; this result is consistent with the decrease in respiration in U. maydis by the addition of glycol-chitosan, which has been described previously [15]. We believe this is the first report on the mitochondrial effects of GCH. In the presence of chitin derivatives, the responses of U. maydis, modifying its lipid, protein, and carbohydrate composition, are part of a global survival mechanism. The OCH modified the total phospholipids and, to a lesser extent, so did GCH. Additionally, the protein profile was modified by the presence of each of the compounds used. The stressors may interact with the plasma membrane and produce different signals that up-regulate different membrane proteins. The modification of the protein concentration and protein functionality during CH stress has been described for R. stolonifer, where the amount of membrane proteins decreases to about 50%, as well as the activity of H + ATPase [35]. Under several stress conditions, fungi are able to modify the composition of their cell membrane, accumulate glycogen as a secondary energy source, and express, overexpress, and/or repress several genes for kinases, enzymes, transcriptional factors, detoxification systems, and mediators of apoptosis [36–41]. In fungi, chitin derivatives increased proteins for ergosterol synthesis, actin cytoskeleton organization, protein N-glycosylation, endocytosis, cell wall formation, and carbohydrate metabolism [28]. Previously, it has been demonstrated that chitosan produces a fungal stress response, involving a large number of genes mediated by the action of common stress transcription factors in yeast, such as Msn2p and Msn4p [42]. It is therefore possible that in U. maydis, the same factors are involved in the stress response to CH, OCH, and GCH. Our results demonstrated that chitosan and its derivatives produce stress responses in U. maydis; these responses are significantly different depending on the characteristics of the molecule. Further experiments are necessary to establish the mode of action of these polycationic compounds and the stress response they elicit in fungi. 4. Materials and Methods 4.1. Reagents and Solutions Low molecular weight chitosan (deacetylation degree (DD) ≥ 85%, MW 50–190 kDa), oligochitosan (chitosan oligosaccharide lactate, DD > 90%, average MW 5 kDa), and glycol chitosan (DD ≥ 60%, average MW 250 kDa) were purchased from Sigma-Aldrich (St. Louis, MO, USA). The stock solutions of CH, OCH, and GCH were prepared according to our previously published protocol [15]. All chemical compounds and solvents were analytical grade. 4.2. Growth in Isosmolar Medium Ustilago maydis ATCC 201384 FB2 was grown in minimal medium (1% glucose, 0.3% potassium nitrate, and salt solution, pH 5.6), individually or in the presence of 1 mg CH, OCH, or GCH per mL. To establish an isosmolar environment, 400 mM sorbitol was added. This isosmolar medium was prepared considering the intracellular potassium concentration and its counter anions of the model yeast Saccharomyces cerevisiae [43]. Cells were cultured at 28 ◦C under agitation at 130 rpm for 48 h. Growth was measured by the changes in optical density at 600 nm. 4.3. Transmembrane Potential Yeasts of U. maydis were cultured in YPD (1% yeast extract, 0.15% ammonium nitrate, 0.25% bacto peptone, 1% glucose, pH 6.8) for 24 h under the condition previously described [15]. Biomass was centrifuged at 3000× g for 10 min and diluted to 50% (w/v) with distilled water; 10-µL samples were used. The membrane potential was estimated by following the changes in fluorescence of a 0.25 mM Molecules 2017, 22, 1745 8 of 11 cyanine solution at 540–590 nm, according to the protocol previously described by Peña et al. [25]. Increasing concentrations of each chitosan derivative (from 2 to 100 µg·µL−1) were added after 50 s and the effects on the transmembrane potential were monitored. 4.4. H2O2 Production Measured by the Amplex Red® Method Cells were cultured (24 h/130 rpm/28 ◦C) in minimal media and with or without 1 mg polycation mL−1. The cells were collected by centrifugation and a 50% (w/v) cell suspension was prepared with sterilized water. Subsequently, 20-µL aliquots were placed into an ELISA 100-well plate with 50 µL of reaction mixture (0.1 units mL−1 horseradish peroxidase, 100 units mL−1 superoxide dismutase, 10 µM Amplex red® (Thermo Fisher Scientific, Waltham, MA, USA), 0.6 M mannitol, and 5 mM MES) and the volume was adjusted to 100 µL. The mixture was incubated at room temperature for 5 min. The formation of the fluorescence derivative (resorufin) as a consequence of the release of H2O2 was measured in a PolarStar OMEGA detector (571–585 nm), using the OMEGA control software (Ortenberg, Germany); the results were interpolated against a calibration curve [44]. The data are reported as nmol of H2O2 per min per mg wet weight of cells. 4.5. Catalase Activity We also used U. maydis to measure catalase in cells grown in the absence or presence of each chitosan derivative. Cells were collected by centrifugation and mechanically disrupted in 0.1 M phosphate buffer (pH 7), using 0.5 mm glass beads. Subsequently, 100 µL of the supernatant were taken and added to 1.5 mL phosphate buffer. After this, 1 mL of 5 mM hydrogen peroxide was added and catalase activity was measured by the decrease in absorbance at 240 nm after 10 min. Protein was quantified by the Lowry method [45]. The specific activity of catalase is reported as units per mg protein. One unit is defined as the amount of enzyme necessary to reduce the absorbance at a rate of 0.1 units per mL per minute [46]. 4.6. Mitochondrial Staining Ustilago maydis was grown in minimal medium supplemented with 1 mg·mL−1 of each compound for 24 h, under the conditions described before. Cell suspension aliquots of 1 mL were incubated in the presence of 25 nM Mitotracker green® (Invitrogen/Thermo Fisher Scientific, Waltham, MA, USA) for 30 min at 37 ◦C. Untreated cells were used as control. Fluorescent mitochondria were observed in phase contrast microscopy with a fluorescein filter (494–520 nm) [47]. 4.7. Total Phospholipid Quantification The membrane fraction of U. maydis grown in the presence of each compound at a concentration of 1 mg·mL−1 for 24 hours at 28 ◦C was obtained by fractional centrifugation, as described in our previous publication [15]. For the quantification of total phospholipids, a commercial kit was used (Spinreact, Spain). Phospholipid concentration was determined by comparing the absorbance against a standard containing 300 mg·dL−1 of total phospholipids. The results were expressed in mM phospholipids g of cells−1 (wet weight). 4.8. SDS-PAGE of the Membrane Fraction Cells were incubated for 24 h on a shaker in the presence of each compound at 1 mg·mL−1, with the exception of CH, which was added at 10 µg·mL−1. The membrane fraction was obtained and the Lowry method was used to determine the protein concentration. Samples with ≈30 µg of protein were mixed with 4× loading buffer (0.5 M Tris pH 6.8; 10% SDS; 15% β-mercaptoethanol, 25% glycerol, and 0.1 mg·mL−1 bromophenol blue) and analyzed on 10% SDS-PAGE; staining and de-staining were performed with Coomassie Blue and acetic acid–methanol–water (1:2:10) solution, respectively. Molecules 2017, 22, 1745 9 of 11 4.9. Glycogen Accumulation and PAS Staining Ustilago maydis was fixed with 0.6% periodic acid solution for 10 min at room temperature. The sample was washed with distilled water and mixed with Schiff's reagent (leucobasic fuchsin) for 30 min. Subsequently, the samples were washed three times with 10% sodium metabisulfite-1 N HCl for 1 min. Samples were rinsed with an ethanol-xylene mixture, mounted on a slide with synthetic resin, and observed in an optical microscope, denoting a purple color in the case of glycogen presence. Acknowledgments: Special thanks to Escuela Nacional de Ciencias Biológicas of Instituto Politécnico Nacional; Facultad de medicina and Instituto de Fisiología Celular of Universidad Nacional Autónoma de México for the support for carrying out this work. This research received financial support from CONACyT projects No. 256520 and 254904; DGAPA-PAPIIT project IN222117 and IPN-SIP-ENCB projects No. 20141521, No. 20160999 and No. 20170864. The first author was recipient of a Ph.D. fellowship provided by CONACyT (No. 231581). For the publication as an open access article, this research had financial support by CONACyT project No. 256520 and 254904; grants CONACyT 239587 and DGAPA-PAPIIT IN204015 to SUC. Author Contributions: D.R.O.-H. and G.G.-S. conceived and designed the experiments; J.P.P. designed isosmolar media experiments; D.R.O.-H. performed the experiments; C.U.-A. and S.U.-C. performed ROS quantification; S.U.-C. and C.U.-A. contributed reagents and analysis tools; D.R.O.-H. and G.G.-S. wrote the paper; J.P.P. and S.U.-C. reviewed and corrected the document. Conflicts of Interest: The authors declare no conflict of interest. The founding sponsors had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript, and in the decision to publish the results. References 1. Martin, F.; Cullen, D.; Hibbett, D.; Pisabarro, A.; Spatafora, J.W.; Baker, S.E.; Grigoriev, I.V. Sequencing the fungal tree of life. New Phytol. 2011, 190, 818–821. [CrossRef] [PubMed] 2. Lackner, D.H.; Schmidt, M.W.; Wu, S.; Wolf, D.A.; Bähler, J. Regulation of transcriptome, translation, and proteome in response to environmental stress in fission yeast. Genome Biol. 2012, 13, R25. [CrossRef] [PubMed] 3. Ortiz-Urquiza, A.; Keyhani, N.O. Stress response signaling and virulence: Insights from entomopathogenic fungi. Curr. Genet. 2015, 61, 239–249. [CrossRef] [PubMed] 4. Gasch, A.P. Comparative genomics of the environmental stress response in ascomycete fungi. Yeast 2007, 24, 961–976. [CrossRef] [PubMed] 5. Tesei, D.; Marzban, G.; Zakharova, K.; Isola, D.; Selbmann, L.; Sterflinger, K. Alteration of protein patterns in black rock inhabiting fungi as a response to different temperatures. Fungal Biol. 2012, 116, 932–940. [CrossRef] [PubMed] 6. Francois, J.M.; Formosa, C.; Schiavone, M.; Pillet, F.; Martin-Yken, H.; Dague, E. Use of atomic force microscopy (afm) to explore cell wall properties and response to stress in the yeast saccharomyces cerevisiae. Curr. Genet. 2013, 59, 187–196. [CrossRef] [PubMed] 7. Gunde-Cimerman, N.; Plemenitaš, A.; Buzzini, P. Changes in lipids composition and fluidity of yeast plasma membrane as response to cold. In Cold-Adapted Yeasts: Biodiversity, Adaptation Strategies and Biotechnological Significance; Buzzini, P., Margesin, R., Eds.; Springer: Berlin/Heidelberg, Germany, 2014; pp. 225–242. 8. Lushchak, V.I. Adaptive response to oxidative stress: Bacteria, fungi, plants and animals. Comp. Biochem. Physiol. Part C Toxicol. Pharmacol. 2011, 153, 175–190. [CrossRef] [PubMed] 9. Hernández-Oñate, M.A.; Herrera-Estrella, A. Damage response involves mechanisms conserved across plants, animals and fungi. Curr. Genet. 2015, 61, 359–372. 10. Dash, M.; Chiellini, F.; Ottenbrite, R.M.; Chiellini, E. Chitosan—A versatile semi-synthetic polymer in biomedical applications. Prog. Polym. Sci. 2011, 36, 981–1014. [CrossRef] 11. Bautista-Baños, S.; Hernández-Lauzardo, A.N.; Velázquez-del Valle, M.G.; Hernández-López, M.; Ait Barka, E.; Bosquez-Molina, E.; Wilson, C.L. Chitosan as a potential natural compound to control pre and postharvest diseases of horticultural commodities. Crop Prot. 2006, 25, 108–118. 12. Vinsova, J.; Vavrikova, E. Chitosan derivatives with antimicrobial, antitumour and antioxidant activities—A review. Curr. Pharma. Des. 2011, 17, 3596–3607. [CrossRef] Molecules 2017, 22, 1745 10 of 11 13. Benhabiles, M.S.; Salah, R.; Lounici, H.; Drouiche, N.; Goosen, M.F.A.; Mameri, N. Antibacterial activity of chitin, chitosan and its oligomers prepared from shrimp shell waste. Food Hydrocoll. 2012, 29, 48–56. [CrossRef] 14. Raafat, D.; Sahl, H.-G. Chitosan and its antimicrobial potential—A critical literature survey. Microb. Biotechnol. 2009, 2, 186–201. [CrossRef] [PubMed] 15. Olicón-Hernández, D.R.; Hernández-Lauzardo, A.N.; Pardo, J.P.; Peña, A.; Velázquez-del Valle, M.G.; Guerra-Sánchez, G. Influence of chitosan and its derivatives on cell development and physiology of Ustilago maydis. Int. J. Biol. Macromol. 2015, 79, 654–660. 16. Ma, Z.; Yang, L.; Yan, H.; Kennedy, J.F.; Meng, X. Chitosan and oligochitosan enhance the resistance of peach fruit to brown rot. Carbohydr. Polym. 2013, 94, 272–277. [CrossRef] [PubMed] 17. Gupta, K.; Dey, A.; Gupta, B. Plant polyamines in abiotic stress responses. Acta Physiol. Plant. 2013, 35, 2015–2036. [CrossRef] 18. Liu, L.; Zhou, Y.; Zhao, X.; Wang, H.; Wang, L.; Yuan, G.; Asim, M.; Wang, W.; Zeng, L.; Liu, X.; et al. Oligochitosan stimulated phagocytic activity of macrophages from blunt snout bream (megalobrama amblycephala) associated with respiratory burst coupled with nitric oxide production. Dev. Comp. Immunol. 2014, 47, 17–24. [CrossRef] [PubMed] 19. Xu, J.; Zhao, X.; Wang, X.; Zhao, Z.; Du, Y. Oligochitosan inhibits phytophthora capsici by penetrating the cell membrane and putative binding to intracellular targets. Pestic. Biochem. Physiol. 2007, 88, 167–175. [CrossRef] 20. Lopez-Moya, F.; Colom-Valiente, M.F.; Martinez-Peinado, P.; Martinez-Lopez, J.E.; Puelles, E.; Sempere-Ortells, J.M.; Lopez-Llorca, L.V. Carbon and nitrogen limitation increase chitosan antifungal activity in neurospora crassa and fungal human pathogens. Fungal Biol. 2015, 119, 154–169. [CrossRef] [PubMed] 21. Martinez, L.R.; Mihu, M.R.; Tar, M.; Cordero, R.J.B.; Han, G.; Friedman, A.J.; Friedman, J.M.; Nosanchuk, J.D. Demonstration of antibiofilm and antifungal efficacy of chitosan against candidal biofilms, using an in vivo central venous catheter model. J. Infect. Dis. 2010, 201, 1436–1440. [CrossRef] [PubMed] 22. Cota-Arriola, O.; Cortez-Rocha, M.O.; Rosas-Burgos, E.C.; Burgos-Hernández, A.; López-Franco, Y.L.; Plascencia-Jatomea, M. Antifungal effect of chitosan on the growth of aspergillus parasiticus and production of aflatoxin b1. Polym. Int. 2011, 60, 937–944. [CrossRef] 23. Xing, K.; Zhu, X.; Peng, X.; Qin, S. Chitosan antimicrobial and eliciting properties for pest control in agriculture: A review. Agron. Sustain. Dev. 2015, 35, 569–588. [CrossRef] 24. Dean, R.; Van Kan, J.A.L.; Pretorius, Z.A.; Hammond-Kosack, K.E.; Di Pietro, A.; Spanu, P.D.; Rudd, J.J.; Dickman, M.; Kahmann, R.; Ellis, J.; et al. The top 10 fungal pathogens in molecular plant pathology. Mol. Plant Pathol. 2012, 13, 414–430. [CrossRef] [PubMed] 25. Peña, A.; Uribe, S.; Pardo, J.P.; Borbolla, M. The use of a cyanine dye in measuring membrane potential in yeast. Arch. Biochem. Biophys. 1984, 231, 217–225. 26. Hernández, A.; Cooke, D.T.; Clarkson, D.T. In vivo activation of plasma membrane h+-atpase hydrolytic activity by complex lipid-bound unsaturated fatty acids in Ustilago maydis. Eur. J. Biochem. 2002, 269, 1006–1011. 27. Shor, E.; Perlin, D.S. Coping with stress and the emergence of multidrug resistance in fungi. PLoS Pathog. 2015, 11, e1004668. [CrossRef] [PubMed] 28. Zakrzewska, A.; Boorsma, A.; Delneri, D.; Brul, S.; Oliver, S.G.; Klis, F.M. Cellular processes and pathways that protect saccharomyces cerevisiae cells against the plasma membrane-perturbing compound chitosan. Eukaryot. Cell. 2007, 6, 600–608. [CrossRef] [PubMed] 29. Krantz, M.; Becit, E.; Hohmann, S. Comparative genomics of the hog-signalling system in fungi. Curr. Genet. 2006, 49, 137–151. [CrossRef] [PubMed] 30. Hernández-Lauzardo, A.N.; Vega-Pérez, J.; Velázquez-del Valle, M.G.; Sánchez, N.S.; Peña, A.; Guerra-Sánchez, G. Changes in the functionality of plasma membrane of rhizopus stolonifer by addition of chitosan. J. Phytopathol. 2011, 159, 563–568. 31. Pena, A.; Sanchez, N.S.; Calahorra, M. Effects of chitosan on candida albicans: Conditions for its antifungal activity. BioMed Res. Int. 2013, 2013, 15. [CrossRef] [PubMed] 32. Palma-Guerrero, J.; Lopez-Jimenez, J.A.; Pérez-Berná, A.J.; Huang, I.C.; Jansson, H.B.; Salinas, J.; Villalaín, J.; Read, N.D.; Lopez-Llorca, L.V. Membrane fluidity determines sensitivity of filamentous fungi to chitosan. Mol. Microbiol. 2010, 75, 1021–1032. [CrossRef] [PubMed] Molecules 2017, 22, 1745 11 of 11 33. Alfaro-Gutiérrez, I.C.; Guerra-Sánchez, M.G.; Hernández-Lauzardo, A.N.; Velázquez-del Valle, M.G. Morphological and physiological changes on rhizopus stolonifer by effect of chitosan, oligochitosan or essential oils. J. Phytopathol. 2014, 162, 723–730. 34. Lopez-Moya, F.; Kowbel, D.; Nueda, M.J.; Palma-Guerrero, J.; Glass, N.L.; Lopez-Llorca, L.V. Neurospora crassa transcriptomics reveals oxidative stress and plasma membrane homeostasis biology genes as key targets in response to chitosan. Mol. BioSyst. 2016, 12, 391–403. [CrossRef] [PubMed] 35. García-Rincón, J.; Vega-Pérez, J.; Guerra-Sánchez, M.G.; Hernández-Lauzardo, A.N.; Peña-Díaz, A.; Velázquez-Del Valle, M.G. Effect of chitosan on growth and plasma membrane properties of rhizopus stolonifer (ehrenb.:Fr.) vuill. Pestic. Biochem. Physiol. 2010, 97, 275–278. 36. Cannon, R.D.; Lamping, E.; Holmes, A.R.; Niimi, K.; Tanabe, K.; Niimi, M.; Monk, B.C. Candida albicans drug resistance—Another way to cope with stress. Microbiology 2007, 153, 3211–3217. [CrossRef] [PubMed] 37. Kroll, K.; Pähtz, V.; Kniemeyer, O. Elucidating the fungal stress response by proteomics. J. Proteom. 2014, 97, 151–163. [CrossRef] [PubMed] 38. Smith, D.A.; Morgan, B.A.; Quinn, J. Stress signalling to fungal stress-activated protein kinase pathways. FEMS Microbiol. Lett. 2010, 306, 1–8. [CrossRef] [PubMed] 39. Hayes, B.M.E.; Anderson, M.A.; Traven, A.; van der Weerden, N.L.; Bleackley, M.R. Activation of stress signalling pathways enhances tolerance of fungi to chemical fungicides and antifungal proteins. Cell. Mol. Life Sci. 2014, 71, 2651–2666. [CrossRef] [PubMed] 40. Kim, J.H.; Campbell, B.C.; Yu, J.; Mahoney, N.; Chan, K.L.; Molyneux, R.J.; Bhatnagar, D.; Cleveland, T.E. Examination of fungal stress response genes using saccharomyces cerevisiae as a model system: Targeting genes affecting aflatoxin biosynthesis by aspergillus flavus link. Appl. Microbiol. Biotechnol. 2005, 67, 807–815. [CrossRef] [PubMed] 41. Freitas, F.Z.; Virgilio, S.; Cupertino, F.B.; Kowbel, D.J.; Fioramonte, M.; Gozzo, F.C.; Glass, N.L.; Bertolini, M.C. The SEB-1 transcription factor binds to the STRE motif in Neurospora crassa and regulates a variety of cellular processes including the stress response and reserve carbohydrate metabolism. G3 Genes Genomes Genet. 2016, 6, 1327–1343. [CrossRef] [PubMed] 42. Zakrzewska, A.; Boorsma, A.; Brul, S.; Hellingwerf, K.J.; Klis, F.M. Transcriptional response of saccharomyces cerevisiae to the plasma membrane-perturbing compound chitosan. Eukaryot. Cell 2005, 4, 703–715. [CrossRef] [PubMed] 43. Navarrete, C.; Petrezsélyová, S.; Barreto, L.; Martínez, J.L.; Zahrádka, J.; Ariño, J.; Sychrová, H.; Ramos, J. Lack of main k+ uptake systems in saccharomyces cerevisiae cells affects yeast performance in both potassium-sufficient and potassium-limiting conditions. FEMS Yeast Res. 2010, 10, 508–517. [CrossRef] [PubMed] 44. Guerrero-Castillo, S.; Cabrera-Orefice, A.; Vázquez-Acevedo, M.; González-Halphen, D.; Uribe-Carvajal, S. During the stationary growth phase, yarrowia lipolytica prevents the overproduction of reactive oxygen species by activating an uncoupled mitochondrial respiratory pathway. Biochim. Biophys. Acta 2012, 1817, 353–362. [CrossRef] [PubMed] 45. Lowry, O.H.; Rosebrough, N.J.; Farr, A.L.; Randall, R.J. Protein measurement with the folin phenol reagent. J. Biol. Chem. 1951, 193, 265–275. [PubMed] 46. Li, Y.; Schellhorn, H.E. Rapid kinetic microassay for catalase activity. J. Biomol. Tech. JBT 2007, 18, 185–187. [PubMed] 47. Pham, C.D.; Yu, Z.; Sandrock, B.; Bölker, M.; Gold, S.E.; Perlin, M.H. Ustilago maydis rho1 and 14-3-3 homologues participate in pathways controlling cell separation and cell polarity. Eukaryot. Cell 2009, 8, 977–989. [CrossRef] [PubMed] Sample Availability: Samples of the compounds chitosan, oligochitosan and glycol-chitosan are not available from the authors. © 2017 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/). DOI: 10.1530/JOE-16-0161 http://joe.endocrinology-journals.org © 2017 Society for Endocrinology Printed in Great Britain Published by Bioscientifica Ltd. Jo u rn a l o f E n d o cr in o lo g y 221–235N PAVÓN, A CABRERA-OREFICE and others Oophorectomy affects oxidative phosphorylationResearch 232:2 In female rat heart mitochondria, oophorectomy results in loss of oxidative phosphorylation Natalia Pavón1,*, Alfredo Cabrera-Orefice2,*, Juan Carlos Gallardo-Pérez3, Cristina Uribe-Alvarez2, Nadia A Rivero-Segura4, Edgar Ricardo Vazquez-Martínez4, Marco Cerbón4, Eduardo Martínez-Abundis5, Juan Carlos Torres-Narvaez1, Raúl Martínez-Memije6, Francisco-Javier Roldán-Gómez7 and Salvador Uribe-Carvajal2 1Departamento de Farmacología, Instituto Nacional de Cardiología Ignacio Chávez, México, Mexico 2Departamento de Genética Molecular, Instituto de Fisiología Celular, Universidad Nacional Autónoma de México, México D.F., Mexico 3Departamento de Bioquímica, Instituto Nacional de Cardiología Ignacio Chávez, México, Mexico 4Unidad de Investigación en Reproducción Humana, Instituto Nacional de Perinatología-Facultad de Química UNAM, México D.F., Mexico 5División Académica Multidisciplinaria de Comalcalco, Universidad Juárez Autónoma de Tabasco, México, Mexico 6Departamento de Instrumentación Electromecánica, Instituto Nacional de Cardiología Ignacio Chávez, Tlalpan DF, México, Mexico 7Departamento de Consulta externa, Instituto Nacional de Cardiología Ignacio Chávez, México, Mexico *(N Pavón and A Cabrera-Orefice contributed equally to this work) Abstract Oophorectomy in adult rats affected cardiac mitochondrial function. Progression of mitochondrial alterations was assessed at one, two and three months after surgery: at one month, very slight changes were observed, which increased at two and three months. Gradual effects included decrease in the rates of oxygen consumption and in respiratory uncoupling in the presence of complex I substrates, as well as compromised Ca2+ buffering ability. Malondialdehyde concentration increased, whereas the ROS- detoxifying enzyme Mn2+ superoxide dismutase (MnSOD) and aconitase lost activity. In the mitochondrial respiratory chain, the concentration and activity of complex I and complex IV decreased. Among other mitochondrial enzymes and transporters, adenine nucleotide carrier and glutaminase decreased. 2-Oxoglutarate dehydrogenase and pyruvate dehydrogenase also decreased. Data strongly suggest that in the female rat heart, estrogen depletion leads to progressive, severe mitochondrial dysfunction. Introduction Estrogens (17β-estradiol, estrone and progesterone) control diverse reproductive system functions. Their participation in other physiological processes such as cognition (Sherwin 1999), cardiovascular function (Stevenson 2000), immunity (Ahmed  et  al. 1999) and bone and mineral metabolism (Compston 2001) has been reported. Thus, estrogens are considered pleiotropic hormones. Estrogens enter the nucleus after being internalized by estrogen receptors α and β (ERα and ERβ) (Hall  et  al. 2001). In the myocardium, non-genomic pathways involving plasma membrane- bound ERs that activate protein kinase-mediated Correspondence should be addressed to N Pavón Email pavitonat@yahoo.com.mx Key Words  estrogens  heart mitochondria  oophorectomy  estrogen receptors  gender Journal of Endocrinology (2017) 232, 221–235 Research 222Oophorectomy affects oxidative phosphorylation DOI: 10.1530/JOE-16-0161 Jo u rn a l o f E n d o cr in o lo g y N PAVÓN, A CABRERA-OREFICE and others http://joe.endocrinology-journals.org © 2017 Society for Endocrinology Printed in Great Britain Published by Bioscientifica Ltd. 232:2 signaling cascades have been described (Sugden & Clerk 1998, Nuedling  et  al. 1999). Each estrogen receptor is codified by a unique gene (Giguere  et al. 1998), which possesses the characteristic functional domains of the steroid/thyroid hormone superfamily of nuclear receptors (Matthews & Gustafsson 2003). ERα and ERβ are widely distributed. ERα is expressed primarily in the uterus, liver, kidneys and heart, whereas ERβ is expressed primarily in the ovaries, prostate, lungs, gastrointestinal tract, bladder and hematopoietic and central nervous systems. Both receptors are co-expressed in mammary glands, epididymis, thyroid, adrenals, bone and some brain regions (Orshal & Khalil 2004, Mendoza- Garcés et al. 2011, Knowlton & Lee 2012). In addition, both receptors have been found in mitochondria, where their functions seem to be different and even antagonistic (Pedram  et  al. 2006, Psarra & Sekeris 2008, Yang et al. 2009). In brain mitochondria, estrogens modulate mitochondrial functions such as oxidative phosphorylation (Wang  et  al. 2001, Duckles  et  al. 2006) and Ca2+ uptake (Nilsen & Diaz Brinton 2003). In mouse heart, estrogens increase mitochondrial respiratory complex IV activity (Hsieh  et  al. 2006). In monkeys and in MCF-7 human breast cancer cells, estrogens may regulate mitochondrial biogenesis and size (Irwin  et  al. 2008, Rosario et al. 2008). However, in rats, this response has not been observed (Mattingly et al. 2008). We used oophorectomized rats as a model to study estrogenic depletion. In adipose tissue mitochondria, oophorectomy decreases oxidative capacity and antioxidant defenses (Nadal-Casellas  et  al. 2011), as well as complex IV (COX) and pyruvate dehydrogenase (PDH) activities in whole-brain mitochondria (Irwin  et  al. 2011). However, these changes have not been fully explored in heart mitochondria. Estrogen receptors have been reported in the mitochondrial inner membrane and matrix of neurons, primary cardiomyocytes, murine hippocampus cell lines and human heart cells, whereas for other steroids, such as progesterone, receptors have been found only in the outer membrane (Dai et al. 2013). We observed that oophorectomy affects heart mitochondrial functions such as oxygen consumption, Ca2+ uptake, transmembrane potential and the expression of different mitochondrial oxidative phosphorylation- related proteins; in castrated male rats, these results are not observed (Pavón  et  al. 2012). Thus, it was decided to evaluate the post-oophorectomy time-dependent evolution of heart mitochondria function. Materials and methods All experiments were conducted in agreement with ethical rules and guides from the Instituto Nacional de Cardiología, México (Record N°14-865). Animals Sixty Wistar female rats (3 weeks old) were used in the experiments. These were randomly assigned to one of two groups: control (Ctrl, intact rats) and oophorectomized (Cast). In addition, the latter were subdivided in three groups of twenty, to be analyzed at 1st, 2nd and 3rd month after surgery. Oophorectomy was performed in three-week-old animals under pentobarbital anesthesia. After surgery, rats were housed in our animal colony and maintained under controlled light/darkness cycles (12 h each) with water and rodent chow ad libitum. Isolation of heart mitochondria Rats were killed with sodium pentobarbital (100 mg/kg i.p.), and the heart was obtained. Heart tissue was incubated for 10 min with 2 mg/g of proteinase K (Sigma, P6556). Digested samples were centrifuged at 11,951.9 g, and the resulting pellet was homogenized in 125 mM KCl, 1 mM EDTA, 10 mM Tris, pH 7.3 (Pavón et al. 2012) and centrifuged again at 478.1 g, to pellet debris. From the supernatant, mitochondria were separated by differential centrifugation. Protein concentration was determined by the Bradford method (Bradford 1976). Oxygen consumption measurements It was assayed polarographically with a Clark electrode at 25°C. Reaction medium was 125 mM KCl, 3 mM phosphate, 2 mM MgCl2, 10 mM HEPES, pH 7.3. Either 10 mM succinate + 5 μg/mL rotenone or 5 mM glutamate + 5 mM malate were added as respiratory substrates. 300 μM ADP was added to induce the phosphorylating state (state 3) as described in Pavón and coworkers (Pavón et al. 2012). Mitochondria were added to a final concentration of 0.5 mg prot/mL; final volume was 1.5 mL. Respiratory control (RC) was calculated as 223Research N PAVÓN, A CABRERA-OREFICE and others Oophorectomy affects oxidative phosphorylation DOI: 10.1530/JOE-16-0161 Jo u rn a l o f E n d o cr in o lo g y http://joe.endocrinology-journals.org © 2017 Society for Endocrinology Printed in Great Britain Published by Bioscientifica Ltd. 232:2 the quotient between the rate of oxygen consumption in state 3 (ADP-stimulated respiration) and the rate in state 4 (after ADP pulse is entirely phosphorylated and respiration shifts to resting state). Calcium uptake Mitochondrial Ca2+ uptake was measured spectrophotometrically at 675–685 nm (dual wavelength mode) at room temperature using the indicator Arsenazo III as described by Janssen and Helbing (1991). Briefly, 10 mM succinate, 5 μg/mL rotenone, 100 μM CaCl2, 50 μM Arsenazo III, 100 μM ADP and 2 mg of mitochondrial protein were added to 2.9 mL 125 mM KCl, 3 mM phosphate, 10 mM HEPES, pH 7.3. Enzyme activities Citrate synthase (CS) was measured at 412 nm (ε = 13.6 mM/ cm) in a reaction mixture containing 0.023 mg/mL acetyl- CoA, 0.1 mM DTNB (5,5′-dithio-bis-2-nitrobenzoic acid), 0.25 mM oxaloacetate, 0.05% Triton X-100 and 10 mM Tris–HCl, pH 8; mitochondria 0.03 mg prot/mL. CS activity was used for normalization of enzyme activities (Davies et al. 2001, Barrientos et al. 2009, Schwarzer et al. 2013). NADH:decylubiquinone oxidoreductase (complex I) activity was measured by following the fluorescence changes of NADH at 460 nm using SET buffer (250 mM sucrose, 0.2 mM EDTA and 50 mM Tris, pH 7.2), 0.155 mM NADH, 0.077 mM decylubiquinone, 10 μM antimycin A, 0.05% Triton X-100 and 0.5 mg prot/mL mitochondria (Barrientos  et  al. 2009). Rotenone (10 μM) was added to inhibit complex I and remaining inhibitor-insensitive activities were subtracted to the data. Succinate:DCPIP oxidoreductase (complex II) activity was measured spectrophotometrically at 590 nm (ε = 15.96 mM/cm) in SET buffer, 100 μM DCPIP, 10 mM succinate, 10 μM antimycin A, 5 μM rotenone and 0.5 mg prot/mL mitochondria (Barrientos et al. 2009). An OMEGA microplate reader was used to determine CS and complexes I and II activities; final volume per well was 200 μL. Complex IV activity was measured as cyanide-sensitive oxygen consumption in the presence of 5 mM ascorbate, 1 μM TMPD (tetramethyl- phenylenediamine), 10 μM antimycin A and 0.5 mg prot/ mL mitochondria (Barrientos  et  al. 2009). NaCN (1 mM) was added to inhibit respiration at the end of each trace. Pyruvate dehydrogenase (PDH) and 2-oxoglutarate dehydrogenase (2-OGDH) activities were measured as in Cooney and coworkers (Cooney  et  al. 1981) with slight modifications using 125 mM KCl, 10 mM phosphate, 10 mM Tris/HCl, 5 mM MgCl2, 0.05% Triton X-100, 2 mM NAD+, 0.63 mM CoA, 1 mM TPP, 1 mM DTT, 1 mM PMSF, 10 μM rotenone, pH 7.4; mitochondria 0.5 mg prot/mL. The reaction was started with either 10 mM pyruvate or 10 mM 2-oxoglutarate. Reduction of NAD+ (ε = 6.22 mM/cm) was followed in a DW2000 AMINCO OLIS spectrophotometer at 340 nm. Aconitase activity was measured as in Hausladen & Fridovich (1994). Mitochondria were solubilized by adding 0.05% Triton X-100 in 25 mM phosphate, pH 7.2. Then, 0.6 mM MnSO4 and 10 mM citrate were added to the reaction mixture. The formation of cis-aconitate was measured at 240 nm. Malondialdehyde by capillary zone electrophoresis Malondialdehyde was determined as in Claeson and coworkers (Claeson et al. 2000). Briefly, 2 mg mitochondria were washed with methanol (1:1), centrifuged at 16,000 g for 15 min and filtered through a 0.22 μm nitrocellulose membrane. Samples were diluted (1:10) with 0.1 M NaOH and analyzed in a P/ACE MDQ (Beckman Coulter). Capillary tube was preconditioned with 0.1 M NaOH/10 min, distilled water/10 min and finally with 10 mM borate + 0.5 mM CTAB, pH 9 buffer. Separation was performed at −25 kV/4 min and absorbance was followed at 267 nm. Western blot Mitochondria were powdered in liquid nitrogen and dissolved in RIPA lysis buffer (PBS 1×, 1% IGEPAL NP40, 0.1% SDS and 0.05% sodium deoxycholate, pH 7.2) plus 5 mM protease inhibitor cocktail (Roche). Protein samples (40 μg) were re-suspended in loading buffer plus 5% β-mercaptoethanol and separated under denaturing conditions. Electrophoretic transfer to PVDF membranes (BioRad) was followed by overnight immunoblotting at 4°C with 1:500 diluted primary antibodies (Santa Cruz) against complex I subunit ND1; complex IV subunit COX4; ATP synthase subunit 5B (beta); adenine nucleotide translocator; pyruvate dehydrogenase subunit E1α; 2-oxoglutarate dehydrogenase; succinate dehydrogenase subunit C or glutaminase. Bands were revealed with secondary antibodies conjugated with horseradish peroxidase (Santa Cruz). The signal was detected by chemiluminescence using an ECL- Plus system (Amersham Bioscience). Densitometry was performed using the Scion Image Software (Scion; MD, USA) and normalized against its respective loading control. Research 224Oophorectomy affects oxidative phosphorylation DOI: 10.1530/JOE-16-0161 Jo u rn a l o f E n d o cr in o lo g y N PAVÓN, A CABRERA-OREFICE and others http://joe.endocrinology-journals.org © 2017 Society for Endocrinology Printed in Great Britain Published by Bioscientifica Ltd. 232:2 Blue native polyacrylamide gel electrophoresis (BN-PAGE) and in-gel enzymatic activities BN-PAGE was performed as described by Schägger (2001). Briefly, mitochondrial pellet was re-suspended in sample buffer (750 mM aminocaproic acid, 25 mM imidazole, pH 7.0) and solubilized with 2 mg n-dodecyl-β-D-maltoside (lauryl maltoside, LM)/mg prot at 4°C for 30 min and centrifuged at 60,000 g; 4°C/25 min. Supernatants were loaded into 4–12% (w/v) polyacrylamide gradient gels. After electrophoresis, in-gel NADH oxidoreductase (NDH) and cytochrome c oxidase (COX) activities were performed as in Zerbetto and coworkers (Zerbetto et al. 1997). BN-gels not subjected to in-gel activities, were stained with Coomassie blue G-250 (Wittig et al. 2007). Densitometry was done using the ImageJ (1.49v) software (NIH) and normalized against its respective loading control. Superoxide dismutase (MnSOD) activity MnSOD activity was determined in non-denaturing gels. Solubilized mitochondria (200 μg) were loaded into 10% polyacrylamide gels. After electrophoresis, gels were incubated in 0.5 mg/mL nitrotetrazolium blue (NTB) for 30 min and then in 28 mM TEMED, 36 mM potassium phosphate, 0.28 mM riboflavin, pH 7.8, in the darkness for 10 min. Activities were revealed by exposure to UV light for 10 min. A standard curve was performed using a serial dilution (2.5, 5, 10, 15, 30 and 60 ng) of MnSOD from bovine erythrocytes (Sigma Chemical Co.). Activities were calculated as in Pérez-Torres and coworkers (Pérez- Torres et al. 2009). Statistical analysis Student’s t-test for unpaired data was used to compare the baseline variables of the groups. ANOVA test was employed and when a significant F was obtained, a Newman–Keuls post-test was used to find intergroup differences. A P < 0.05 was considered statistically significant. For statistical analysis, we used Prism 5.0 software. Results Strong evidence indicates that estrogens control mitochondrial functions. Blood vessel mitochondria from oophorectomized rats (Cast) exhibit a delay in respiration that disappears upon estradiol administration (Duckles  et  al. 2006). Thus, we explored functional alterations in rat heart mitochondria at one, two and three months after oophorectomy. Oxygen consumption measurements were performed to analyze the progressive effect of castration on rat heart mitochondrial oxidative phosphorylation (OXPHOS) system (Table  1). Respiratory substrates used were succinate or glutamate–malate. Succinate- dependent oxygen consumption and respiratory controls (RC) were similar in oophorectomized (Cast) groups and in non-oophorectomized controls (Table 1 and Supplementary Fig. 1, see section on supplementary data given at the end of this article). By contrast, in the presence of glutamate–malate, respiratory coupling gradually decreased from the 1st month after surgery, whereas state 4 increased up to two times (Table 1 and Table 1 Oxygen consumption and respiratory controls in isolated heart mitochondria from control (Ctrl) and castrated (Cast) female rats at different times after surgery. Condition + Glutamate–malate + Succinate–rotenone State 4 State 3 RC State 4 State 3 RC 1st month Ctrl 36 ± 10 178 ± 42 5.2 ± 1.2 54 ± 9 153 ± 31 2.8 ± 0.2 Cast 56 ± 8 192 ± 36 3.4 ± 0.5* 70 ± 8 186 ± 35 2.7 ± 0.6 2nd month Ctrl 32 ± 6 152 ± 23 4.8 ± 1.1 71 ± 23 190 ± 36 2.8 ± 0.8 Cast 92 ± 19** 164 ± 27 1.9 ± 0.6*** 70 ± 14 172 ± 19 2.5 ± 0.5 3rd month Ctrl 33 ± 6 165 ± 16 5.1 ± 1.1 49 ± 13 141 ± 29 3.0 ± 0.9 Cast 62 ± 13* 96 ± 16** 1.6 ± 0.4*** 54 ± 19 157 ± 40 3.1 ± 0.9 Oxygen consumption was measured at 25°C, incubating mitochondria in 1.5 mL of a medium containing 125 mM KCl, 3 mM phosphate, 2 mM MgCl2, 10 mM HEPES, pH 7.3 and either 5 mM glutamate + 5 mM malate or 10 mM succinate + 5 μg/mL rotenone as substrates. To induce phosphorylating state (state 3), 300 μM ADP was added to the reaction chamber. Mitochondrial respiratory control (RC) is defined as the ratio between the rate of oxygen consumption in phosphorylating and non-phosphorylating states (RC = state 3/state 4). Values of oxygen consumption are expressed as ngAO/min.mg prot. Data of six independent experiments are shown as the mean ± S.D. *P < 0.05, **P < 0.01 and ***P < 0.001 with respect to each Ctrl value. 225Research N PAVÓN, A CABRERA-OREFICE and others Oophorectomy affects oxidative phosphorylation DOI: 10.1530/JOE-16-0161 Jo u rn a l o f E n d o cr in o lo g y http://joe.endocrinology-journals.org © 2017 Society for Endocrinology Printed in Great Britain Published by Bioscientifica Ltd. 232:2 Figure 1 Progressive mitochondrial protein contents modifications during the first three months after oophorectomy. Panel A, one month; panel B, two months; panel C, third month after castration. Left panels (i) western blot analysis of proteins from intact (Ctrl) and castrated (Cast) female rat mitochondria. ND1, NADH ubiquinone oxidoreductase (complex I); COX IV, cytochrome c oxidase subunit 4; ATPase, ATP synthase subunit 5B (beta); ANT, adenine nucleotide translocase; PDH-E1α, pyruvate dehydrogenase subunit E1; 2-OGDH, α-ketoglutarate dehydrogenase; SDHC, succinate dehydrogenase subunit B; GA, glutaminase. Right panels (ii), variations in protein contents compared to the control ND1. Representative blots and data from three independent experiments; *P < 0.05 and **P < 0.01. Research 226Oophorectomy affects oxidative phosphorylation DOI: 10.1530/JOE-16-0161 Jo u rn a l o f E n d o cr in o lo g y N PAVÓN, A CABRERA-OREFICE and others http://joe.endocrinology-journals.org © 2017 Society for Endocrinology Printed in Great Britain Published by Bioscientifica Ltd. 232:2 Supplementary Fig. 1). At the 3rd month after surgery, state 3 decreased near to half (Table  1). These results suggested a dysfunction of complex I, which is highly sensitive to stress and can be regulated by estrogens (Chen et al. 2009). Previously, in rats tested at the 4th month after castration, we detected changes in different mitochondrial OXPHOS-related proteins such as cytochrome c oxidase, ATP synthase, adenine nucleotide translocase (ANT), pyruvate dehydrogenase subunit 1 (PDH-E1α), 2-oxoglutarate dehydrogenase (2-OGDH), succinate dehydrogenase subunit C (SDHC) and glutaminase (GA). These data led to measure the activity and contents of these proteins at different times after oophorectomy (Fig. 1). At the 1st month, Cast rats showed similar contents of mitochondrial OXPHOS-related proteins as those of Ctrl (Fig.  1A). Then, at 2nd and 3rd months, some of these proteins gradually changed their expression (Fig. 1B and C). For example, at the 2nd month, there was a perceptible decrease in 2-OGDH, SDHC and GA (Fig. 1B) and later on the decrease was more evident (from 0.5 to 5 times approximately) for most proteins, particularly for PDH (Fig. 1C). Besides, it was of interest to determine if these low levels of protein expression correlated with changes in OXPHOS complexes function; therefore, these enzymes were explored. The amount of complexes I, III, IV and V was determined by BN-PAGE (Fig. 2A). After oophorectomy, a progressive decrease in complex I was observed (Fig. 2A) and evidenced further by densitometry (Fig. 2D). At the 3rd month, a slight decrease in complex IV content was also present (Fig.  2A and D). As there are only subtle changes in the amount of complexes III and V (Fig. 2A Figure 2 Progressive effects of castration on heart mitochondrial OxPhos complexes I, III, IV and V from female rats. Lanes are from control (Ctrl) and 1-, 2- and 3-month castrated rat heart mitochondrial samples. Isolated mitochondria were solubilized with lauryl-maltoside (LM) 2 mg/mg protein before electrophoretic separation. (A) Different samples were resolved by BN-PAGE in a 4–12% polyacrylamide gradient gel and were subjected to Coomassie staining. (B) In-gel NADH dehydrogenase activity (NDH); 1 mM NADH and 0.5 mg/mL Nitrotetrazolium blue chloride (NTB). (C) In-gel cytochrome c oxidase activity (COX); 0.04% diaminobenzidine and 0.02% cytochrome c. (D, E and F) Densitometry analysis of different protein bands from panels A (complexes I, III, IV and V), B (complex I in-gel activity (NDH)) and C (complex IV in-gel activity (IV)), respectively; *P < 0.05, **P < 0.01, ***P < 0.01. Representative figures from 3 independent gels. Respiratory chain complexes of interest are marked as I and IV. ATP synthase (V) was used as loading control. A full colour version of this figure is available at http://dx.doi.org/10.1530/JOE-16-0161. 227Research N PAVÓN, A CABRERA-OREFICE and others Oophorectomy affects oxidative phosphorylation DOI: 10.1530/JOE-16-0161 Jo u rn a l o f E n d o cr in o lo g y http://joe.endocrinology-journals.org © 2017 Society for Endocrinology Printed in Great Britain Published by Bioscientifica Ltd. 232:2 and D), the last one was used as loading control. Only one control (1st month) is shown in Fig. 2 as no differences were observed throughout the three months (data not shown). Furthermore, in-gel activities for complexes I (Fig. 2B) and IV (Fig. 2C) decreased as post-castration time increased. Once again, densitometry analysis confirmed the differences in both NDH (Fig. 2E) and COX (Fig. 2F) activities at two and three months after castration. Individual activities of the enzymes that decreased after oophorectomy were determined to verify our findings. Citrate synthase (CS) activity was almost the same at different post-castration times; only a slight decrease at the 3rd month was detected (Table  2). Therefore, to discard the effects of different yield or stability of mitochondria on enzyme activities, data were also normalized to their respective CS activities. Complex I activity decreased as post-oophorectomy time increased in a similar way as observed by in-gel staining (Table 2). In  addition, complex II activity did not change in any case (Table 2). The activities of complexes III and V were not determined as their respective relative contents did not change (Fig.  2A). PDH and 2-OGDH activities were also determined spectrophotometrically. At the 1st month after oophorectomy, no differences were found in enzyme activities, although beginning on the 2nd month, both Table 2 Effect of castration on the mitochondrial enzyme activities at different times (months) after surgery. Enzyme Condition Activity (%) Activity (%)/CS activity (%) Citrate synthase Control 100 ± 10a Castrated 1st month 95 ± 9 2nd month 90 ± 12 3rd month 85 ± 12 Complex I Control 100 ± 6b 1 Castrated 1st month 90 ± 6 0.95 2nd month 62 ± 10** 0.69** 3rd month 31 ± 8*** 0.36*** Complex II Control 100 ± 13c 1 Castrated 1st month 94 ± 15 0.99 2nd month 83 ± 5 0.92 3rd month 84 ± 16 0.98 Complex IV Control 100 ± 13d 1 Castrated 1st month 91 ± 21 0.96 2nd month 50 ± 12** 0.56** 3rd month 47 ± 8*** 0.55*** Pyruvate dehydrogenase Control 100 ± 14e 1 Castrated 1st month 94 ± 12 0.99 2nd month 54 ± 10** 0.60** 3rd month 10 ± 2*** 0.12*** 2-Oxoglutarate dehydrogenase Control 100 ± 12f 1 Castrated 1st month 102 ± 10 1.07 2nd month 48 ± 6*** 0.53*** 3rd month 30 ± 4*** 0.35*** 100% of activity corresponds to: a444.13 ± 43.9 nmol DTNB/min·mg prot; b627.2 ± 54.6 nmol NADH/min·mg prot; c141.6 ± 18.9 nmol DCPIP/min·mg prot; d620 ± 83.3 ngAO/min·mg prot; e34.5 ± 4.7 nmol NADH/min·mg prot; f121.8 ± 14.4 nmol NADH/min·mg prot. Activities were measured at room temperature (~25°C). In PDH, OGDH and complex II determinations, rotenone 10 μM was added to prevent the oxidation of the NADH or reverse electron transfer by complex I. Data from three-six independent experiments. **P < 0.01, ***P < 0.001 with respect to each control value. Figure 3 Effect of castration on Ca2+ transport by heart mitochondria isolated from female rats at different castration times. Mitochondrial protein (2 mg) was added to 3 mL of a medium containing 125 mM KCl, 10 mM succinate, 10 mM HEPES, 3 mM phosphate, 100 μM ADP, 100 μM CaCl2, 5 μg rotenone and 50 μM arsenazo III. Arsenazo III absorbance changes were followed at 675–685 nm; room temperature. Panel A, trace (i) shows intact female mitochondria from 1 month; trace (ii) shows castrated female mitochondria from 1 month; panel B trace (i) shows intact female mitochondria from 2 months; trace (ii) shows castrated female mitochondria from 2 months; panel C trace (i) shows intact female mitochondria from 3 months; trace (ii) shows castrated female mitochondria from 3 months. Representative traces from 10 independent experiments. Research 228Oophorectomy affects oxidative phosphorylation DOI: 10.1530/JOE-16-0161 Jo u rn a l o f E n d o cr in o lo g y N PAVÓN, A CABRERA-OREFICE and others http://joe.endocrinology-journals.org © 2017 Society for Endocrinology Printed in Great Britain Published by Bioscientifica Ltd. 232:2 decreased (Table  2). This was more evident at the 3rd month after surgery where PDH activity decreased almost 10 times and 2-OGDH almost 3 times (Table 2). Ca2+ overaccumulation is considered as another effect of oophorectomy on mitochondria (Pavón  et  al.  2012). Therefore, it was interesting to study whether this parameter changed in heart mitochondria. As Fig.  3A shows, at 1st month, there was no difference between Ctrl (trace i) and Cast (trace ii). At the 2nd month, a minimal difference was present (Fig.  3B, i and ii). Nonetheless, 3rd month Cast mitochondria exhibited a mild loss in the capacity to retain Ca2+ (Fig. 3C). After 45 min, these mitochondria released about a 30% of Ca2+ (Fig. 3C). Heart mitochondria are equipped with effective ROS scavenging systems. Dysfunctions in these systems are directly related to cardiovascular disease (Matthews & Gustafsson 2003, Nilsen & Diaz Brinton 2003, Orshal & Khalil 2004, Psarra & Sekeris 2008, Irwin et al. 2011). Earlier observations have evidenced the influence of estrogens on the expression and function of antioxidant proteins such as MnSOD (Baños  et  al. 2005a,b). These evidences raise the possibility of oxidative damage in Cast rats. To test if this condition was present, MnSOD and aconitase activities were quantified (Fig. 4 panels A, B) and malondialdehyde levels were measured (Fig. 5). In regard to MnSOD activity, it was found that at the 1st month after oophorectomy, there were no differences between Ctrl and Cast groups (Fig.  4A, i). However, at the 2nd month, activity was lower in Cast group, which was statistically significant (Fig. 4, ii). This difference in MnSOD activity was even more obvious at the 3rd month (Fig. 4, iii). Figure 4 Superoxide dismutase (MnSOD) and aconitase activities in heart mitochondria from control and castrated female rats. Panel A figure (i) shows MnSOD activity in heart mitochondria from control (Ctrl) and castrated (Cast) rats after 1st month; figure (ii) shows MnSOD activity in Ctrl and Cast rats at the 2nd month; figure (iii) shows MnSOD activity in Ctrl and Cast at the 3rd month. Representative figures from 5 independent gels; images are representative of 10 separate experiments. Panel B trace (i) shows aconitase activity in Ctrl and Cast heart mitochondria at the 1st month; trace (ii) shows aconitase activity at the 2nd month and trace (iii) shows aconitase activity at the 3rd month. The results are expressed as the mean ± S.D. from 10 different experiments. Unpaired t-test was used for statistical analysis. *P < 0.05, **P < 0.01. Figure 5 Lipoperoxidation expressed as malondialdehyde generation in heart mitochondria from Ctrl and Cast female rats. The results are expressed as mean ± S.D. for 10 different samples per group analyzed. 2 mg of protein were used and malondialdehyde was separated at −25 kV/4 min at 267 nm. Results were expressed as pmol/mL. *P < 0.05, ***P < 0.001. 229Research N PAVÓN, A CABRERA-OREFICE and others Oophorectomy affects oxidative phosphorylation DOI: 10.1530/JOE-16-0161 Jo u rn a l o f E n d o cr in o lo g y http://joe.endocrinology-journals.org © 2017 Society for Endocrinology Printed in Great Britain Published by Bioscientifica Ltd. 232:2 In a previous study, we found evidence that estrogens may control the expression of some proteins involved in OXPHOS (Pavón et al. 2012). Thereby, a dysfunction in the respiratory chain should also involve the overproduction of ROS. These ROS would inactivate enzymes containing iron–sulfur centers, e.g. aconitase and complexes I, II and III. Aconitase inactivation is an appropriate marker of the superoxide production on the matrix side (Muller  et  al. 2004). No differences were detected at the 1st month (Fig. 4B, i), whereas inhibition was present from the 2nd month (40%) (Fig.  4B, ii) and increased during the 3rd month (54%) (Fig.  4B, iii). Thus, higher production of ROS or defective detoxification mechanisms will damage lipids, proteins and DNA. An indicator of oxidative damage is malondialdehyde (MDA), whose level increased in the Cast group beginning at the 2nd month and becoming even higher at the 3rd month (Fig. 5). All previous data indicated that oophorectomy leads to dysfunctional mitochondria and increased levels of oxidative damage. Both effects have also been implicated in abnormal mitochondrial dynamics (fusion and fission) (Ong & Hausenloy 2010, Wohlgemuth et al. 2014). In an effort to determine if oophorectomy is associated with mitochondrial dynamics, we measured the expression of the fission-associated proteins Fis-1 and Drp-1, the fusion- associated protein OPA-1 and the apoptosis-related proteins Bcl-2 and Bax. Figure 6 shows no significant changes in the expression of the dynamic-related proteins at any time after castration. In fact, only Fis-1 decreased at the first month, but increased back to Ctrl levels at the second and third month. In addition, we found a decrease in expression of Bcl-2 after the first month of castration, whereas an increase was detected at the third month (Fig. 7). Mitochondrial dysfunction can result from a decrease in protein content (Chen et al. 2004, 2009) and activity of OXPHOS enzymes (Stirone et al. 2005). These may affect the important functions for the cell (e.g. Ca2+ uptake, metabolite transport, and so forth) and mitochondrial biogenesis (Mattingly et al. 2008). All such changes would presumably lead to a decrease in metabolites oxidation. Under our experimental conditions, it is probable that most of them were present and higher at the 3rd month after oophorectomy. Discussion After the 1st month post-oophorectomy, isolated mitochondria in the presence of glutamate–malate exhibited a slight decrease in respiratory coupling compared to the controls (Table 1). At the 2nd and 3rd months, respiratory coupling in Cast groups was almost 40% and a decrease in complex I content and activity was detected (Fig. 2A, B, Tables 1 and 2). By contrast, using succinate–rotenone, respiratory activities and coupling Figure 6 Western blot detection of proteins Fis-1, Drp-1 and OPA-1. Panel A shows content of Fis-1 in each experimental group; Panel B shows the content of Drp-1 and Panel C, OPA-1 content. In all cases, 30 μg of each sample were loaded per lane. VDAC was used as loading control. Bars represent mean ± S.E.M. of 3 independent experiments; *P < 0.05. Figure 7 Western blot detection of proteins Bax and Bcl-2. Panel A shows the content of Bax in each experimental group. Panel B shows content of Bcl-2 in each experimental group. VDAC was used as loading control. Bars represent mean ± S.E.M. of 3 independent experiments; *P < 0.05. Research 230Oophorectomy affects oxidative phosphorylation DOI: 10.1530/JOE-16-0161 Jo u rn a l o f E n d o cr in o lo g y N PAVÓN, A CABRERA-OREFICE and others http://joe.endocrinology-journals.org © 2017 Society for Endocrinology Printed in Great Britain Published by Bioscientifica Ltd. 232:2 were not different between Ctrl and Cast groups at any time after surgery. Individual complex II activities normalized to CS were not affected in Cast groups (Table 2) even if SDHC subunit expression decreased ~40% (Fig. 1). COX IV and ATPase β subunits decreased, suggesting a general decrease in OXPHOS-related proteins. A decrease in complex IV content (~85%) and activity (~55%) was observed, whereas complexes III and V were constant (Fig. 2 and Table 2). Although the amount and activity of complex IV decreased, electron flux through complexes I and II was not limited. In complex I-dependent respiration, flux control mostly lies on complexes I and III, whereas in complex II-dependent respiration, control lies on complexes III and IV (Bianchi  et  al. 2004). The stoichiometry for complexes I:II:III:IV is 1:1.5:3:6–7, respectively (Schägger & Pfeiffer 2001); thus, a partial decrease in complexes II and IV contents would not be expected to modify respiratory activity as would for instance, complex I deficiency. After oophorectomy, complex IV activity decreased up to 300 ngAO/min·mg prot (~50% of the Vmax); nevertheless, this value was still higher than the control respiratory rate in state 3 (Table  1). Thus, in Cast samples, succinate oxidation would not decrease as complex IV is still in excess compared to the other three complexes. Conversely, in the NADH–O2 reaction, glutamate and malate were oxidized through different pathways to produce NADH and feed the respiratory chain via complex I. That is, electron flux was mostly limited by complex I. In addition to the gradual loss of complex I contribution (Fig. 2 and Table 2), we found a lower activity in two of NAD-dependent dehydrogenases from the Krebs cycle: PDH and 2-OGDH (Fig.  1 and Table 2), which must have limited even further the rate of electron transfer through this pathway. Further studies are required to explore these individual pathways in heart mitochondria after oophorectomy. Furthermore, it has been described that the transcription of the mRNA encoding for complex I subunits ND1, NDUFS7 and NDUFS8 might be regulated by estrogens (Too  et  al. 1999, Noguchi  et  al. 2002, Chen et al. 2009). Thus, in the absence of estrogens, a decrease in complex I content and activity would be expected as observed here (Fig. 2A and B). Remarkably, expression of subunit ND1 did not change after castration (Fig. 1). ND1 is a mitochondrial DNA-encoded protein, whereas NDUFS7 and NDUFS8 are codified by nuclear genes (Chen et al. 2009). The last two subunits are associated with each other and are also known to be part of the catalytic site for ubiquinone (Sánchez- Caballero  et  al. 2016). We have not analyzed yet the expression of nuclear-encoded subunits, which are probably more susceptible to estrogenic regulation than the mitochondrial-encoded proteins as other nuclear proteins were clearly downregulated after oophorectomy (e.g. SDHC, COX IV, GA and PDH-E1α) (Fig.  1). For instance, GA expression is upregulated via estrogen- related receptor alpha (ERRα during cell differentiation (Huang  et  al. 2016)). Estrogen receptors are known to play a crucial role in the transcriptional control of mitochondrial function and energy metabolism (Hsieh et al. 2006, Huang et al. 2016). Inability to regulate matrix solutes is among the first alterations in damaged mitochondria. Here, Cast mitochondria exhibited dysfunction in Ca2+ accumulation at the 3rd month after surgery (Fig. 3C). The inability of isolated heart mitochondria to hold Ca2+ and its further release may be due to MPTP activation and transmembrane potential depletion, a condition fully achieved at the 4th month (Hunter et al. 2012, Pavón et al. 2012). Different stress conditions such as ischemia, hypoxia, oxidative stress and cytotoxic drugs were identified as inducers of MPTP. A link between estrogen deficiency and MPTP activation is suggested, but then again, the mechanism remains obscure. Cardiac mitochondria exist in two functionally distinct populations: subsarcolemmal mitochondria (SSM) and interfibrillar mitochondria (IFM) (Palmer et al. 1977). SSM are released by tissue homogenization leaving behind skinned myocytes; the liberation of IFM from skinned myocytes requires a brief exposure to a protease. Aging (Fujioka  et  al. 2011, Suh  et  al. 2003) and caloric restriction (Hofer  et  al. 2009) studies have shown that age-related decline in mitochondrial capacity affects IFM, whereas SSM located beneath the plasma membrane remain unaffected. Changes in morphology and disposition in IFM without estrogens were reported previously (Zhai et al. 2000); the SSM population was not studied by these authors. Based on these observations, it would be very interesting to determine whether changes occur only in the IFM population. Moreover, it has been described that oxidative stress in Cast mitochondria and antioxidant systems, such as MnSOD, depends on estrogens (Baños  et  al. 2005a,b, Pedram  et  al. 2006, Bellanti  et  al. 2013). Thus, estrogen loss probably impairs SOD activity increasing ROS (Borras et al. 2007), as in fact we found (Figs 4 and 5). ROS damaged aconitase and increased malondialdehyde. Also, key enzymes involved in mitochondrial bioenergetics, such as 2-oxoglutarate dehydrogenase (OGDH), were 231Research N PAVÓN, A CABRERA-OREFICE and others Oophorectomy affects oxidative phosphorylation DOI: 10.1530/JOE-16-0161 Jo u rn a l o f E n d o cr in o lo g y http://joe.endocrinology-journals.org © 2017 Society for Endocrinology Printed in Great Britain Published by Bioscientifica Ltd. 232:2 probably affected by ROS (Gibson et al. 2000, Starkov et al. 2004, Martin et al. 2005). In regard to the possibility of disequilibrium in apoptosis, we evaluated the expression of two members of the Bcl-2 protein family, which regulate apoptosis. We measured Bax, which is a pro-apoptotic protein and Bcl-2 that is an anti-apoptotic protein. Although Bax remained constant, Bcl-2 levels decreased at the 1st month after castration and then increased at the 3rd month (Fig.  7). However, no increase in apoptosis was observed (data not shown). Our findings provide an important overview of the cardioprotective effect of estrogens on mitochondrial bioenergetics and dynamics. At menopause, the decrease in estrogens may contribute to cardiac vulnerability by playing important roles in intracellular energy and redox-dependent intracellular signaling. Mitochondrial contents have to adapt to cellular growth rate and meet cell requirements. In this landscape, estrogens could orchestrate a comprehensive cardiac transcriptional program including use of substrates, production and transport of ATP and modulation of antioxidant enzymes (Noguchi  et  al. 2002, Baños  et  al. 2005a,b, Klinge 2008). Estrogen levels in rats vary and seem to affect mitochondrial functions. In rats, it is known that steroidogenesis by testes or ovaries are reactivated at 30–45  days of postnatal life (Banu & Aruldhas 2002) reaching their maximum levels of estrogens at puberty at 10 weeks of age (Ojeda et al. 2007). To avoid hormonal influences and isolate estrogen depletion-related damage, three-week-old rats were used. Our animals will not be exposed to estrogens in their lifetime unless these are provided exogenously. Thus, our model is not exactly equivalent to menopause. Sexual hormones affect diverse non-reproductive tissues including immune, central nervous and skeletal systems, as well as cells from liver, skin and kidneys (Smith  et  al. 1994, Carani  et  al. 1997, Kovats 2012, 2015, Koss  et  al. 2015, Khalid & Krum 2016, Khan & Ansar Ahmed 2016). There is a variety of biological effects, many of which bear no clear relationship to their primary reproductive functions. Particularly in rodents, estrogens have many actions that may affect the body weight and adiposity independently of feeding patterns, including energy expenditure, gastrointestinal function, basal metabolism, growth and body composition. For example, estrogen deprivation decreases triiodothyronine (Thomas et al. 1986). Thyroid hormones and estrogens exhibit overlapping functions and cross-modulate genes involved in reproduction and sexual behavior (Vasudevan et al. 2001). On the other hand, estrogens prevent hypertension by modulating the renin–angiotensin–aldosterone system (RAAS), acting not only on the kidney, heart and vasculature but also on the central nervous system (Sullivan 2008, Sandberg & Ji 2012, O’Donnell  et  al. 2014). Estrogens also modulate pituitary growth hormone (GH) secretion and signaling (Sinha et al. 1979, Kerrigan & Rogol 1992, Baik et al. 2011, Fernández-Pérez et al. 2013). Thus, after menopause or oophorectomy, a precipitous decline in insulin levels and sensitivity is present, parallels an increase in fat mass and elevations in circulating inflammatory markers, low-density lipoproteins (LDL), triacylglycerols and fatty acids, i.e. estrogen deprivation leads to metabolic syndrome (Pfeilschifter  et  al. 2002, Sites et al. 2002, Carr 2003, Toth et al. 2006). Estrogens have also been linked to cholecystokinin, increasing its satiation action (Asarian & Geary 2006). Low estrogen levels promote increased body weight and adiposity (Mauvais-Jarvis  et  al. 2013). This was also observed in our experimental groups (1st month Ctrl 75 ± 10 g vs Cast 85 ± 13 g; 2nd month Ctrl 109 ± 14 g vs Cast 137 ± 14 g; 3rd month Ctrl 216 ± 21 g vs Cast 269 ± 13 g). Our study evaluated the progression of the oophorectomy-evoked changes in cardiac mitochondrial OXPHOS functions. These modifications were fully established only after three months of castration and not at 2  weeks as in mitochondria from other organs (Li  et  al. 2009, Cavalcanti-de-Albuquerque  et  al. 2014). These effects clearly mimic those observed in human menopause (Barrett-Connor 2013). Thus, our data provide strong evidence in favor of estrogen substitution therapy (Al-Safi & Santoro 2014, Whayne & Mukherjee 2015). Surgical castration is generally favored as a model of menopause. However, 4-vinylcyclohexene diepoxide (VCD) has been recently proposed to reproduce ‘menopausal conditions’ as it destroys preantral ovarian follicles preserving ovaries (Hoer et al. 2001, Mayer et al. 2002). VCD increases markers of oxidative damage and inflammation (in liver and kidney) and also caspases 9 and 3 and other side effects (Abolaji et al. 2016). In heart, these secondary effects have not been discarded, so, we advocate surgery over VCD as a model to study estrogen depletion. In conclusion, in rat heart mitochondria, estrogen deprivation gradually leads to (a) decreased contents and function of aerobic metabolism-related proteins such as complex I, complex IV, ATPase-b, ANT, PDH- E1α, 2KGDH, SDHC and GA; (b) impaired mitochondrial Research 232Oophorectomy affects oxidative phosphorylation DOI: 10.1530/JOE-16-0161 Jo u rn a l o f E n d o cr in o lo g y N PAVÓN, A CABRERA-OREFICE and others http://joe.endocrinology-journals.org © 2017 Society for Endocrinology Printed in Great Britain Published by Bioscientifica Ltd. 232:2 Ca2+ transport; (c) decreased ROS-detoxifying enzyme activities and (d) increased lipoperoxidation (MDA). By contrast, it is suggested that fusion and fission were not affected, as only small and reversible changes in proteins Fis-1, Drp-1 and OPA-1 were detected (Fig. 6). In addition, mitochondrial biogenesis probably was not affected as CS activity did not change after castration (Table 2). All oophorectomy effects were progressive; at month 1, some were hardly detectable and gradually became more evident at months 2 and 3. Our evidence suggests that estrogens regulate mitochondrial function (Hall  et  al. 2001, Duckles  et  al. 2006, Pedram  et  al. 2006, Psarra & Sekeris 2008, Yang et al. 2009), probably through transcriptional changes (Orshal & Khalil 2004, Klinge 2008, Mattingly  et  al. 2008) that lead to loss of OXPHOS. Supplementary data This is linked to the online version of the paper at http://dx.doi.org/10.1530/ JOE-16-0161. Declaration of interest The authors declare that there is no conict of interest that could be perceived as prejudicing the impartiality of the research reported. Funding Partially funded by PAPIIT/UNAM (Grant IN204015) and CONACyT (Grant 239487). This work is part of Project 14-865 Instituto Nacional de Cardiología. Acknowledgements The authors would like to thank Eréndira Reyes Camacho for her technical assistance and Dr Verónica Guarner for her valuable assistance and helpful discussions. A C O, C U A and N A R S are CONACyT fellows. References Abolaji AO, Tolovai PE, Odeleye TD, Akinduro S, Teixeira Rocha JB & Farombi EO 2016 Hepatic and renal toxicological evaluations of an industrial ovotoxic chemical 4-vinylcyclohexene diepoxide, in both sexes of Wistar rats. Environmental Toxicology and Pharmacology 13 28–40. (doi:10.1016/j.etap.2016. 05.010) Ahmed SA, Hissong BD, Verthelyi D, Donner K, Becker K & Karpuzoglu- Sahin E 1999 Gender and risk of autoimmune diseases: possible role of estrogenic compounds. Environmental Health Perspectives 107 681–686. (doi:10.1289/ehp.99107s5681) Al-Safi ZA & Santoro N 2014 Menopausal hormone therapy and menopausal symptoms. Fertility and Sterility 101 905–915. (doi:10.1016/j.fertnstert.2014.02.032) Asarian L & Geary N 2006 Modulation of appetite by gonadal steroid hormones. Philosophical Transactions of the Royal Society of London. Series B, Biological Sciences 361 1251–1263. (doi:10.1098/ rstb.2006.1860) Baik M, Yu JH & Hennighausen L 2011 Growth hormone-STAT5 regulation of growth hepatocellular carcinoma and liver metabolism. Annals of the New York Academy of Sciences 1229 29–37. (doi:10.1111/ j.1749-6632.2011.06100.x) Banu KS & Aruldhas MM 2002 Sex steroids regulate TSH-induced thyroid growth during sexual maturation in Wistar rats. Experimental and Clinical Endocrinology and Diabetes 110 37–42. (doi:10.1055/s-2002-19993) Baños G, Medina-Campos ON, Maldonado PD, Zamora J, Pérez I, Pavón N & Pedraza-Chaverrí J 2005a Antioxidant enzymes in hypertensive and hypertriglyceridemic rats: effect of gender. Clinical and Experimental Hypertension 27 45–57. (doi: 10.1081/ceh- 200044255) Baños G, Medina-Campos ON, Maldonado PD, Zamora J, Pérez I, Pavón N & Pedraza-Chaverrí J 2005b Activities of antioxidant enzymes in two stages of pathology development in sucrose-fed rats. Canadian Journal of Physiology and Pharmacology 83 278–286. (doi:10.1139/y05-013) Barrett-Connor E 2013 Menopause, atherosclerosis, and coronary artery disease. Current Opinion in Pharmacology 13 186–191. (doi:10.1016/j. coph.2013.01.005) Barrientos A, Fontanesi F & Díaz F 2009 Evaluation of the mitochondrial respiratory chain and oxidative phosphorylation system using polarography and spectrophotometric enzyme assays. Current Protocols in Human Genetics Chapter 19, Unit 19.3. (doi:10.1002/0471142905.hg1903s63) Bellanti F, Matteo M, Rollo T, De Rosario F, Greco P, Vendemiale G & Serviddio G 2013 Sex hormones modulate circulating antioxidant enzymes: impact of estrogen therapy. Redox Biology 1 340–346. (doi:10.1016/j.redox.2013.05.003) Bianchi C, Genova ML, Parenti Castelli G & Lenaz G 2004 The mitochondrial respiratory chain is partially organized in a supercomplex assembly: kinetic evidence using flux control analysis. Journal of Biological Chemistry 279 36562–36569. (doi:10.1074/jbc. M405135200) Borras C, Gambini J & Vina J 2007 Mitochondrial oxidant generation is involved in determining why females live longer than males. Frontiers in Bioscience 12 1008–1013. (doi:10.2741/2120) Bradford MM 1976 A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Analytical Biochemistry 72 248–254. (doi:10.1016/0003- 2697(76)90527-3) Carani C, Qin K, Simoni M, Faustini-Fustini M, Serpente S, Boyd J, Korach KS & Simpson ER 1997 Effect of testosterone and estradiol in a man with aromatase deficiency. New England Journal of Medicine 337 91–95. (doi:10.1056/NEJM199707103370204) Carr MC 2003 The emergence of the metabolic syndrome with menopause. Journal of Clinical Endocrinology and Metabolism 88 2404–2411. (doi:10.1210/jc.2003-030242) Cavalcanti-de-Albuquerque JPA, Salvador CI, Lopes ME, Jardim- Messeder D, Werneck-de-Castro JPS, Galina A & Carvalho DP 2014 Role of estrogen on skeletal muscle mitochondrial function in ovariectomized rats: a time course study in different fiber types. Journal of Applied Physiology 116 779–789. (doi:10.1152/ japplphysiol.00121.2013) Chen JQ, Delannoy M, Cooke C & Yager DJ 2004 Mitochondrial localization of ERα and ERβ in human MCF7 cells. American Journal of Physiology: Endocrinology and Metabolism 286 E1011–E1022. (doi:10.1152/ajpendo.00508.2003) Chen JQ, Cammarata PR, Baines CP & Yager JD 2009 Regulation of mitochondrial respiratory chain biogenesis by estrogens/estrogen receptors and physiological, pathological and pharmacological implications. Biochimica et Biophysica Acta 1793 1540–1570. (doi:10.1016/j.bbamcr.2009.06.001) Claeson K, Aberg T & Karlberg B 2000 Free malondialdehyde determination in rat brain tissue by capillary zone electrophoresis: 233Research N PAVÓN, A CABRERA-OREFICE and others Oophorectomy affects oxidative phosphorylation DOI: 10.1530/JOE-16-0161 Jo u rn a l o f E n d o cr in o lo g y http://joe.endocrinology-journals.org © 2017 Society for Endocrinology Printed in Great Britain Published by Bioscientifica Ltd. 232:2 evaluation of two protein removal procedures. Journal of Chromatography B: Biomedical Applications 740 87–92. (doi:10.1016/ S0378-4347(00)00030-X) Compston JE 2001 Sex steroids and bone. Physiological Reviews 81 419–447. Cooney GJ, Taegtmeyer H & Newsholme EA 1981 Tricarboxylic acid cycle flux and enzyme activities in the isolated working rat heart. Biochemical Journal 200 701–703. (doi:10.1042/bj2000701) Dai Q, Shah AA, Garde RV, Yonish BA, Zhang L, Medvitz NA, Miller SE, Hansen EL, Dunn CN & Price TM 2013 A truncated progesterone receptor (PR_M) localizes to the mitochondrion and controls cellular respiration. Molecular Endocrinology 27 741–753. (doi:10.1210/ me.2012-1292) Davies SM, Poljak A, Duncan MW, Smythe GA & Murphy MP 2001 Measurements of protein carbonyls, orthoand meta-tyrosine and oxidative phosphorylation complex activity in mitochondria from young and old rats. Free Radical Biology and Medicine 31 181–190. (doi:10.1016/S0891-5849(01)00576-7) Duckles SP, Krause DN, Stirone C & Procaccio V 2006 Estrogen and mitochondria: a new paradigm for vascular protection? Molecular Interventions 6 26–35. (doi:10.1124/mi.6.1.6) Fernández-Pérez L, Guerra B, Díaz-Chico JC & Flores-Morales A 2013 Estrogens regulate the hepatic effects of growth hormone, a hormonal interplay with multiple fates. Frontiers in Endocrinology 3 66. (doi:10.3389/fendo.2013.00066) Fujioka H, Moghaddas S, Murdock GD, Lesnefsky JE, Tandler B & Hoppel LC 2011 Decreased cytochrome c oxidase subunit VIIa in aged rat heart mitochondria: immunocytochemistry. Anatomical Record 294 1825–1833. (doi:10.1002/ar.21486) Gibson GE, Park LC, Sheu KF, Blass JP & Calingasan NY 2000 The alpha-ketoglutarate dehydrogenase complex in neurodegeneration. Neurochemistry International 36 97–112. (doi:10.1016/S0197- 0186(99)00114-X) Giguere V, Tremblay A & Tremblay GB 1998 Estrogen receptor beta: re-evaluation of estrogen and antiestrogen signaling. Steroids 63 335–339. (doi:10.1016/S0039-128X(98)00024-5) Hall MJ, Couse FJ & Korach SK 2001 The multifaceted mechanisms of estradiol and estrogen receptor signaling. Journal of Biological Chemistry 276 36869–36872. (doi:10.1074/jbc.R100029200) Hausladen A & Fridovich I 1994 Superoxide and peroxynitrite inactivate aconitases, but nitric oxide does not. Journal of Biological Chemistry 269 29405–29408. Hoer PB, Devine PJ, Hu X, Thompson KE & Sipes IG 2001 Ovarian toxicity of 4-vinylcyclohexene diepoxide: a mechanistic model. Toxicologic Pathology 29 91–99. (doi:10.1080/019262301301418892) Hofer T, Servais S, Seo AY, Marzetti E, Hiona A, Upadhyay SJ, Wohlgemuth SE & Leewenburgh C 2009 Bioenergetics and permeability transition pore opening in heart subsarcolemmal and interfibrillar mitochondria: effects of aging and lifelong calorie restriction. Mechanisms of Ageing and Development 130 297–307. (doi:10.1016/j.mad.2009.01.004) Hsieh YC, Yu HP, Suzuki T, Choudhry MA, Schwacha MG, Bland KI & Chaudry IH 2006 Upregulation of mitochondrial respiratory complex IV by estrogen receptore-(beta) is critical for inhibiting mitochondrial apoptotic signaling and restoring cardiac functions following trauma- hemorrhage. Journal of Molecular and Cellular Cardiology 41 511–521. (doi:10.1016/j.yjmcc.2006.06.001) Huang T, Liu R, Fu X, Yao D, Yang M, Liu Q, Lu WW, Wu C & Guan M 2016 Aging reduces an ERRalpha-directed mitochondrial glutaminase expression suppressing glutamine anaplerosis and osteogenic differentiation of mesenchymal stem cells. Stem Cells [in press]. (doi:10.1002/stem.2470) Hunter CJ, Machijas MA & Korzick HD 2012 Age dependent reductions in mitochondrial respiration are exacerbated by calcium in the female heart. Gender Medicine 9 197–206. (doi:10.1016/j. genm.2012.04.001) Irwin RW, Yao J, Hamilton RT, Cadenas E, Brinton RD & Nilsen J 2008 Progesterone and estrogen regulate oxidative metabolism in brain mitochondria. Endocrinology 149 3167–3175. (doi:10.1210/ en.2007-1227) Irwin RW, Syeda SS, Hamilton RT, Cardenas E & Brinton RD 2011 Medroxyprogesterone acetate antagonizes estrogen up-regulation of brain mitochondrial function. Endocrinology 152 556–567. (doi:10.1210/en.2010-1061) Janssen JW & Helbing AR 1991 Arsenazo III: an improvement of the routine calcium determination in serum. European Journal of Clinical Chemistry and Clinical Biochemistry 29 197–201. Kerrigan JR & Rogol AD 1992 The impact of gonadal steroid hormone action on growth hormone secretion during childhood and adolescence. Endocrine Reviews 13 281–298. (doi:10.1210/er.13.2.281) Khalid AB & Krum SA 2016 Estrogen receptors alpha and beta in bone. Bone 87 130–135. (doi:10.1016/j.bone.2016.03.016) Khan D & Ansar Ahmed S 2016 The immune system is a natural target for estrogen action: opposing effects of estrogen in two prototypical autoimmune diseases. Frontiers in Immunology 3 73–93. (doi:10.3389/ fimmu.2015.00635) Klinge MC 2008 Estrogenic control of mitochondrial function and biogenesis. Journal of Cellular Biochemistry 105 1342–1351. (doi:10.1002/jcb.21936) Knowlton AA & Lee RA 2012 Estrogen and the cardiovascular system. Pharmacology and Therapeutics 135 54–70. (doi:10.1016/j. pharmthera.2012.03.007) Koss WA, Lloyd MM, Sadowski RN, Wise LM & Juraska JM 2015 Gonadectomy before puberty increases the number of neurons and glia in the medial prefrontal cortex of female, but not male, rats. Developmental Psychobiology 57 305–312. (doi:10.1002/ dev.21290) Kovats S 2012 Estrogen receptors regulate an inflammatory pathway of dendritic cell differentiation: mechanisms and implications for immunity. Hormones and Behavior 62 254–262. (doi:10.1016/j. yhbeh.2012.04.011) Kovats S 2015 Estrogen receptors regulate innate immune cells and signaling pathways. Cellular Immunology 294 63–69. (doi:10.1016/j. cellimm.2015.01.018) Li S, Li S, Hydery T, Juan Y, Lin WY, Kogan B, Mannikarottu A, Leggett RE, Schule C & Levin RM 2009 The effect of 2- and 4-week ovariectomy on female rabbit urinary bladder function. Urology 74 691–696. (doi:10.1016/j.urology.2009.02.068) Martin E, Rosenthal RE & Fiskum G 2005 Pyruvate dehydrogenase complex: metabolic link to ischemic brain injury and target ofoxidative stress. Journal of Neuroscience Research 79 240–247. (doi:10.1002/jnr.20293) Matthews J & Gustafsson A-J 2003 Estrogen signaling: a subtle balance between ERα and ERβ. Molecular Interventions 3 281–292. (doi:10.1124/mi.3.5.281) Mattingly KA, Ivanova MM, Riggs KA, Wickramasinghe NS, Barch MJ & Klinge CM 2008 Estradiol stimulates transcription of Nuclear Respiratory Factor-1 and increases mitochondrial biogenesis. Molecular Endocrinology 22 609–622. (doi:10.1210/ me.2007-0029) Mauvais-Jarvis F, Clegg DJ & Henever AL 2013 The role of estrogens in control of energy balance and glucose homeostasis. Endocrine Reviews 34 309–338. (doi:10.1210/er.2012-1055) Mayer LP, Pearsall NA, Christian PJ, Devine PJ, Payne CM, McCuskey MK, Marion SL, Sipes IG & Hoyer PB 2002 Long-term effects of ovarian follicular depletion in rats by 4-vinylcyclohexene diepoxide. Reproductive Toxicology 16 775–781. (doi:10.1016/S0890- 6238(02)00048-5) Mendoza-Garcés L, Mendoza-Rodríguez CA, Jiménez-Trejo F, Picazo O, Rodríguez MC & Cerbón M 2011 Differential expression of estrogen receptors in two hippocampal regions during the estrous cycle of the rat. Anatomical Record 294 1913–1919. (doi:10.1002/ar.21247) Research 234Oophorectomy affects oxidative phosphorylation DOI: 10.1530/JOE-16-0161 Jo u rn a l o f E n d o cr in o lo g y N PAVÓN, A CABRERA-OREFICE and others http://joe.endocrinology-journals.org © 2017 Society for Endocrinology Printed in Great Britain Published by Bioscientifica Ltd. 232:2 Muller FL, Liu Y & Van Remmen H 2004 Complex III releases superoxide to both sides of the inner mitochondrial membrane. Journal of Biological Chemistry 279 49064–49073. (doi:10.1074/jbc.M407715200) Nadal-Casellas A, Proenza AM, Liadó I & Gianotti M 2011 Effects of ovariectomy and 17β-estradiol replacement on rat brown adipose tissue mitochondrial function. Steroids 76 1051–1056. (doi:10.1016/j. steroids.2011.04.009) Nilsen J & Diaz Brinton R 2003 Mechanism of estrogen-mediated neuroprotection: regulation of mitochondrial calcium and Bcl-2 expression. PNAS 100 2842–2847. (doi:10.1073/pnas.0438041100) Noguchi S, Nakatsuka M, Asagiri K, Habara T, Takate M, Konishi H & Kudo T 2002 Bisphenol A stimulates NO synthesis through a non-genomic estrogen receptor-mediated mechanism in mouse endothelial cells. Toxicology Letters 303 29–34. (doi:10.1016/S0378- 4274(02)00252-7) Nuedling S, Kahlert S, Loebbert K, Meyer R, Vetter H & Grohe C 1999 Differential effects of 17β-estradiol on mitogen-activated protein kinase pathways in rat cardiomyocytes. Federation of European Biochemical Societies Letters 454 271–276. (doi:10.1016/S0014- 5793(99)00816-9) O’Donnell E, Floras SJ & Harvey PJ 2014 Estrogen status and the renin angiotensin aldosterone system. American Journal of Physiology: Regulatory, Integrative and Comparative Physiology 307 R498–R500. (doi:10.1152/ajpregu.00182.2014) Ojeda NB, Grigore D, Robertson EB & Alexandder BT 2007 Estrogen protects against increased blood pressure in postpubertal female growth restricted offspring. Hypertension 50 679–685. (doi:10.1161/ HYPERTENSIONAHA.107.091785) Ong BS & Hausenloy JD 2010 Mitochondrial morphology and cardiovascular disease. Cardiovascular Research 88 16–29. (doi:10.1093/cvr/cvq237) Orshal MJ & Khalil R 2004 Gender, sex hormones and vascular tone. American Journal of Physiology: Regulatory, Integrative and Comparative Physiology 286 R233–R249. (doi:10.1152/ajpregu.00338.2003) Palmer JW, Tandler B & Hoppel CL 1977 Biochemical properties of subsarcolemmal and interfibrillar mitochondria isolated from rat cardiac muscle. Journal of Biological Chemistry 252 8731–8739. Pavón N, Martínez-Abundis E, Hernández L, Gallardo-Pérez JC, Alvarez-Delgado C, Cerbón M, Pérez-Torres I, Aranda A & Chávez E 2012 Sexual hormones: effects on cardiac and mitochondrial activity after ischemia-reperfusion in adult rats. Gender difference. Journal of Steroid Biochemistry and Molecular Biology 132 135–146. (doi:10.1016/j. jsbmb.2012.05.003) Pedram A, Razandi M, Wallace CD & Levin RE 2006 Functional estrogen receptors in the mitochondria of breast cancer cells. Molecular Biology of the Cell 17 2125–2137. (doi:10.1091/mbc.E05-11-1013) Pérez-Torres I, Roque P, El Hafidi M, Diaz-Diaz E & Baños G 2009 Association of renal damage and oxidative stress in a rat model of metabolic syndrome. Influence of gender. Free Radical Research 43 761–771. (doi:10.1080/10715760903045296) Pfeilschifter J, Koditz R, Pfohl M & Schatz H 2002 Changes in proinflammatory cytokine activity after menopause. Endocrine Reviews 23 90–119. (doi:10.1210/edrv.23.1.0456) Psarra AM & Sekeris CE 2008 Steroid and thyroid hormone receptors in mitochondria. International Union of Biochemistry and Molecular Biology Life 60 210–223. (doi:10.1002/iub.37) Rosario GX, D’Souza SJ, Manjramkar DD, Parmar V, Puri CP & Sachvedra G 2008 Endometrial modifications during earl pregnancy in bonnet monkeys (Macaca radiata). Reproduction Fertility and Development 20 281–294. (doi:10.1071/RD07152) Sánchez-Caballero L, Guerrero-Castillo S & Nijtmans L 2016 Unraveling the complexity of mitocondrial complex I assembly: a dynamic process. Biochimica et Biophysica Acta 1857 980–990. (doi:10.1016/j. bbabio.2016.03.031) Sandberg K & Ji H 2012 Sex differences in primary hypertension. Biology of Sex Differences 3 7. (doi:10.1186/2042-6410-3-7) Schägger H 2001 Respiratory chain supercomplexes. International Union of Biochemistry and Molecular Biology Life 52 119–128. (doi:10.1080/15216540152845911) Schägger H & Pfeiffer K 2001 The ratio of oxidative phosphorylation complexes I-V in bovine heart mitochondria and the composition of respiratory chain supercomplexes. Journal of Biological Chemistry 276 37861–37867. Schwarzer M, Schrepper A, Amorim PA, Osterholt M & Doenst T 2013 Pressure overload differentially affects respiratory capacity in interfibrillar and subsarcolemmal mitochondria. American Journal of Physiology: Heart and Circulatory Physiology 304 H529–H537. (doi:10.1152/ajpheart.00699.2012) Sherwin BB 1999 Can estrogen keep your smart? Evidence from clinical studies. Journal of Psychiatry and Neuroscience 24 315–321. Sinha YN Wicker MA, Salocks CB & Vanderlaan WP 1979 Gonadal regulation of prolactin and growth hormone secretion in the mouse. Biology of Reproduction 21 473–481. (doi:10.1095/ biolreprod21.3.763-s) Sites CK, Toth MJ, Cushman M, L’Hommedieu GD, Tchernof A, Tracy RP & Poehlman ET 2002 Menopause-related differences in inflammation markers and their relationship to body fat distribution and insulin- stimulated glucose disposal. Fertility and Sterility 77 128–135. (doi:10.1016/S0015-0282(01)02934-X) Smith EP, Boyd J, Frank G, Takahashi H, Cohen RM, Specker B, Williams TC, Lubahn DB & Korach KS 1994 Estrogen resistance caused by a mutation in the estrogen-receptor gene in a man. New England Journal of Medicine 331 1056–1061. (doi:10.1056/ NEJM199410203311604) Starkov AA, Fiskum G, Chinopoulos C, Lorenzo BJ, Browne SE, Patel MS & Beal MF 2004 Mitochondrial alpha-ketoglutarate dehydrogenase complex generates reactive oxygen species. Journal of Neuroscience 24 7779–7788. (doi:10.1523/JNEUROSCI.1899-04.2004) Stevenson JC 2000 Cardiovascular effects of estrogens. Journal of Steroid Biochemistry and Molecular Biology 74 387–393. (doi:10.1016/S0960- 0760(00)00117-5) Stirone C, Duckles SP, Krause DN & Procaccion V 2005 Estrogen increases mitochondrial efficiency and reduces oxidative stress in cerebral blood vessels. Molecular Pharmacology 68 959–965. (doi:10.1124/ mol.105.014662) Sugden PH & Clerk A 1998 Stress-responsive mitogen-activated protein kinases (c-Jun N-terminal kinases and p38 mitogen-activated protein kinases) in the myocardium. Circulation Research 83 345–352. (doi:10.1161/01.RES.83.4.345) Suh JH, Health SH & Hagen TM 2003 Two subpopulations of mitochondria in the aging rat heart display heterogenous levels of oxidative stress. Free Radical Biology and Medicine 35 1064–1072. (doi:10.1016/S0891-5849(03)00468-4) Sullivan JC 2008 Sex and the renin-angiotensin system: inequality between the sexes in response to RAS stimulation and inhibition. American Journal of Physiology: Regulatory, Integrative and Comparative Physiology 294 R1220–R1226. (doi:10.1152/ajpregu.00864.2007) Thomas DK, Storlien LH, Bellingham WP & Gillette K 1986 Ovarian hormone effects on activity, glucoregulation and thyroid hormone in the rat. Physiology and Behavior 36 567–573. (doi:10.1016/0031- 9384(86)90332-X) Too CK, Giles A & Wilkinson M 1999 Estrogen stimulates expression of adenine nucleotide translocator ANT1 messenger RNA in female rat hearts. Molecular and Cellular Endocrinology 25 161–167. (doi:10.1016/ S0303-7207(99)00002-7) Toth MJ, Sites CK & Matthews DE 2006 Role of ovarian hormones in the regulation of protein metabolism in women: effects of menopausal status and hormone replacement therapy. American Journal of Physiology: Endocrinology and Metabolism 291 E639–E646. (doi:10.1152/ajpendo.00050.2006) Vasudevan N, Davidovka G, Zhu YS, Koibuchi N, Chin WW & Ptaff D 2001 Differential interaction of estrogen receptor and thyroid 235Research N PAVÓN, A CABRERA-OREFICE and others Oophorectomy affects oxidative phosphorylation DOI: 10.1530/JOE-16-0161 Jo u rn a l o f E n d o cr in o lo g y http://joe.endocrinology-journals.org © 2017 Society for Endocrinology Printed in Great Britain Published by Bioscientifica Ltd. 232:2 Received in final form 15 November 2016 Accepted 21 November 2016 Accepted Preprint published online 21 November 2016 hormone receptor isoforms on the rat oxytocin receptor promoter leads to differences in transcriptional regulation. Neuroendocrinology 74 309–324. (doi:10.1159/000054698) Wang J, Green PS & Simpkins JW 2001 Estradiol protects against ATP depletion, mitochondrial membrane potential decline and the generation of reactive oxygen species induced by 3-nitropropionic acid in SK-N-SH human neuroblastoma cells. Journal of Neurochemistry 77 804–811. (doi:10.1046/j.1471- 4159.2001.00271.x) Whayne TF Jr & Mukherjee D 2015 Women, the menopause, hormone replacement therapy and coronary heart disease. Current Opinion in Cardiology 30 432–438. (doi:10.1097/HCO.0000000000000157) Wittig I, Karas M & Schägger H 2007 High resolution clear native electrophoresis for in-gel functional assays and fluorescence studies of membrane protein complexes. Molecular and Cellular Proteomics 6 1215–1225. (doi:10.1074/mcp.M700076-MCP200) Wohlgemuth SE, Calvani R & Marzetti E 2014 The interplay between autophagy and mitochondrial dysfunction in oxidative stress- induced cardiac aging and pathology. Journal of Molecular and Cellular Cardiology 71 62–70. (doi:10.1016/j.yjmcc.2014.03.007) Yang HS, Sarkar NS, Liu R, Pérez JE, Wang X, Wen Y, Yan JL & Simpkins WJ 2009 Estrogen receptor β as a mitochondrial vulnerability factor. Journal of Biological Chemistry 284 9540–9548. (doi:10.1074/jbc.M808246200) Zerbetto E, Vergani L & Dabbeni-Sala F 1997 Quantification of muscle mitochondrial oxidative phosphorylation enzymes via histochemical staining of blue native polyacrylamide gels. Electrophoresis 18 2059–2064. (doi:10.1002/elps.1150181131) Zhai P, Eurell TE, Cotthaus R, Jeffery EH, Bahr JM & Gross DR 2000 Effect of estrogen on global myocardial ischemia-reperfusion injury in female rats. American Journal of Physiology: Heart and Circulatory Physiology 279 H2766–H2775. FEMS Pathogens and Disease, 74, 2016, ftv111 doi: 10.1093/femspd/ftv111 Advance Access Publication Date: 25 November 2015 Research Article RESEARCH ARTICLE Staphylococcus epidermidis: metabolic adaptation and biofilm formation in response to different oxygen concentrations Cristina Uribe-Alvarez1, Natalia Chiquete-Félix1, Martha Contreras-Zentella2, Sergio Guerrero-Castillo3, Antonio Peña1 and Salvador Uribe-Carvajal1,∗ 1Department of Molecular Genetics, Instituto de Fisiologı́a Celular, Universidad Nacional Autónoma de México, 04510, México DF, México, 2Department of Cellular and Developmental Biology, Instituto de Fisiologı́a Celular, Universidad Nacional Autónoma de México, 04510, México DF, México and 3Nijmegen Center for Mitochondrial Disorders, Radboud University Medical Center, 6525 GA Nijmegen, the Netherlands ∗Corresponding author: Department of Molecular Genetics, Instituto de Fisiologı́a Celular, Cdad Universitaria, Apdo Postal 70-472, Coyoacán, 04510 México, México. Tel: +5255-56225632; Fax: +5255-56225630; E-mail: suribe@ifc.unam.mx One sentence summary: Biofilm formation by Staphylococcus epidermidis is enhanced in anaerobic conditions. Many enzymes are expressed as oxygen becomes low, which can be considered as possible therapeutic targets. Editor: Tom Coenye ABSTRACT Staphylococcus epidermidis has become a major health hazard. It is necessary to study its metabolism and hopefully uncover therapeutic targets. Cultivating S. epidermidis at increasing oxygen concentration [O2] enhanced growth, while inhibiting biofilm formation. Respiratory oxidoreductases were differentially expressed, probably to prevent reactive oxygen species formation. Under aerobiosis, S. epidermidis expressed high oxidoreductase activities, including glycerol-3-phosphate dehydrogenase, pyruvate dehydrogenase, ethanol dehydrogenase and succinate dehydrogenase, as well as cytochromes bo and aa3; while little tendency to form biofilms was observed. Under microaerobiosis, pyruvate dehydrogenase and ethanol dehydrogenase decreased while glycerol-3-phosphate dehydrogenase and succinate dehydrogenase nearly disappeared; cytochrome bo was present; anaerobic nitrate reductase activity was observed; biofilm formation increased slightly. Under anaerobiosis, biofilms grew; low ethanol dehydrogenase, pyruvate dehydrogenase and cytochrome bo were still present; nitrate dehydrogenase was the main terminal electron acceptor. KCN inhibited the aerobic respiratory chain and increased biofilm formation. In contrast, methylamine inhibited both nitrate reductase and biofilm formation. The correlation between the expression and/or activity or redox enzymes and biofilm-formation activities suggests that these are possible therapeutic targets to erradicate S. epidermidis. Keywords: Staphylococcus epidermidis; biofilms; anaerobiosis; pathogenicity; therapeutic target; opportunistic Received: 11 September 2015; Accepted: 23 November 2015 C© FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com 1 b y g u est o n Ju n e 2 2 , 2 0 1 6 h ttp ://fem sp d .o x fo rd jo u rn als.o rg / D o w n lo ad ed fro m 2 FEMS Pathogens and Disease, 2016, Vol. 74, No. 1 INTRODUCTION Staphylococcus epidermidis is a coagulase-negative saprophytic in- habitant of the outer skin layers where it excludes pathogenic bacteria such as S. aureus (Otto 2009; Cogen et al. 2010). Regret- fully, when S. epidermidis is introduced into tissues by needle punctures or surgical wounds, it becomes amajor health hazard as it forms biofilms on catheters or prosthesis forcing their re- moval (Gristina 1987; Raad, Alrahwan and Rolston 1998). Among coagulase-negative staphylococci-caused prosthetic valve infec- tive endocarditis, S. epidermidis is found in 82% cases (Mack et al. 2013). Also in 30%–43% implant perioperative infections (Zim- merli, Trampuz and Ochsner 2004) and in 50%–70% catheter- related infections (von Eiff, Peters and Heilmann 2002). In spite of its growing importance as a human pathogen, the metabolism of S. epidermidis has not been fully character- ized. Also, the signals that promote biofilm formation are poorly understood, although it is known that stress triggers the ex- pression of proteins that bind cells together and enhance resis- tance to antiseptics, antibiotics and host defenses (Cramton et al. 2001; Vuong and Otto 2002; Kostakioti, Hadjifrangiskou and Hultgren 2013). To optimize treatment, S. epidermidismetabolism and biofilm-forming activity have to be understood (Vuong and Otto 2002). Staphylococcus epidermidis is a facultative anaerobe, i.e. it can survive in awide range of [O2]. This bacterium thrives on human skin, where [O2] ranges from 2% to 5% (Peyssonnaux et al. 2008) and also in ischemic/anoxic tumors and abscesses where [O2] is zero (Atkuri et al. 2007; Wiese et al. 2012). Staphylococcus epider- midis biofilm-forming activity increases as [O2] decreases (Cram- ton et al. 1999, 2001; Cotter, O’Gara and Casey 2009; Cotter et al. 2009). Indeed, production of biofilm-associated molecules such as the cell adhesion-promoting, extracellular polysaccharide β-1,6-linked glucosaminoglycan is enhanced at low [O2] (Cram- ton et al. 1999). Anaerobic growth increases biofilm formation in both S. aureus and S. epidermidis (Cramton et al. 2001; Fuchs et al. 2007; Cotter et al. 2009). Bacteria contain branched respiratory chains with multiple terminal oxidases that work at different [O2] (Anraku 1988). These alternative pathways allow survival in adverse and chang- ing environments (Nakano et al. 1997; Mukhopadhyay et al. 2002; Gandhi and Chikindas 2007; Desriac et al. 2013). In this regard, the closely related S. aureusmodifies its respiratory chain as [O2] varies (Taber and Morrison 1964; Artzatbanov and Petrov 1990; Fuchs et al. 2007; Gotz andMayer 2013; Hammer et al. 2013). Thus, it was hypothesized that the adaptation of both the response to [O2] and the propensity to form biofilms are related. The emerg- ing pathological importance of S. epidermidis led us to analyze its oxidative phosphorylation machinery as well as the generation of biofilms when grown under aerobic, microaerobic or anaer- obic conditions. Such knowledge may uncover different thera- peutic targets as it has in other research efforts (Gordon et al. 2010; Hurdle et al. 2011; Kim et al. 2013). MATERIALS AND METHODS Materials Brij 58, Ethylenediaminetetraacetic acid (EDTA), glycerol-3- phosphate, glycerol, horse heart cytochrome c, methyl-viologen, lead (II) nitrate, NAD+, NADH, ATP, n-dodecyl β-D-maltoside, ni- trotetrazolium blue chloride (NBT), phenylmethylsulfonyl uo- ride (PMSF), sodium deoxycholate, sodium dithionite, sodium dodecyl sulfate, GramStain Kit and trizma basewere fromSigma Co (St Louis, MO). Ethanol, magnesium sulfate, potassium ni- trate, potassium cyanide, potassium carbonate, potassium hy- droxide, sodium phosphate, sodium bicarbonate and succinic acid were from JT Baker (Center Valley, PA). TSB medium, 3,3′- Diaminobenzidine tetrahydrochloride hydrate (DAB) and digi- tonin were from Fluka (Taufenkirchen, Germany). Ammonium persulfate, acrylamide and Bis N,N´-Methylene-bis-acrylamide were from BioRad (Richmond, CA). Imidazol and ξ-amino- caproic were from MP (Santa Ana, CA). Glucose and ammonium sulfate were from Merck (Kenilworth, NJ); Tryptone was from Difco (Sparks, MD); yeast extract was from Bioxon; and PCRMas- ter mix (2X) was from Thermo Scientific (Whaltham, MA). Bacterial strain and growth Staphylococcus epidermidis ATCC 12228 was donated by Dr Juan Carlos Cancino Dı́az (Instituto Politécnico Nacional). Bacteria were grown in LB medium at 27◦C under aerobic (Ae) conditions under shaking (250 rpm) unless otherwise specified; under mi- croaerobic (µA) conditions (5% CO2 atmosphere, static); and un- der anaerobic (An) conditions generated with GazPak EZ anaer- obe pouch in a sealed acrylic chamber (static). Pre-cultures were grown in TSB for 24 h at 37◦C, 250 rpm. A 1:15 dilution in LB wasmade in a sterile 100-well TrueLine Honeycomb Cell Culture Plate and grown at 27◦C. Absorbance at 600 nm was measured every 3 h in a Bioscreen C spectrophotometer (Growth Curves, USA). To induce cytochrome bd expression, S. epidermidis was grown in G-medium (Hanson, Srinivasan and Halvorson 1963) with 0.8% casein hydrolysate, 0.32% L-Glutamic acid, 0.21% D-L alanine and 0.12% asparagine under µA for 48 h (Escamilla et al. 1987). DNA extraction, mutS and yqiL amplification DNA extraction was performed with a Quick-gDNA MiniPrep from Zymo Research. mutS and yqiL genes were amplified by PCR using a PCR Master Mix (Life technologies) containing Taq polymerase. Oligonucleotides used to amplifiy a mismatch re- pair protein mutS were as follows: mutS− F3 (GATATAAGAATAAGGGTTGTGAA and mutS− R3 GTAATCGTCTCAGTTATCATGTT) which amplified a 412-bp fragment (Thomas et al. 2007). Acetyl coenzyme A acetyltransferase yqiL oligonucleotides were as fol- lows: yqi L − F2 (CACGCATAGTATTAGCTGAAG) and yqi L − R2 (CTAATGCCTTCATCTTGAGAAATAA) which amplified a 416-bp fragment (Wang et al. 2003). Both PCR assays involved an initial denaturation at 94◦C for 5 min, 35 cy- cles of 94◦C for 1 minute, 55◦C for 40 s and 72◦C for 40 s; and a final extension of 72◦C for 5 min. PCR amplification products were subjected to electrophoresis in 1% agarose gels and ethid- ium bromide staining. Biofilm detection Staphylococcus epidermidis pre-cultures and cultures were per- formed as indicated previously. After incubation in 300 µL for b y g u est o n Ju n e 2 2 , 2 0 1 6 h ttp ://fem sp d .o x fo rd jo u rn als.o rg / D o w n lo ad ed fro m Uribe-Alvarez et al. 3 6, 12, 24 or 30 h in Costar 96 well plates, each well was gen- tly washed three times with 200 µL phosphate-buffered saline (PBS), dried and stained with 1% crystal violet for 15 min. Plates were rinsed with PBS three more times, and bound crystal vio- let was solubilized in 200 µL ethanol-acetone (80:20 v/v). Optical density at 600 nm (OD600) was determined in a Polar Star Omega (BMG Labtech) microplate reader (Okajima et al. 2006). To eval- uate the effect of different respiratory chain inhibitors, cyanide or methylamine was added to the microplate at the beginning of the assay. Bovine heart mitochondria Beef heart mitochondria (BHM) obtained as in Löw and Vallin (1963) were a gift from Dr Marietta Tuena (IFC, UNAM). These were used as activity standards for different mitochondrial res- piratory enzymes and for ATPase (Wittig, Braun and Schagger 2006; Wittig, Karas and Schagger 2007). Cell membrane isolation All procedures were conducted at 4◦C. Cells were centrifuged at 10 000 × g for 10 min and washed with isolation buffer (50 mM Tris-HCl pH 7.4). The pellet was suspended in isolation buffer plus 1mM EDTA and 1 mM PMSF. Cells were disrupted by five passages through a French Press at 4000 psi (SLM Aminco). The suspension was centrifuged at 10 000 × g for 20 min to remove unbroken cells; the supernatant was centrifuged at 200 000 × g for 90min (Niebisch andBott 2003). Themembrane pelletwas re- suspended and homogenized in isolation buffer plus 1mMPMSF. Protein was quantified by Bradford, frozen at −70◦C and stored until further use. Spectral analysis of cytochromes Cell membranes from 24-h cultures grown in LB media at 27◦C were suspended in 50 mM Tris-HCl buffer (pH 7.4) plus 30% (v/v) glycerol, frozen with liquid nitrogen in 2 mm light path cuvettes and analyzed in an Olis DW2000 spectrophotometer. Differen- tial spectra from 400 to 700 nm were obtained from dithionite- reducedminus persulfate-oxidized and dithionite+CO-reduced minus dithionite-reduced membranes. Nitrate reductase activity Cells grown under Ae, µA or An conditions were sonicated three times 30 s with 10 s rests and centrifuged at 10 000 × g for 10 min to remove unbroken cells. Methyl-viologen oxidation by ni- trate reductase of the cytosolicmembrane extracts was recorded at 546 nm in an Aminco-Olis DW 2000 spectrophotometer. Sam- ples (10µg protein)were assayed in 50mMpotassiumphosphate (pH 7) with 0.2 mM methyl viologen previously reduced with 2.9 mM sodium dithionite. The reaction was started with 5 mM potassiumnitrate (Kern and Simon 2009). Specific activitieswere calculated using an extinction coefficient of 19.5 mM−1 cm−1. When indicated, methylamine was added at the beginning of the assay (Franco, Cárdenas and Fernández 1984; McCarty and Bremner 1992). Electrophoretic techniques and in-gel activities Clear native gel electrophoresis (CN-PAGE) was performed ac- cording to Wittig and Schagger (2005) and Wittig, Karas and Schagger (2007). Isolated membranes from S. epidermidis and BHM were solubilized with 1% Brij 58 and 0.5 mg lauryl malto- side/mg protein respectively and shaken for 1 h at 4◦C. Mem- branes were centrifuged at 100 000 × g at 4◦C for 30 min. Su- pernatants protein concentration was determined by Bradford and 0.1–0.3 mg protein per well was loaded on 4–12% polyacry- lamide gradient gels.When clear native electrophoresiswas per- formed, 0.01% Lauryl maltoside and 0.05% sodium deoxycholate were added to the cathode buffer as in Wittig, Karas and Schag- ger (2007). Gels were run for an hour at 15 mA/gel in a Bio-rad electrophoresis chamber. In-gel NADH:NBT oxidoreductase activity (120 µg protein for S. epidermidis and 20 µg protein for BHM) was determined by in- cubating the native gels in 10 mM Tris (pH 7.0), 0.5 mg nitrote- trazolium blue chloride (NBT)/mL and 1 mM NADH. In-gel suc- cinate:NBT oxidoreductase activity (120 µg protein for S. epider- midis and 100 µg protein for BHM) was determined by incubating the native gels in 10 mM Tris (pH 7.0), 0.5 mg nitrotetrazolium blue chloride (NBT)/mL and 1 mM succinate. In-gel cytochrome c oxidase activity (150 µg protein for S. epidermidis and 20 µg pro- tein for BHM) was determined using diaminobenzidine (Wittig, Karas and Schagger 2007). In-gel ATPase activity (200 µg S. epi- dermidis protein and 100 µg BHM protein) was measured by in- cubating the CN-gel in 35 mM Tris with 270 mM glycine (pH 8.4) for an hour, then 0.2% Pb(NO3)2, 14 mM MgSO4 and 8 mM ATP were added (Wittig, Karas and Schagger 2007). Glycerol-3-phosphate dehydrogenase activity Activity was measured in lysates from cells grown in different [O2] in fresh 33 mM ammonium sulfate, 100 mM carbonate- bicarbonate buffer, 1 mMNAD+ (pH 7.0) and 100 mM of glycerol- 3-phosphate as substrate. Final solution was adjusted to pH 9.0 with KOH or HCl. Absorbance change for NADH was measured at 340 nm and specific activities were calculated (Burton 1955; Van Eys, Nuenke and Patterson 1959). Mass spectrometry From the CN-PAGE gel, the indicated bands were excised and in-gel digested with trypsin. Peptides were analyzed by liquid chromatography tandem mass spectrometry (LC-MS/MS) a in a Q-exactive mass spectrometer (Thermo Fisher Scientific) equipped at the front end with a nano-ow high-performance liquid chromatography system Agilent1200s (Wessels et al. 2013). Peptides were separated in a 100 µm ID PicoTip emitter column filled with 3 µm C18 reverse phase silica beads using 30 min linear gradients of 5%–35% acetonitrile with 0.1% formic acid. The mass spectrometer operated in a Top 20 dependent, positive ion mode switching automatically between MS and MS/MS. Full scan MS mode (400–1400 m z−1) was operated at a resolution of 70 000 with automatic gain control target of 1 × 106 ions and a maximum ion transfer of 20 ms. Raw files were analyzed by MaxQuant software (version 1.5). Spectra were searched against the S. epidermidis database with additional sequences of known contaminants and reverse decoy with a strict FDR of 0.01. Trypsin was selected as the protease with two missed cleavages allowed. Dynamic modifications included N-terminal acetylation and oxidation of methionine. Cystein carbamidomethylation was set as fixed modification. Oxymetry Staphylococcus epidermidis grown under Ae, µA or An condi- tions were resuspended in 10 mM Hepes pH 7.4. Protein b y g u est o n Ju n e 2 2 , 2 0 1 6 h ttp ://fem sp d .o x fo rd jo u rn als.o rg / D o w n lo ad ed fro m 4 FEMS Pathogens and Disease, 2016, Vol. 74, No. 1 Figure 1. Characterization of S. epidermidis ATCC 12228. (A) Gram stain was performed using a kit from Sigma diagnostics HT90-A. Image shows Gram-positive cocci in clusters, diplococci and cocci. (B) Staphylococcus epidermidis-specific gene amplification. 1: 1kb plus marker, Invitrogen. 2: PCR product of DNA mismatch repair protein oligonucleotides (mutS) of 412 pb C. Staphylococcus epidermidis specific gene amplification. 1: 1kb plus marker, Invitrogen. 2: PCR product of Acetyl coenzyme A acetyltransferase (yqiL) of 416 pb. concentration was determined by Biuret in a Beckman Coulter spectrophotometer at 540 nm. Oxygen consumption by cells was assessed in an oxygenmetermodel 782 (Warner/Strathkelvin In- struments) with a Clark type electrode in a 1 mL water-jacketed chamber at 30◦C. Approximately 5 mg mL−1 of cells were added to the chamber. Reaction was started by the addition of 10 µM of ethanol (Guerrero-Castillo et al. 2009). Data were analyzed using the 782 Oxygen System Software (Warner/Strathkelvin Instru- ments). Different concentrations of cyanide were used as a res- piratory chain inhibitor in order to block oxygen consumption. Statistics Results are expressed as mean ± standard deviation from at least four individual experiments to which Tukey´s test was ap- plied. Significance levels and number of experiments were spec- ified under each figure. RESULTS Staphylococcus epidermidis adaptability to different [O2] is illus- trated by the plasticity of the respiratory chain and the varia- tions in biofilm formation. Under the microscope, S. epidermidis ATCC 12228 colonies formed typical clusters (Fig. 1A). The iden- tity of S. epidermidis ATCC 12228 was confirmed by amplifying DNA oligonucleotides from the mismatch repair protein (mutS) (Fig. 1B, first gel) and from acetyl coenzyme A acetyltransferase (yqiL) (Fig. 1B, second gel). (Wang et al. 2003; Thomas et al. 2007) Bacterial growth and biofilm formation at different [O2]. The adaptability of S. epidermidis to different [O2] was analyzed in cul- tures under atmospheric oxygen, with (Ae) or without agitation, under µA or under An conditions (Fig. 2A). In the absence of ag- itation, at all [O2] tested, cells grew to a similar density reaching the stationary phase at 24–27 h. In contrast, under agitation at atmospheric [O2] (Ae) the stationary phase was reached within half the time (Fig. 2A). Even though S. epidermidis ATCC 12228 is considered a low- virulence, low-biofilm forming strain, we were able to detect biofilm formation (Fazly Bazzaz et al. 2014). In this strain, biofilm- generation decreased as [O2] increased (Fig. 2B). In Ae cells with agitation, biofilms were hardly detectable and they increased slightly in cells subjected to Ae-without shaking. Biofilms were large in µA and An samples (Fig. 2B). Thus, in S. epidermidis in- creasing [O2] stimulated growth while inhibiting biofilm forma- tion. i.e. at low oxygen concentration, biofilm formation was high, suggesting that low [O2] contributes to bacterial virulence (Gristina 1987; Raad, Alrahwan and Rolston 1998). Detection of Oxidative Phosphorylation-related proteins in S. epi- dermidis grown at different [O2]. The adaptive response of S. epider- midis to different [O2] implies handling [O2] and phosphorylat- ing ADP. Thus, we evaluated the composition of the respiratory chain and the expression of F1F0-ATPase. Solubilized plasma membranes from Ae, µA or An cells were subjected to clear native PAGE, and protein bands were revealed by Coomassie blue staining (Fig. 3A). These samples were used to measure in-gel NADH dehydrogenase (Fig. 3B), succinate dehydrogenase (Fig. 3C) and ATPase (Fig. 3D) activities. In all cases, BHM were used as a positive control (Fig. 3 BHM lanes). BHM bands were la- beled according to the migration and activity patterns reported for each complex (I, V, III, IV and II) (Fig. 3A BHM) (Schagger and von Jagow 1991; Wittig, Braun and Schagger 2006; Wittig, Karas and Schagger 2007). I for NADH dehydrogenase activity from complex I, V for ATPase activity of complex V and II for succinate dehydrogenase activity of complex II. Bands corresponding to b y g u est o n Ju n e 2 2 , 2 0 1 6 h ttp ://fem sp d .o x fo rd jo u rn als.o rg / D o w n lo ad ed fro m Uribe-Alvarez et al. 5 Figure 2. Staphylococcus epidermidis growth and biofilm formation under differ- ent aeration conditions. (A) Growth curves of S. epidermidis at 27oC at aerobic (atmosphere oxygen level) with and without shaking, microaerobic (5% CO2) and anaerobic environment. Absorption at 600 nm was measured in a Bio- screen C spectrophotometer. Data shown are mean ± S.D. from n = 18. (B) Staphylococcus epidermidis biofilm formation at 6, 12, 24 or 30 h. Solubilized crystal violet was measured at 600 nm using a Polar Star Omega (BMG Labtech) microplate reader. Tukey´s comparison test showed significant difference (∗P < 0.05) between biofilm formation in microaerobic and anaerobic conditions between 6 and 24 and 30 h. After 6 h, a significant biofilm formation difference (∗P < 0.05) was found between aerobic conditions with and without shaking and microaerobic and anaerobic conditions. No difference was observed between oxygen-limited conditions at all times, n = 6. BHMrespiratory complexes III and IV are also indicated although no complex III or IV activities were detected in S. epidermidis (re- sult not shown). Staphylococcus epidermidis cells grown at differ- ent [O2] exhibited different protein bands (Fig. 3A, S. epidermidis lanes) that were further analyzed for oxidoreductase andATPase activities. NADHdehydrogenase in-gel activity (Fig. 3B) in BHMcomplex I was detected at 1000 kDa NADH dehydrogenase activity band (Fig. 3B, BHM band I) (Wittig, Braun and Schagger 2006; Wittig, Karas and Schagger 2007). For S. epidermidis grown in Ae, four NADH dehydrogenase activity bands of lower molecular weight were observed (Fig. 3B lane S. epidermidis Ae). In µA or An cells, these bands were either not observed (N1) or were much lighter (N2, N3 and N4) (Fig. 3B, lanes S. epidermidis Ae, µA and An). Complex II succinate dehydrogenase activity from BHM was detected as a single 130 kDa band (Fig. 3C, BHM, band II) (Wittig, Braun and Schagger 2006). In S. epidermidis, one succinate dehy- drogenase activity band was detected in Ae grown cells and was practically lost under O2-limiting conditions (Fig. 3A and C, lanes S. epidermidis Ae, µA and An). Cytochrome c oxidase in-gel activity was detected in BHM membranes as a single band (results not shown) corresponding to complex IV,MW200 kDa (Wittig, Braun and Schagger 2006). No oxidase activity was detected in S. epidermidis even when adding up to 300 µg of protein (results not shown). Thus, in agree- ment with others (Taber and Morrison 1964), it is concluded that cytochrome c oxidase is not present in S. epidermidis. The ATPase activity assay revealed a strong band in the BHM sample (Fig. 3D, BHM, band V). Staphylococcus epidermidis Ae ex- hibited two ATPase activity bands (Fig. 3D, Ae, bands A1 and A2 while µA and An revealed only one band (Fig. 3D µA and An bands). Taken together, the above data indicate that in S. epi- dermidis oxidative-phosphorylation-related activities increased in cells grown at higher [O2]. Identification of in-gel activity bands by mass spectroscopy: Bands exhibiting the tested oxidoreductase or ATPase activities (Fig. 3), i.e. bands N1, N2, N3, N4, S1 and A1 were identified by LC- MS/MS and were matched against all S. epidermidis protein en- tries of the NCBI database (Table 1). Band N1 sequencing re- vealed, among other proteins, an aerobic glycerol-3-phosphate dehydrogenase, a NADH dehydrogenase-like protein (SE 0635) and a glycine decarboxylase complex. Band N2 contained the pyruvate dehydrogenase complex (PDC), constituted by Figure 3. Staphylococcus epidermidis membrane protein electrophoretic analysis. Oxidoreductase in-gel activities from S. epidermidis membranes grown in different [O2] were evaluated. BHM was solubilized with Lauryl maltoside. Staphylococcus epidermidis membranes were obtained from cultures grown under: (Ae) aerobic condi- tions, (µA) microaerobic conditions, (An) anaerobic conditions. (A) Solubilisates were resolved by CN-PAGE in a 4%–12% polyacrylamide gradient gel and stained with Coomasie. (B) In-gel NADH-NBT activity: BHM revealed complex I band (I) and S. epidermidis aerobic grown membranes revealed four bands labeled as N1, N2, N3 and N4. (C) In-gel Succinate-NBT activity: BHM band II corresponds to complex II. Band S1 of S. epidermidiswas present only in aerobic growth conditions. (D) In-gel ATPase activity: BHM Band V corresponds to complex V. S. epidermidis ATPase activity was labeled as bands A1 and A2. b y g u est o n Ju n e 2 2 , 2 0 1 6 h ttp ://fem sp d .o x fo rd jo u rn als.o rg / D o w n lo ad ed fro m 6 FEMS Pathogens and Disease, 2016, Vol. 74, No. 1 Table 1. Analyzed proteins by LC/MS-MS protein sequencing from a Coomassie stained CN-PAGE gel. Band Protein name or BLAST homology NCBI database number Peptides MW (kDa) PEP N1 Aerobic glycerol-3-phosphate dehydrogenase (S. epidermidis ATCC 12228) gi|81842889 27 62.3 4.62−211 NADH dehydrogenase-like protein SE 0635 gi|695605246 3 43.86 2.02−10 Glycine decarboxylase subunit 1 gi|81674491 6 49.96 5.8−48 Glycine decarboxylase subunit 2 gi|81674492 4 56.4 5.72−11 N2 Dihydrolipoamide dehydrogenase (E3) gi|721492590 21 49.7 0 Pyruvate dehydrogenase E1 component subunit β gi|81674992 21 35.29 1.07−167 Pyruvate dehydrogenase E1 component subunit α gi|81674993 12 41.33 1.63−222 Dihydrolipoamide acetyltransferase component (E2) gi|694237422 10 46.22 1.08−52 Glycerol-3-phosphate dehydrogenase gi|81674534 19 36.12 6.54−36 Malate:quinone oxidoreductase gi|721493807 9 56.35 2.51−29 N3 Dihydrolipoamide dehydrogenase gi|721492590 21 49.7 0 NADH dehydrogenase-like protein SE 0635 gi|695605246 5 43.86 1.35−16 Lactate dehydrogenase, partial gi|520977789 3 32.54 5.04−11 N4 Alcohol dehydrogenase gi|721493754 13 37.8 9.40−225 Glyceraldehyde-3-phosphate dehydrogenase gi|81675183 7 36.2 3.96−57 Lactate dehydrogenase, partial gi|520977789 3 36.19 3.39−25 S1 Succinate dehydrogenase/fumarate reductase, avoprotein subunit gi|721492636 29 65.631 9.83−102 Succinate dehydrogenase gi|721492637 9 31.43 0 Putative succinate dehydrogenase, cytochrome b556 subunit gi|291319172 1 20.2 6.22−8 cytochrome aa3 quinol oxidase, subunit I (S. caprae) gi|242348990 10 75.38 1.37E−97 cytochrome aa3 quinol oxidase, subunit II (S. caprae) gi|242348991 7 42.7 6.04E−76 A1 ATP synthase subunit alfa gi|81170377 22 54.7 0 ATP synthase subunit beta gi|81170379 35 55.6 0 ATP synthase subunit delta gi|488441919 11 16.8 5.52−147 ATP synthase subunit gamma gi|81842668 10 31.94 2.68−97 ATP synthase F1, epsilon subunit gi|691218402 4 14.09 3.48−73 ATP synthase subunit b gi|81842667 3 19.47 1.07−26 pyruvate dehydrogenase, dihydrolipoamide acetyltranferase and dihydrolipoamide dehydrogenase, a glycerol-3-phosphate dehydrogenase, and a malate:quinone oxidoreductase; band N3 also contained enzymes from the PDC, a partial lactate de- hydrogenase (LDH) and the NADH dehydrogenase-like protein (SE 0635) found in the N1 band; in N4 proteins included alcohol dehydrogenase, glyceraldehyde-3-phosphate dehydrogenase, a partial LDH (Table 1). Aerobic glycerol-3-phosphate dehydroge- nase (SE 0979 MW = 62.3 kDa) from the N1 band is the one with highest number of peptides identified and the least er- ror. Previous work in isolating glycerol-3-phosphate dehydro- genase from Escherichia coli (Schryvers, Lohmeier and Weiner 1978) and data from the crystal structure (Yeh, Chinte and Du 2008) indicate that the aerobic glycerol-3-phosphate dehydro- genase works as a dimeric enzyme, so it is possible that in S. epidermidis glycerol-3-phosphate dehydrogenase is also a dimer that feeds electrons directly to the respiratory chain. NADH dehydrogenase-like protein (SE 0635 MW = 43.86 kDa identi- fied in bands N1 and N3 with a very low peptide count and a high posterior error (PEP) may be a type 2 NADH:quinone oxi- doreductase (NDH-2), which is a single 50 kDa subunit protein with FAD as a non-covalently bound cofactor (Schurig-Briccio et al. 2014). Bacterial complex I weighs 500–600 kDa depending on the bacterium under study (Young, Jaworowski and Poulis 1978; Young et al. 1982; Bergsma, Van Dongen and Konings 2008; Baradaran et al. 2013). The S. epidermidis genome shows no other NADH dehydrogenases (NC 004461.1). As reported for S. aureus (Schryvers, Lohmeier and Weiner 1978), bacterial respiratory complex I was absent in S. epidermidis. Unrelated to oxidore- ductase activity, we found glycine decarboxylase, a membrane- bound complex that catalyzes the oxidative decarboxylation of glycine. b y g u est o n Ju n e 2 2 , 2 0 1 6 h ttp ://fem sp d .o x fo rd jo u rn als.o rg / D o w n lo ad ed fro m Uribe-Alvarez et al. 7 Both N2 and N3 bands (Table 1) contain the PDC. PDC contains multiple copies of all three enzymatic components: pyruvate dehydrogenase E1 components α (Q8CPN3) and β (Q8CPN2) and dihydrolipoamide acetyltransferase E2 (Q8CTW0), and dihydrolipoamide dehydrogenase E3 (GenBank: KGY36148.1). The PDC decarboxylates pyruvate into acetyl-CoA that participates in the citric acid cycle and feeds the electron transport chain. Band N2 also revealed a malate:quinone oxidoreductase. The malate:quinone oxidoreductase com- plex oxidizes malate to oxaloacetate donating its electrons to quinone. This complex is absent in mammalians, which makes it a potential drug target. Bands N3 and N4 revealed the presence of an LDH. LDH from Lactobacillus casei is a dimeric 70 kDa enzyme (Padgaonkar and Nadkarni 1980). Finally, band N4 has an alcohol dehydrogenase, reported to be a dimeric enzyme of approximately 80 kDa (Hammes-Schiffer and Benkovic 2006). Band S1 sequence revealed a succinate dehydroge- nase/fumarate reductase avoprotein subunit (SE 0841, MW = 66 kDa). The much larger mass observed here suggests that we isolated the whole succinate dehydrogenase complex (SDC), including succinate dehydrogenase cytochrome b-558 (SE 0840, MW 23.67 kDa) and succinate dehydrogenase iron–sulfur pro- tein subunit (SE 0842, MW 31.4 kDa). The complex may also be interacting with other proteins. In Bacillus subtilis, the CN-PAGE in-gel activity band for succinate dehydrogenase is reported at 301 kDa because a complex with nitrate reductase may be formed (Sousa et al. 2013). In Wolinella succinogenes and in E. coli, the SDC is crystallized as a dimeric enzyme (Lancaster and Kroger 2000; Cecchini et al. 2002). Also, SDC might be in a complex with one or two small hydrophobic polypeptides that anchor the enzyme to the membrane and are required for electron transfer to quinone (Hederstedt 1980, 1986). In band S1, an additional cytochrome aa3 quinol oxidase was found. No activity was found when trying to measure in-gel activ- ities with cytochrome c as electron donor, which was expected as electrons are donned directly from ubiquinol to oxidases. The A1 bandwas F1F0-ATPase as confirmed by finding F1 sub- units alfa, beta, delta, gamma and epsilon, plus the F0 subunit b (Table 1). The number of bands detected may vary depend- ing on the detergent, although the Ae grown cells have stronger bands and probably more activity. Comparison with the litera- ture indicates that digitonin-solubilized B. subtilis membranes contained three ATPase activity bands at MW = 487, 277 and 187 kDa. (Sousa et al. 2013). Glycerol-3-phosphate dehydrogenase activity. Aerobic glycerol-3- phosphate dehydrogenasewas identified as themost prominent protein in band N1, and in-gel activities indicate that it is highly inhibited as [O2] decreases. Thus, we decided to test its activ- ity in extracts from S. epidermidis grown at different [O2] (Fig. 4). As expected, glycerol-3-phosphate dehydrogenase activity was much higher in Ae grown cells and decreased dramatically in under oxygen-limiting conditions (Fig. 4). The respiratory chain terminal oxidases from S. epidermidis are dif- ferentially expressed at different [O2]. In order to increase our un- derstanding of the adaptability of S. epidermidis to [O2], it was decided to analyze the terminal electron acceptors in the respi- ratory chain, considering that, while the different O2-dependent oxidases reduce O2, anaerobic respiratory chains contain en- zymes that use fumarate, nitrite, nitrate or DMSO as final elec- tron acceptors (Haddock and Jones 1977). Differential absorbance spectra of membrane extracts ob- tained at 77 K indicated that in the respiratory chain from S. epi- dermidis grown at different [O2], b-type cytochrome peaks were observed at 426–427 nm and 555–557 nm; a-type cytochromes Figure 4. Glycerol-3-phosphate dehydrogenase activities from S. epidermidis grown at different oxygen concentrations. NADH absorbance change was mea- sured at 340 nm and specific activities were calculated for extracts from Ae, µA and An cells. Glycerol-3-phoshate dehydrogenase activity was much higher in aerobic cell growth conditions than in oxygen-limited growth conditions. Tukey’s comparison test showed G-3-PDH activity difference between the aerobic and microaerobic grown cells and aerobic and anaerobic grown cells. Significance is ∗P < 0.05. were observed as a shoulder at 441–451 and peak at 604 nm. The absence of a peak at 630 nm in all samples is indicative of the lack of a d-type cytochrome. The absence of shoulders at 417 and 550 nm indicates the lack of c-cytochromes (Fig. 5). When [O2] was restricted, i.e. at µA or An, complete loss of a-type cy- tochromes (aa3) (shoulders at 441 and 451 nm and peak at 604 nm) and a decrease in b-type cytochromes were observed (peaks at 427 and 557 nm) (Fig. 5). The detection of a small amount of cy- tochrome b in the anaerobic sample is in contrast with a report where complete loss of cytochromes was observed in S. epider- midis grown in anaerobic conditions for 16 h (Jacobs and Conti 1965) and in agreement with Frerman and White (1967) where the presence of cytochromes b and o is reported. The lack of cy- tochrome c confirmed the absence of cytochrome oxidase and in turn, the lack of cytochromes d confirmed the absence of bd- cytochromes (Fig. 5) as has been reported by others (Taber and Morrison 1964). To further analyze the respiratory chain terminal oxidases from S. epidermidis grown at different [O2], CO-dithionite- reduced minus dithionite-reduced difference spectra were ob- tained from Ae or µA membranes (Fig. 6) These spectra have an absorbance maximum at 417 nm, and smaller peaks at 545 and 575 nm together with valleys at 430 and 554 nm which are in- dicative of presence of a CO complex with cytochrome o (Fig. 6). Thus, it may be concluded that cytochrome bo was present in both Ae and µA S. epidermidis (Frerman and White 1967) Although S. aureus and S. epidermidis have cydAB genes, cyt bd has not been found by spectroscopy (Taber and Morrison 1964; Jacobs and Conti 1965). This may be due to an insufficient ex- pression of cydAB genes. In all cases only b-type cytochromes were observed (Fig 6). In S. epidermidis cytochrome d was absent in µA cells (Fig. 6) or in those grown in the presence of KCN (re- sults not shown). Thus, in S. epidermidis both µA and Ae cells express o-type cytochromes, while an a-type cytochrome was expressed in Ae cells. Staphylococcus epidermidis grown under anaerobic conditions in- creases expression of nitrate reductase. Anaerobically grown S. epi- dermidis expresses nitrate reductase (Kucera, Dadak and Dobry 1983). In our hands, nitrate reductase activity in An was 0.215 ± 0.017 mmol(min.mg)−1 protein. Then, in µA it decreased to 0.085 ± 0.01 mmol(min.mg)−1 protein. In Ae cells, nitrate reduc- tase activity decreased further, to 0.015 ± 0.012mmol(min.mg)−1 protein, 14 times less than in An (Fig. 7). Thus, when under An, S. epidermidis expressed nitrate reductase to substitute oxygen with nitrate as a terminal electron acceptor. b y g u est o n Ju n e 2 2 , 2 0 1 6 h ttp ://fem sp d .o x fo rd jo u rn als.o rg / D o w n lo ad ed fro m 8 FEMS Pathogens and Disease, 2016, Vol. 74, No. 1 Figure 5. Difference spectra (dithionite-reduced minus persulfate-oxidized) of membranes from cells cultured under different [O2]: ( ) Ae, (- - -) µA, (– – –) An. Spectra were recorded at 77 K. Membrane protein from 24 h-grown cells in LB medium were adjusted to 15 mg/ml. b-type cytochromes can be observed at 426–427 nm and at 555–557 nm in all conditions, a-type cytochromes can be observed as a shoulder at 441–451 and peak at 604 nm in membranes obtained from aerobic grown cells. In all samples, c-cytochrome shoulders at 417 and 550 nm are absent as well as the d-type cytochrome peak at 630 nm. Figure 6. CO Difference spectra (CO + dithionite-reduced minus dithionite-reduced) of membranes from cells cultured under different conditions: ( ) Ae, (- - -) µA, (– – –) An. Spectra were recorded at 77 K. Membrane protein from 24 h grown cells in LB medium were adjusted to 15 mg/ml. A CO complex resembling that of cytochrome o with the Söret peak at 417 nm and peaks at 545 and 575 nm and troughs at 430 and 560–554 nm can be observed. In both conditions, there is a small peak at 592 nm with a shoulder at 445 indicating the presence of an a-type cytochrome. Cyanide inhibits oxygen consumption and promotes biofilm for- mation in S. epidermidis. After evaluating the respiratory chain electron acceptors available, we decided to test if mimicking an anaerobic environment by inhibiting the cytochromes aa3 and bo with cyanide would increase biofilm formation. Oxygen con- sumption in aerobic cells was completely inhibited with 200 µM of cyanide (Fig. 8A). Then biofilm formation was evaluated in the same concentrations of cyanide in cultures grown to 24 or 30 h. At 24 h biofilm formation promotion by cyanide was suggested but not clear. However, at 30 h we observed an increase in the biofilm formation as we exposed S. epidermidis to increasing con- centrations of cyanide reaching 0.50 ± 0.04 which is close to the b y g u est o n Ju n e 2 2 , 2 0 1 6 h ttp ://fem sp d .o x fo rd jo u rn als.o rg / D o w n lo ad ed fro m Uribe-Alvarez et al. 9 Figure 7. Nitrate reductase activity of S. epidermidis grown at different oxygen concentrations. Nitrate reductase activity was measured by means of methylvi- ologen oxidation, which was previously reduced by 2.9 mM of sodium dithion- ite. Reaction was monitored at 546 nm. Data shown are mean ± S.D. from n = 4. Tukey´s comparison test showed significant differences (∗P < 0.05) between all conditions. 0.59 ± 0.09 obtained in microaerobic conditions. At 24 h, no sig- nificant differences in biofilm formation were observed (Fig. 8B). Methylamine inhibits nitrate reductase activity and biofilm forma- tion in S. epidermidis ATCC 12228. Methylamine is reported to in- hibit nitrate reductase activity at 150 mM. We measured nitrate reductase of S. epidermidis grown in microaerobic conditions us- ing different concentrations of methylamine (Fig. 8C) and found that at 10 mM methylamine nitrate reductase activity was fully inhibited. Afterwards, biofilm formation was evaluated in cells grown in microaerobic conditions and in the presence of differ- ent methylamine concentrations and a decrease in biofilm for- mation was observed at (Fig. 8D). Microaerobic conditions were used and not anaerobic conditions, because under anaerobic conditions bacteria would be unable to grow (result not shown). This is explained by the lack of oxygen for cytochromes and the inhibition of nitrate reductase. As S. epidermidis gains pathogenic importance it becomes necessary to study its metabolic adaptations to different envi- ronmental conditions. Our results provide an image of the plas- ticity of the S. epidermidis respiratory chain. Branched respira- tory chains from pathogens may contain therapeutic targets. For instance, S. epidermidis expresses an MQO complex, a bo cy- tochrome and a nitrate reductase not found in mammals. Sev- eral known inhibitors of bo cytochrome (Meunier et al. 1995) and nitrate reductase (Magalon et al. 1998; Moreno-Vivian et al. 1999; Gates et al. 2003) might prevent S. epidermidis colonization of tis- sues or prosthetic devices. DISCUSSION O2 is the final electron acceptor in aerobic oxidative phosphory- lation,which is themain source of ATP. Bacteria sense substrates and environmental conditions adjusting theirmetabolism to op- timize ATP yields and minimize production of toxic O2 partial- reduction molecules known collectively as reactive oxygen Figure 8. Effect of cyanide or methylamine on S. epidermidis: rate of O2 consumption or biofilm formation. (A) KCN-mediated inhibition of O2 consumption by S. epidermidis grown under Ae conditions.. Data are mean ± SD from n = 4. (B) Biofilm formation by S. epidermidis cultures at 24 and 30 h in Ae and in the presence of KCN as in A. Significance (∗P < 0.01). (C) Inhibition of nitrate reductase activity by methylamine in µA- S. epidermidis. Data are mean ± SD from n = 4. (D) Biofilm formation in 24-h cultures grown in LB medium in µA conditions and in the presence of methylamine as in C. Significant difference (∗P < 0.01) between 0 and 0.5 mM methylamine at 24 h of growth, n = 6. For oxymetry, inhibitors were added directly to the reaction mixture, while in biofilm-forming assays these were present throughout the culture. b y g u est o n Ju n e 2 2 , 2 0 1 6 h ttp ://fem sp d .o x fo rd jo u rn als.o rg / D o w n lo ad ed fro m 10 FEMS Pathogens and Disease, 2016, Vol. 74, No. 1 species. Among these adaptations, most prokaryotes are able to differentially express the components in their highly branched respiratory chains developing different electron transport path- ways (Anraku 1988). Different terminal oxidases are expressed in response to the availability of electron acceptors in themedium, e.g. when O2 is available it is chosen as the preferred electron ac- ceptor (Unden and Bongaerts 1997). In anaerobic atmospheres, respiratory chains use other final electron acceptors such as ni- trate, nitrite, fumarate or DMSO, which upon reduction do not provide as much energy as O2 (Unden and Bongaerts 1997). In some unicellulars including Staphylococci, different [O2] may trigger biofilm formation (Xu et al. 1998; Gomez, Honto- ria and Gonzalez-Lopez 2002). Other factors affecting biofilm formation are temperature, osmolarity, pH and iron concen- trations (Otto 2008). Also hydrophobic surfaces provide an an- chor for bacterial association (Hall-Stoodley and Stoodley 2005). Biofilms protect cells against environmental hazards and are a source of pyogenic emboli. Staphylococcus epidermidis increases its biofilm-forming activity when grown under anaerobiosis, probably through the expression of exopolysaccharide PIA, te- ichoic acids and proteins needed for biofilm maturation (Otto 2008). Here, as [O2] was increased, biofilm formation was in- hibited. When respiratory enzymes that use oxygen as elec- tron acceptor were inhibited with cyanide (Fig. 8A) in an ef- fort to mimic anaerobic conditions, biofilm formation increased (Fig. 8B). In contrast, when nitrate reductase activity was inhib- ited bymethylamine (Fig. 8C) in a µA conditions and the cell was forced to use whatever O2 was available, biofilm formation was reduced (Fig. 8D). These data suggest that expression of differ- ent respiratory chains may be tightly related to the decision the cell makes to form biofilms. In Staphyloccocci, electrons ow from different dehydroge- nases to menaquinone (Gotz and Mayer 2013). Bacterial respi- ratory chains can contain different cytochrome c oxidases or quinol oxidases and oxidoreductases that are expressed de- pending on growth conditions. Cyt bo expression increases in non-fermentable sources and it decreases in fermentable sources (Escamilla et al. 1987); cytochrome bd has a high affin- ity for O2 and it is induced in microaerobic conditions, mean- while cytochrome bo has a lower oxygen affinity and is typi- cally induced in high [O2]; cytochrome aa3 is induced in high [O2] (Shepherd and Poole 2013). Staphylococcus aureus expresses cytochrome bo, cytochrome aa3 (qoxABCD) and possibly a cy- tochrome bd oxidase (CydAB) (Gotz and Mayer 2013), but only cytochromes o and a- have been detected by spectrophotom- etry (Taber and Morrison 1964). The gene cluster encoding cy- tochrome bo oxidase has not been identified so its existence is in doubt (Hammer et al. 2013). Staphylococci lack c-type cytochromes such as c-549 and c-554 (Faller, Götz and Schleifer 1980; Gotz and Mayer 2013). Using data reported here, we propose a model where the branched respiratory chain of S. epidermidis ismodified by growth at different [O2]. The enzymes under consideration include sol- uble enzymes (white circles) donating their electrons to NADH dehydrogenase type II, (NDH2) (green circle) which in turn do- nates electrons tomenaquinone (yellow circle); othermembrane dehydrogenases donating electrons to menaquinone (green cir- cles) and terminal electron acceptors, which may be O2 depen- dent (blue circles) or O2 independent (orange circle) (Fig. 9). In aerobic grown cells (Ae) (Fig. 9A), menaquinone receives elec- trons directly from a large number of membrane dehydroge- nases including glycerol-3-phosphate dehydrogenase, succinate dehydrogenase, themenaquinone oxidase complex, LDH and an NDH2, which in turn receives electrons from at least two solu- ble enzymes: alcohol dehydrogenase and the PDC. In mitochon- dria LDH and glycerol-3-phosphate dehydrogenase do not do- nate electrons to the respiratory chain, yet in bacteria they are membrane-bound enzymes transferring their electrons directly to ubiquinol (Barnes and Kaback 1970; Lascelles 1978; Doig et al. 1999; Modun and Williams 1999; Dym et al. 2000; Delgado et al. 2001; Fuller et al. 2011). From menaquinone, electrons are trans- ferred to one of two terminal O2-dependent oxidases, namely, cytochrome bo and cytochrome aa3. When [O2] decreases in the growth medium, the com- position of the S. epidermidis respiratory chain composition changes. In microaerobic grown cells (µA) (Fig. 9B), soluble en- zymes alcohol dehydrogenase and pyruvate dehydrogenase ac- tivities remain. Among membrane dehydrogenases, glycerol 3- phosphate dehydrogenase and succinate dehydrogenase be- come non-detectable, while NDH2, lactate DH and the MQO complex do not seem to change. Among the final electron- acceptors, cytochrome aa3 disappears, cytochrome bo decreases, and an O2-independent nitrate reductase is expressed at low levels (Fig. 9B). In anaerobic grown cells (An) (Fig. 9C), dehy- drogenases do not change, while cytochrome bo almost disap- pears. The most striking characteristic of the An cell was the high expression of nitrate reductase as the anaerobic final elec- tron acceptor of the respiratory chain. The lack of complexes III and IV is in agreement with the notion that in Staphylococci electrons ow from different dehydrogenases to menaquinone and from menaquinone to different quinol oxidases, e.g. S. epi- dermidis ATCC 12228 grown in aerobic conditions contains two main cytochromes: cyt bo and cyt aa3 and this is similar to the reported respiratory chain from S. aureus (Taber and Morrison 1964). The spectra we obtained suggest the presence of cy- tochromes aa3 and bo. However, the genome shown only one qoxABCD operon, and thus there are no genes for bo cy- tochromes. A possible explanation for our data may be that a promiscuous assembly of cytochrome c oxidase apo-proteins with hemes b and o occurred, where a bo cytochrome replaced heme aa3. Under specific culture conditions, bacterial oxidases may be assembled promiscuously accepting a different heme group to that present on its original structure. Examples of these substitutions have been described previously (Matsushita et al. 1992; Puustinen et al. 1992; Peschek et al. 1995; Sakamoto, Handa and Sone 1997; Azarkina et al. 1999; Contreras-Zentella et al. 2003). Even though we did not observe absorption bands char- acteristics of the cytochrome d at 630 nm, proteins that form the Cytochrome d ubiquinol oxidase are reported in the Uniprot databank (SE0785, SE 0784). The possibility that there is a simi- lar promiscuous substitution of heme groups has to be consid- ered. Previous reports on Pseudomonas aeruginosa that encodes a cyanide-insensitive oxidase (CioAB), which is homologous to the Cytochrome bd oxidase (CydAB) of E. coli, indicate that there is a substitution of b-type cytochromes instead of d-type cy- tochromes and this prevents the detection of an absorption peak at 630 nm (Cooper, Tavankar and Williams 2003). Furthermore, in Campylobacter jejuni the cydAB genes reported in the genome apparently encode a cyanide-resistant oxidase that does not have a d-type cytochrome (Jackson et al. 2007). The oxidoreduc- tases we proposed (Fig. 9) were sought in the Uniprot proteome database. We did find expression of proteins exhibiting each of the activities detected here (Table 2). In addition, we found in the proteome some oxidoreductases, namely Glycerol dehydro- genase (SE0235) and Cytochrome d ubiquinol oxidase-like pro- teins I (SE0784) and II (SE0785) that were not detected in our experiments. b y g u est o n Ju n e 2 2 , 2 0 1 6 h ttp ://fem sp d .o x fo rd jo u rn als.o rg / D o w n lo ad ed fro m Uribe-Alvarez et al. 11 Figure 9. Proposed models of the S. epidermidis respiratory chain in response to [O2] during growth. Color code: soluble enzymes (gray), membrane dehydrogenases (green); menaquinone (yellow); O2-dependent terminal electron acceptors (blue) or O2-independent acceptors (orange). (A) In aerobic (Ae) grown cells menaquinone receives electrons from glycerol-3-phosphate dehydrogenase, succinate dehydrogenase, the menaquinone oxidase complex, LDH or a NDH2, which receives electrons from at least two soluble enzymes: alcohol dehydrogenase and the PDC. From menaquinone, electrons are transferred to one of two terminal O2-dependent oxidases, namely, cytochrome bo and Cytochrome aa3. (B) In µA, soluble enzymes (alcohol dehydrogenase and pyruvate dehydrogenase) remain. Glycerol 3-phosphate dehydro- genase and succinate dehydrogenase become non-detectable, while NDH2, lactate DH and the MQO complex do not change. Cytochrome aa3 disappears, cytochrome bo decreases, and an O2-independent nitrate reductase is expressed at low levels. (C) In anaerobic (An) conditions, dehydrogenases do not change, cytochrome bo almost disappears and nitrate reductase is highly expressed. b y g u est o n Ju n e 2 2 , 2 0 1 6 h ttp ://fem sp d .o x fo rd jo u rn als.o rg / D o w n lo ad ed fro m 12 FEMS Pathogens and Disease, 2016, Vol. 74, No. 1 Table 2. Possible correspondence between oxidoreductase activities detected here and oxidoreductases found in the Uniprot proteome database. Oxidoreductases found in the proteome Detected here by LC-MS and/or enzymatic Uniprot Databank Accession database activities number Glycerol dehydrogenase No SE0235 Glyceraldehyde-3-phosphate dehydrogenase Yes SE0557, SE1361 NADH dehydrogenase Yes SE0635, SE2333 Alcohol dehydrogenase Yes SE0375 D,L-Lactate dehydrogenase Yes SE2074, SE2145 Succinate dehydrogenase Yes SE0841, SE0842 Succinate dehydrogenase cytochrome b-558 Yes SE0840 Glycerol-3-phosphate dehydrogenase Yes SE0979 Malate dehydrogenase Yes SE0461 Probable quinol oxidase Yes SE0756, SE0757, SE0758, SE0759 Cytochrome d ubiquinol oxidase like protein No SE0784, SE0785 Respiratory nitrate reductase Yes SE1972, SE1973, SE1974, SE1975 Non-pathogenic staphylococcal species such as the ATCC12228 encode a pyocyanin- and cyanide-insensitive cytochrome bd quinol oxidase, while pathogenic species, such as S. aureus encode a sensitive variant; yet, in our hands no bd cytochrome was found (Voggu et al. 2006). Even when S. epider- midis was grown in a non-fermentable carbon source medium in the presence of 1 mM of KCN cytochrome bdwas not present. The glycerol-3-phosphate dehydrogenase from S. epidermidis is more active than other bacteria used in biotechnology for glycerol degradation (Holmberg et al. 1990; Yazdani and Gonza- lez 2007; da Silva, Mack and Contiero 2009). The PDC enzymes we found on membranes are usually reported as cytoplasmic enzymes, but they were also found in the membrane fraction of Mycoplasma pneumonia (Dallo et al. 2002) and Rhodospirillum rubrum (Luderitz and Klemme 1977). Knowledge on how branched respiratory chains provide sur- vival capabilities to cells can help identify specific respiratory chain inhibitors that can be used as therapeutic targets in hu- man infections. Even though we are suggesting that the en- zymes that are expressed at low oxygen concentrations may be therapeutic targets, we do not know exactly how they act during biofilm maturation. Previous studies state that anaerobic condi- tions increase polysaccharide gene expression in staphylococci (Cramton et al. 2001). Interestingly, methylamine was an effec- tive inhibitor of the S. epidermidis nitrate reductase, the main final-electron acceptor present during microaerobic or anaero- bic growth, and by consequence reduced biofilm formation. The high adaptability of S. epidermidis plays an important role in its pathogenicity and this has to be analyzed thoroughly. Already, the large effects of [O2] on biofilm formation and on the respira- tory chain composition of S. epidermidis suggest preventive and therapeutic strategies against this bacterium. ACKNOWLEDGEMENTS RamónMéndez,Martha Calahorra andNorma Sánchez provided technical assistance for this project. FUNDING Partially funded by grants CONACYT 239487 and UNAM-DGAPA- PAPIIT IN204015 to SUC. CUA is a CONACYT fellow enrolled in the Biochemistry PhD program at UNAM. Conflict of interest. None declared. REFERENCES Anraku Y. Bacterial electron transport chains. Annu Rev Biochem 1988;57:101–32. Artzatbanov V, Petrov VV. Branched respiratory chain in aerobically grown Staphylococcus aureus—oxidation of ethanol by cells and protoplasts. Arch Microbiol 1990;153: 580–4. Atkuri KR, Herzenberg LA, Niemi AK, et al. Importance of cul- turing primary lymphocytes at physiological oxygen levels. P Natl Acad Sci USA 2007;104:4547–52. Azarkina N, Siletsky S, Borisov V, et al. A cytochrome bb’- type quinol oxidase in Bacillus subtilis strain 168. J Biol Chem 1999;274:32810–7. Baradaran R, Berrisford JM, Minhas GS, et al. Crystal struc- ture of the entire respiratory complex I. Nature 2013;494: 443–8. Barnes EM, Jr, Kaback HR. Beta-galactoside transport in bacterial membrane preparations: energy coupling via membrane- bounded D-lactic dehydrogenase. P Natl Acad Sci USA 1970;66:1190–8. Bergsma J, Van Dongen MB, Konings WN. Purification and char- acterization of NADH dehydrogenase from Bacillus subtilis. Eur J Biochem 1982;128:151–7. Burton RM. Glycerol dehydrogenase from Aerobacter aerogenes. In: Colowick SP, Kaplan NO (eds). Methods in Enzymology Vol. 1 in [59] pp. 397–400. NY: Academic Press, 1955. Cecchini G, Schroder I, Gunsalus RP, et al. Succinate dehydro- genase and fumarate reductase from Escherichia coli. Biochim Biophys Acta 2002;1553:140–57. Cogen AL, Yamasaki K, Sanchez KM, et al. Selective antimicrobial action is provided by phenol-soluble modulins derived from Staphylococcus epidermidis, a normal resident of the skin. J In- vest Dermatol 2010;130:192–200. Contreras-Zentella M, Mendoza G, Membrillo-Hernandez J, et al. A novel double heme substitution produces a func- tional bo3 variant of the quinol oxidase aa3 of Bacillus cereus. Purification and paratial characterization. J Biol Chem 2003;278:31473–8. Cooper M, Tavankar GR, Williams HD. Regulation of expression of the cyanide-insensitive terminal oxidase in Pseudomonas aeruginosa. Microbiology 2003;149:1275–84. Cotter JJ, O’Gara JP, Casey E. Rapid depletion of dissolved oxygen in 96-well microtiter plate Staphylococcus epidermidis biofilm assays promotes biofilm development and is inuenced b y g u est o n Ju n e 2 2 , 2 0 1 6 h ttp ://fem sp d .o x fo rd jo u rn als.o rg / D o w n lo ad ed fro m Uribe-Alvarez et al. 13 by inoculum cell concentration. Biotechnol Bioeng 2009;103: 1042–7. Cotter JJ, O’Gara JP, Mack D, et al. Oxygen-mediated regulation of biofilm development is controlled by the alternative sigma factor sigma(B) in Staphylococcus epidermidis. Appl Environ Mi- crob 2009;75:261–4. Cramton SE, Gerke C, Schnell NF, et al. The intercellular ad- hesion (ica) locus is present in Staphylococcus aureus and is required for biofilm formation. Infect Immun 1999;67: 5427–33. Cramton SE, Ulrich M, Gotz F, et al. Anaerobic conditions in- duce expression of polysaccharide intercellular adhesin in Staphylococcus aureus and Staphylococcus epidermidis. Infect Im- mun 2001;69:4079–85. da Silva GP, Mack M, Contiero J. Glycerol: a promising and abun- dant carbon source for industrialmicrobiology. Biotechnol Adv 2009;27:30–9. Dallo SF, Kannan TR, BlaylockMW, et al. Elongation factor Tu and E1 beta subunit of pyruvate dehydrogenase complex act as fibronectin binding proteins in Mycoplasma pneumoniae. Mol Microbiol 2002;46:1041–51. Delgado ML, O’Connor JE, Azorin I, et al. The glyceraldehyde-3- phosphate dehydrogenase polypeptides encoded by the Sac- charomyces cerevisiae TDH1, TDH2 and TDH3 genes are also cell wall proteins. Microbiology 2001;147:411–7. Desriac N, Broussolle V, Postollec F, et al. Bacillus cereus cell response upon exposure to acid environment: toward the identification of potential biomarkers. Front Microbiol 2013;4: 284. Doig P, de Jonge BL, Alm RA, et al. Helicobacter pylori physiology predicted from genomic comparison of two strains.Microbiol Mol Biol R 1999;63:675–707. Dym O, Pratt EA, Ho C, et al. The crystal structure of D-lactate dehydrogenase, a peripheral membrane respiratory enzyme. P Natl Acad Sci USA 2000;97:9413–8. Escamilla JE, Ramı́rez R, Del Arenal IP, et al. Expression of cy- tochrome oxidases in Bacillus cereus: effects of oxygen ten- sion and carbon source. J Gen Microbiol 1987;133:3549–55. Faller AH, Götz F, Schleifer KH. Cytochrome-patterns of Staphy- lococci and Micrococci and their taxonomic implications. Zentralblatt für Bakteriologie: I. Abt. Originale C: Allgemeine, angewandte und ökologische. Mikrobiologie 1980;1:26–39. Fazly Bazzaz BS, Jalalzadeh M, Sanati M, et al. Biofilm formation by Staphylococcus epidermidis on foldable and rigid intraocular lenses. Jundishapur J Microbiol 2014;7:e10020. Franco AR, Cárdenas J, Fernández E. Ammonium (methylam- monium) is the co-represor of nitrate reductase in Chlamy- domonas reinhardii. FEBS Lett 1984;176:453–6. Frerman FE, White DC. Membrane lipid changes during forma- tion of a functional electron transport system in Staphylococ- cus aureus. J Bacteriol 1967;94:1868–74. Fuchs S, Pane-Farre J, Kohler C, et al. Anaerobic gene expression in Staphylococcus aureus. J Bacteriol 2007;189:4275–89. Fuller JR, Vitko NP, Perkowski EF, et al. Identification of a lactate- quinone oxidoreductase in Staphylococcus aureus that is es- sential for virulence. Front Cell Infect Microbiol 2011;1:19. Gandhi M, Chikindas ML. Listeria: a foodborne pathogen that knows how to survive. Int J Food Microbiol 2007;113:1–15. Gates AJ, Hughes RO, Sharp SR, et al. Properties of the periplas- mic nitrate reductases from Paracoccus pantotrophus and Es- cherichia coli after growth in tungsten-supplemented media. FEMS Microbiol Lett 2003;220:261–9. Gomez MA, Hontoria E, Gonzalez-Lopez J. Effect of dissolved oxygen concentration on nitrate removal from groundwa- ter using a denitrifying submerged filter. J Hazard Mater 2002;90:267–78. Gordon O, Vig Slenters T, Brunetto PS, et al. Silver coordina- tion polymers for prevention of implant infection: thiol inter- action, impact on respiratory chain enzymes, and hydroxyl radical induction. Antimicrob Agents Ch 2010;54:4208–18. Gotz F, Mayer S. Both terminal oxidases contribute to fitness and virulence during organ-specific Staphylococcus aureus col- onization. MBio 2013;4:e00976–13. Gristina AG. Biomaterial-centered infection: microbial adhesion versus tissue integration. Science 1987;237:1588–95. Guerrero-Castillo S, Vazquez-Acevedo M, Gonzalez-Halphen D, et al. In Yarrowia lipolytica mitochondria, the alternative NADH dehydrogenase interacts specifically with the cy- tochrome complexes of the classic respiratory pathway. Biochim Biophys Acta 2009;1787:75–85. Haddock BA, Jones CW. Bacterial respiration. Bacteriol Rev 1977;41:47–99. Hall-Stoodley L, Stoodley P. Biofilm formation and dispersal and the transmission of human pathogens. Trends Microbiol 2005;13:7–10. Hammer ND, Reniere ML, Cassat JE, et al. Two heme-dependent terminal oxidases power Staphylococcus aureus organ-specific colonization of the vertebrate host. MBio 2013;4:8873–94. Hammes-Schiffer S, Benkovic SJ. Relating protein motion to catalysis. Annu Rev Biochem 2006;75:519–41. HansonRS, SrinivasanVR, HalvorsonHO. Biochemistry of sporu- lation. I. Metabolism of acetate by vegetative and sporulating cells. J Bacteriol 1963;85:451–60. Hederstedt L. Cytochrome b reducible by succinate in an isolated succinate dehydrogenase-cytochrome b complex from Bacil- lus subtilis membranes. J Bacteriol 1980;144:933–40. Hederstedt L. Molecular properties, genetics, and biosynthesis of Bacillus subtilis succinate dehydrogenase complex.Methods Enzymol 1986;126:399–414. Holmberg C, Beijer L, Rutberg B, et al.Glycerol catabolism in Bacil- lus subtilis: nucleotide sequence of the genes encoding glyc- erol kinase (glpK) and glycerol-3-phosphate dehydrogenase (glpD). J Gen Microbiol 1990;136:2367–75. Hurdle JG, O’Neill AJ, Chopra I, et al. Targeting bacterial mem- brane function: an underexploited mechanism for treating persistent infections. Nat Rev Microbiol 2011;9:62–75. Jackson RJ, Elvers KT, Lee LJ, et al.Oxygen reactivity of both respi- ratory oxidases in Campylobacter jejuni: the cydAB genes en- code a cyanide-resistant, low-affinity oxidase that is not of the cytochrome bd type. J Bacteriol 2007;189:1604–15. Jacobs NJ, Conti SF. Effect of hemin on the formation of the cy- tochrome system of anaerobically grown Staphylococcus epi- dermidis. J Bacteriol 1965;89:675–9. Kern M, Simon J. Periplasmic nitrate reduction in Wolinella suc- cinogenes: cytoplasmic NapF facilitates NapAmaturation and requires the menaquinol dehydrogenase NapH for mem- brane attachment. Microbiology 2009;155:2784–94. Kim JH, Haff RP, Faria NC, et al. Targeting the mitochon- drial respiratory chain of Cryptococcus through antifungal chemosensitization: amodel for control of non-fermentative pathogens. Molecules 2013;18:8873–94. Kostakioti M, Hadjifrangiskou M, Hultgren SJ. Bacterial biofilms: development, dispersal, and therapeutic strategies in the dawn of the postantibiotic era. Cold Spring Harb Perspect Med 2013;3:a010306. Kucera I, Dadak V, Dobry R. The distribution of redox equiva- lents in the anaerobic respiratory chain of Paracoccus deni- trificans. Eur J Biochem 1983;130:359–64. b y g u est o n Ju n e 2 2 , 2 0 1 6 h ttp ://fem sp d .o x fo rd jo u rn als.o rg / D o w n lo ad ed fro m 14 FEMS Pathogens and Disease, 2016, Vol. 74, No. 1 Lancaster CR, Kroger A. Succinate: quinone oxidoreductases: new insights from X-ray crystal structures. Biochim Biophys Acta 2000;1459:422–31. Lascelles J. sn-Glycerol-3-phosphate dehydrogenase and its in- teraction with nitrate reductase in wild-type and hem mutant strains of Staphylococcus aureus. J Bacteriol 1978;133:621–5. Löw H, Vallin I. Succinate-linked Diphosphopyridine nucleotide reduction in Submitochondrial particles. Biochim Biophys Acta 1963;69:361–74. Luderitz R, Klemme JH. Isolation and characterization of a membrane-bound pyruvate dehydrogenase complex from the phototrophic bacterium Rhodospirillum rubrum (author’s transl). Z Naturforsch C 1977;32:351–61. McCarty GW, Bremner JM. Inhibition of assimilatory nitrate reductase activity in soil by glutamine and ammonium analogs. P Natl Acad Sci USA 1992;89:5834–6. MackD, Davies AP, Harris LG, et al. Biomaterials associated infec- tion. In: FintanMoriarty SAJZT, Busscher HJ (eds). Immunolog- ical Aspects and Antimicrobial Strategies. Chapter 2. Staphylococ- cus Epidermidis in Biomaterial-Associated Infections. New York: Springer, 2013, 25–56. Magalon A, Rothery RA, Lemesle-Meunier D, et al. Inhibitor bind- ing within the NarI subunit (cytochrome bnr) of Escherichia coli nitrate reductase A. J Biol Chem 1998;273:10851–6. Matsushita K, Ebisuya H, Ameyama M, et al. Change of the ter- minal oxidase from cytochrome a1 in shaking cultures to cytochrome o in static cultures of Acetobacter aceti. J Bacteriol 1992;174:122–9. Meunier B, Madgwick SA, Reil E, et al. New inhibitors of the quinol oxidation sites of bacterial cytochromes bo and bd. Biochemistry 1995;34:1076–83. Modun B, Williams P. The staphylococcal transferrin-binding protein is a cell wall glyceraldehyde-3-phosphate dehydro- genase. Infect Immun 1999;67:1086–92. Moreno-Vivian C, Cabello P, Martinez-Luque M, et al. Prokary- otic nitrate reduction: molecular properties and functional distinction among bacterial nitrate reductases. J Bacteriol 1999;181:6573–84. Morgan DJ, Sazanov LA. Three-dimensional structure of respira- tory complex I from Escherichia coli in ice in the presence of nucleotides. Biochim Biophys Acta 2008;1777:711–8. Mukhopadhyay R, Rosen BP, Phung LT, et al. Microbial arsenic: from geocycles to genes and enzymes. FEMS Microbiol Rev 2002;26:311–25. Nakano MM, Dailly YP, Zuber P, et al. Characterization of anaer- obic fermentative growth of Bacillus subtilis: identification of fermentation end products and genes required for growth. J Bacteriol 1997;179:6749–55. Niebisch A, Bott M. Purification of a cytochrome bc-aa3 super- complex with quinol oxidase activity from Corynebacterium glutamicum. Identification of a fourth subunity of cytochrome aa3 oxidase and mutational analysis of diheme cytochrome c1. J Biol Chem 2003;278:4339–46. Okajima Y, Kobayakawa S, Tsuji A, et al. Biofilm formation by Staphylococcus epidermidis on intraocular lens material. Invest Ophthalmol Vis Sci 2006;47:2971–5. Otto M. Staphylococcal biofilms. Curr Top Microbiol Immunol 2008;322:207–28. Otto M. Staphylococcus epidermidis–the ‘accidental’ pathogen. Nat Rev Microbiol 2009;7:555–67. Padgaonkar VA, Nadkarni GB. Effect of heavywater on structure- function relationship of lactate dehydrogenase from Lacto- bacillus casei. Indian J Biochem Biophys 1980;17:272–5. Peschek GA, Alge D, Fromwald S, et al. Transient accumula- tion of heme O (cytochrome o) in the cytoplasmic mem- brane of semi-anaerobic Anacystis nidulans. Evidence for oxygenase-catalyzed heme O/A transformation. J Biol Chem 1995;270:27937–41. Peyssonnaux C, Boutin AT, Zinkernagel AS, et al. Critical role of HIF-1alpha in keratinocyte defense against bacterial infec- tion. J Invest Dermatol 2008;128:1964–8. Puustinen A, Morgan JE, Verkhovsky M, et al. The low-spin heme site of cytochrome o from Escherichia coli is promis- cuous with respect to heme type. Biochemistry 1992;31: 10363–9. Raad I, Alrahwan A, Rolston K. Staphylococcus epidermidis: emerg- ing resistance and need for alternative agents. Clin Infect Dis 1998;26:1182–7. Sakamoto J, Handa Y, Sone N. A novel cytochrome b(o/a)3- type oxidase from Bacillus stearothermophilus cat- alyzes cytochrome c-551 oxidation. J Biochem 1997;122: 764–71. Schagger H, von Jagow G. Blue native electrophoresis for isola- tion ofmembrane protein complexes in enzymatically active form. Anal Biochem 1991;199:223–31. Schryvers A, Lohmeier E, Weiner JH. Chemical and functional properties of the native and reconstituted forms of the membrane-bound, aerobic glycerol-3-phosphate dehydroge- nase of Escherichia coli. J Biol Chem 1978;253:783–8. Schurig-Briccio LA, Yano T, Rubin H, et al. Characterization of the type 2 NADH: menaquinone oxidoreductases from Staphylo- coccus aureus and the bactericidal action of phenothiazines. Biochim Biophys Acta 2014;1837:954–63. Shepherd M, Poole RK. Bacterial respiratory chains. In: Roberts GCK (ed.). Encyclopedia of Biophysics. European Biophysical Societies’ Association (EBSA). Berlin, Heidelberg: Springer- Verlag, 2013, DOI: 10.1007/978-3-642-16712-6. Sousa PM, Videira MA, Santos FA, et al. The bc:caa3 supercom- plexes from the Gram positive bacterium Bacillus subtilis res- piratory chain: a megacomplex organization? Arch Biochem Biophys 2013;537:153–60. Taber HW, Morrison M. Electron transport in Staphylococci. properties of a particle preparation from exponential phase Staphylococcus aureus. Arch Biochem Biophys 1964;105:367–79. Thomas JC, Vargas MR, Miragaia M, et al. Improved multilocus sequence typing scheme for Staphylococcus epidermidis. J Clin Microbiol 2007;45:616–9. Unden G, Bongaerts J. Alternative respiratory pathways of Escherichia coli: energetics and transcriptional regulation in response to electron acceptors. Biochim Biophys Acta 1997;1320:217–34. Van Eys J, Nuenke BJ, Patterson MK, Jr. The nonprotein com- ponent of alpha-glycerophosphate dehydrogenase. Physical and chemical properties of the crystalline rabbit muscle en- zyme. J Biol Chem 1959;234:2308–13. Voggu L, Schlag S, Biswas R, et al. Microevolution of cytochrome bd oxidase in Staphylococci and its implication in resistance to respiratory toxins released by Pseudomonas. J Bacteriol 2006;188:8079–86. von Eiff C, Peters G, Heilmann C. Pathogenesis of infections due to coagulase-negative staphylococci. Lancet Infect Dis 2002;2:677–85. Vuong C, Otto M. Staphylococcus epidermidis infections. Microbes Infect 2002;4:481–9. Wang XM, Noble L, Kreiswirth BN, et al. Evaluation of a multilo- cus sequence typing system for Staphylococcus epidermidis. J Med Microbiol 2003;52:989–98. b y g u est o n Ju n e 2 2 , 2 0 1 6 h ttp ://fem sp d .o x fo rd jo u rn als.o rg / D o w n lo ad ed fro m Uribe-Alvarez et al. 15 Wessels HJ, Vogel RO, Lightowlers RN, et al. Analysis of 953 hu- man proteins from amitochondrial HEK293 fraction by com- plexome profiling. PLoS One 2013;8:e68340. Wiese M, Gerlach RG, Popp I, et al. Hypoxia-mediated impair- ment of the mitochondrial respiratory chain inhibits the bactericidal activity of macrophages. Infect Immun 2012;80: 1455–66. Wittig I, Braun HP, Schagger H. Blue native PAGE. Nat Protoc 2006;1:418–28. Wittig I, Karas M, Schagger H. High resolution clear native elec- trophoresis for in-gel functional assays and uorescence studies of membrane protein complexes. Mol Cell Proteomics 2007;6:1215–25. Wittig I, Schagger H. Advantages and limitations of clear-native PAGE. Proteomics 2005;5:4338–46. Xu KD, Stewart PS, Xia F, et al. Spatial physiological heterogene- ity in Pseudomonas aeruginosa biofilm is determined by oxy- gen availability. Appl Environ Microb 1998;64:4035–9. Yazdani SS, Gonzalez R. Anaerobic fermentation of glycerol: a path to economic viability for the biofuels industry. Curr Opin Biotechnol 2007;18:213–9. Yeh JI, Chinte U, Du S. Structure of glycerol-3-phosphate dehy- drogenase, an essential monotopic membrane enzyme in- volved in respiration and metabolism. P Natl Acad Sci USA 2008;105:3280–5. Young IG, Jaworowski A, Poulis MI. Amplification of the respira- tory NADH dehydrogenase of Escherichia coli by gene cloning. Gene 1978;4:25–36. ZimmerliW, Trampuz A, Ochsner PE. Prosthetic-joint infections. N Engl J Med 2004;351:1645–54. b y g u est o n Ju n e 2 2 , 2 0 1 6 h ttp ://fem sp d .o x fo rd jo u rn als.o rg / D o w n lo ad ed fro m In Saccharomyces cerevisiae fructose-1,6-bisphosphate contributes to the Crabtree effect through closure of the mitochondrial unspecific channel Mónica Rosas-Lemus, Cristina Uribe-Alvarez, Natalia Chiquete-Félix, Salvador Uribe-Carvajal ⇑ Department of Molecular Genetics, Inst. de Fisiología Celular, Universidad Nacional Autónoma de México, Mexico a r t i c l e i n f o Article history: Received 25 March 2014 and in revised form 16 May 2014 Available online 9 June 2014 Keywords: Fructose-1,6-bisphosphate Glucose-6-phosphate Crabtree effect Mitochondria Saccharomyces cerevisiae Permeability transition a b s t r a c t In Saccharomyces cerevisiae addition of glucose inhibits oxygen consumption, i.e. S. cerevisiae is Crabtree-positive. During active glycolysis hexoses-phosphate accumulate, and probably interact with mitochondria. In an effort to understand the mechanism underlying the Crabtree effect, the effect of two glycolysis-derived hexoses-phosphate was tested on the S. cerevisiae mitochondrial unspecific chan- nel (ScMUC). Glucose-6-phosphate (G6P) promoted partial opening of ScMUC, which led to proton leakage and uncoupling which in turn resulted in, accelerated oxygen consumption. In contrast, fructose-1,6-bis- phosphate (F1,6BP) closed ScMUC and thus inhibited the rate of oxygen consumption. When added together, F1,6BP reverted the mild G6P-induced effects. F1,6BP is proposed to be an important modulator of ScMUC, whose closure contributes to the ‘‘Crabtree effect’’.  2014 Elsevier Inc. All rights reserved. Introduction In ‘‘Crabtree positive’’ yeast, the addition of glucose both increases glycolysis and inhibits the rate of oxygen consumption [1,2]. It has been proposed that glucose addition induces a rapid metabolic switch from a gluconeogenic/respiratory metabolism to a fermentative mode [3]. The Crabtree effect and the Warburg effect are different in that the Crabtree effect is immediate and reversible, while the Warburg effect is established at longer times, after the expression of different proteins that lead to its irrevers- ibility. Both phenomena have been observed in tumor cells [1]. The Crabtree effect is triggered by different metabolic signals [2,4,5]. Among these is the accumulation of the glycolytic interme- diaries glucose-6-phosphate (G6P)1 [6–10 mM], and fructose-1, 6-bisphosphate (F1,6BP) [5–10 mM] [6–8]. Glycolysis-derived accu- mulation of hexoses-phosphate complements other known signaling molecules such as fructose-2,6-biphosphate [9]. The Crabtree effect is observed in tumor cells [10,11], highly proliferating non-tumor cells [11], some yeast species [12] and some bacteria [13]. In regard to the mechanism underlying the Crabtree effect, a competition between glycolysis and oxidative phosphorylation for ADP or Pi has been proposed [14–16]. The mechanism underlying the Crabtree effect is still elusive, although inhibition of complex III and complex IV by F1,6BP has been reported [17]. Most Crabtree positive cells accumulate F1,6BP and G6P, which seem to modulate both glycolysis and oxidative phosphorylation [17–19]. Indeed, G6P and F6P activate the mitochondrial respira- tory complex III, while F1,6BP inhibits the activity of both complex III and IV [17]. In the yeast Saccharomyces cerevisiae, oxidative phosphorylation is strongly regulated by the mitochondrial unspecific channel (ScMUC) [20,21]. MUCs have been observed in animals, plants and yeast [22,23]. MUCs opening, known as the permeability tran- sition (PT), allows the passage of molecules up to 1.5 kDa [23–27], which results in mitochondrial swelling, transmembrane potential depletion and even rupture of the outer membrane [28]. It has been suggested that PT is physiological and reversible and that its main function is to eliminate cations or to partially uncouple the respiratory chain to prevent ROS overproduction [22,24,29–31]. ATP, low Pi and the rapid flow of electrons through the respiratory chain promote opening of ScMUC [20,32,33], while Pi, Ca2+ and Mg2+ close it [26]. In order to determine the mechanism by which G6P and F1,6BP control mitochondrial metabolism and whether these molecules contribute to the Crabtree effect, their effects of these hexoses- phosphate on ScMUC were tested. It was observed that G6P opens ScMUC while F1,6BP closes it. When added together, the F1,6BP effect dominated. We propose that the closing of the ScMUC by F1,6BP inhibits the rate of oxygen consumption in the resting state http://dx.doi.org/10.1016/j.abb.2014.05.027 0003-9861/ 2014 Elsevier Inc. All rights reserved. ⇑ Corresponding author. Fax: +52 55 5622 5630. E-mail address: suribe@ifc.unam.mx (S. Uribe-Carvajal). 1 Abbreviations used: ScMUC, S. cerevisiae mitochondrial unspecific channel; G6P, glucose-6-phosphate; F1,6BP, fructose-1,6-bisphosphate; PT, permeability transition; CCCP, carbonyl cyanide 3-chlorophenylhydrazone. Archives of Biochemistry and Biophysics 555–556 (2014) 66–70 Contents lists available at ScienceDirect Archives of Biochemistry and Biophysics journal homepage: www.elsevier .com/ locate /yabbi through the tight coupling of mitochondria, i.e. F1,6BP is a Crabtree effect promoter. Material and methods Materials All chemicals were of the highest purity commercially available. Fructose-1,6-bisphosphate, MES, mannitol, triethanolamine, safranine-O, trizma-base, dextrose, carbonyl cyanide 3-chloro- phenylhydrazone (CCCP) and glucose-6-phosphate, were from Sigma–Aldrich Co. (St. Louis, MO), (NH4)2SO4, D-lactic acid and eth- anol were from J.T. Baker S.A. de C.V. (Xalostoc, México), yeast extract and gelatin peptone were from Bioxon Dickinson, S.A. de C.V. (Cuautitlán Izcalli, México), KH2PO4, KCl, and phosphoric acid were from Química Suastes S.A. de C.V. (Tlahuac, México), BSA type V was from Research Organics (Cleveland, OH). Growth conditions An industrial strain of baker’s yeast ‘‘yeast foam’’ (YF) and the Kluyveromyces lactis strain 12/8 were used [34]. A 75 mL preculture in YPD (1% yeast extract, 2% gelatin peptone, 2% dextrose) was maintained for 8 h at 30 C under agitation at 250 rpm. Subse- quently, the pre-culture was added to 1L of YPLac (1% yeast extract, 1% gelatin peptone, 0.12% (NH4)2SO4, 0.1% KH2PO4 and 2% lactic acid, pH = 5.5) and incubated overnight. The cells were washed twice with distilled water by centrifugation in a F14 6x250y Sorvall rotor at 3800g for 5 min. Isolation of mitochondria Mitochondria were obtained by homogenization and differen- tial centrifugation [35]. Briefly, cells were suspended 50% w/v in mitochondrial buffer (0.6 M mannitol, 5 mM MES pH 6.8 TEA) plus 0.1% BSA and were homogenized in a Bead Beater using 0.5 mm glass beads [36]. The homogenate was centrifuged in a F21- 8x50y Sorvall rotor at 1017g for 5 min. Then the supernatant was recovered and centrifuged at 10,700g for 10 min. The pellet was suspended in mitochondrial buffer containing BSA, and centri- fuged at 3600g for 5 min. The supernatant was recovered and centrifuged at 17,000g for 10 min. The resulting pellet was sus- pended in a small volume of mitochondrial buffer (without BSA) and protein was determined by biuret [37]. Oxygen uptake The rate of oxygen consumption was measured in resting state (State IV), in phosphorylating conditions (State III) and in the pres- ence of the uncoupler CCCP (State U). We used a Strathkelvin Oximeter model 782 (Warner/Strathkelvin Instruments) with a Clark type electrode immersed in a 1 ml chamber with a water bath (PolyScience model 9000, USA) at 30 C. The reaction mixture was 0.6 M mannitol, 5 mM MES, pH 6.8 (TEA), 10 mM KCl and 2 ll/ml ethanol. Pi concentrations used are indicated in the legends of the figures and tables. Mitochondrial protein concentration was 0.25 mg/ml. Mitochondrial swelling The K+-mediated mitochondrial swelling was determined at room temperature. The reaction mixture was 0.3 M mannitol, 5 mMMES, pH 6.8 (TEA) and 2 ll/ml, ethanol. Swelling was started with 20 mM KCl as indicated. The absorbance changes were measured at 540 nm in a DW 2000 Aminco spectrophotometer in split mode equipped with a magnetic stirrer [38]. Transmembrane potential The DW was determined spectrophotometrically using a DW2000 Aminco spectrophotometer in dual mode. The reaction mixture was 0.6 M mannitol, 5 mM MES pH 6.8, 10 mM KCl, 2 ll/ml ethanol and 15 lM safranine-O. Absorbance changes were followed at 511–533 nm [39]. Results and discussion G6P increases, while F1,6BP inhibits the rate of oxygen con- sumption through direct inhibition of the cytochrome complexes III and IV [17]. However, a possible additional effect on ScMUC has not been explored. The opening of ScMUC accelerates oxygen consumption through uncoupling of oxidative phosphorylation [20,24,25,40]. By contrast, when ScMUC is closed, oxygen consump- tion decreases [41]. Therefore, it was decided to explore in isolated yeast mitochondria the effect of G6P and F1,6BP on the rate of oxy- gen consumption (Table 1). G6P was tested at concentrations of 2–20 mM in mitochondria where the ScMUC was fully open (0.1 mM Pi), partially open (1 mM Pi) or fully closed (4 mM Pi). When ScMUC was fully open, G6P had no effects (Results not shown). In mitochondria with partially closed ScMUC, G6P increased the rate of oxygen consumption in the resting state IV while the uncoupled state was mildly acceler- ated only at the highest concentrations tested. These effects led to a mild decrease in the U/IV quotient (Table 1). In the conditions where ScMUC was fully closed, only the highest concentrations of G6P resulted in a small increase in state IV respiration, while the uncoupled rate did not change significantly. Thus, a small decrease in the U/IV quotient was observed at the highest G6P concentra- tions tested (Table 1). In all cases, the effects of G6P on the phos- phorylating state III were similar to those observed in the uncoupled state (Result not shown). The results suggest that at the tested concentrations, G6P has a mild uncoupling effect. F1,6BP was tested at concentrations of 2–20 mM under condi- tions where ScMUC was fully open (0.1 mM Pi) or fully closed (4 mM Pi) (Table 2). In mitochondria with an open ScMUC, F1,6BP inhibited both state IV and the uncoupled state, increasing the U/IV from 1.0 in the totally uncoupled control to 2.0 at 6 mM. In mitochondria with a closed ScMUC, F1,6BP also decreased the rates of respiration both in state IV and in the uncoupled state. The U/IV remained constant up to 6 mM F1,6BP, and it decreased at 10 and 20 mM F1,6BP (Table 2). The decrease in the rate of oxygen con- sumption in state IV respiration and the increase in the U/IV quo- tient indicated that F1,6BP is a coupling agent. Thus, the oxygen consumption results (Tables 1 and 2) indicate that G6P and F1,6BP are ScMUC effectors, and that while the former is a mild uncoupler, the latter is an efficient coupling agent even at low concentrations. When ScMUC is open, mitochondria swell upon K+ addition. Thus, to further investigate whether G6P and F1,6BP modulate ScMUC, swelling was measured. As expected from the oxygen con- sumption results, G6P had no effect on the opening of ScMUC (Result not shown). However, in the presence of a partially closed ScMUC (1 mM Pi) a slight rate of swelling was observed which increased mildly at higher G6P concentrations (Fig. 1A). In mito- chondria where the ScMUC was closed, K+-mediated swelling was not observed and G6P did not have any effects (Fig. 1B). The data in Table 2 suggest that F1,6BP is a coupling agent. To determine whether this effect may be related to ScMUC, we added increasing concentrations of F1,6BP to mitochondria with open M. Rosas-Lemus et al. / Archives of Biochemistry and Biophysics 555–556 (2014) 66–70 67 ScMUC (0.1 mM Pi). In the absence of F1,6BP, mitochondrial swell- ing was large and rapid (Fig. 2A). Then, as the F1,6BP concentration increased, swelling decreased, becoming negligible at concentra- tions of 4 mM and above (Fig. 2A trace f). At 4 mM Pi, where ScMUC was closed, no swelling was detected neither in the control nor at any F1,6BP concentration (Fig 2B). Both oxygen consumption and mitochondrial swelling experiments indicate that F1,6BP promotes closure of ScMUC, leading to coupling of oxidative phosphorylation. The transmembrane potential decreases upon opening of ScMUC [25], and thus the effect of G6P and F1,6BP on this parameter was also tested. In mitochondria with partially closed ScMUC, G6P depleted the already-low transmembrane potential (Fig. 3A). Under conditions where ScMUC was closed, different concentra- tions of G6P decreased the transmembrane potential (Fig. 3B). When assaying F1,6BP effects on mitochondria with fully open ScMUC (Fig. 4A), the transmembrane potential increased with Table 1 Effect of G6P on the rate of oxygen consumption under conditions where the ScMUC is partially closed (1 mM Pi) or completely closed (Pi 4 mM). Pi G6P (mM) State IV natgO(min*mgprot)1 Uncoupled state natgO(min*mgprot)1 U/IV 1 mM (ScMUC partially closed) 0 132 ± 17.0 210 ± 19.8 1.6 2 138 ± 19.8 198 ± 36.8 1.4 4 150 ± 31.1 212 ± 39.6 1.4 6 160 ± 11.3 214 ± 14.1 1.3 10 194 ± 19.8 262 ± 14.1 1.3 20 234 ± 14.1 280 ± 11.3 1.2 4 mM (ScMUC closed) 0 162.9 ± 28.8 310.0 ± 45.4 1.9 2 170.8 ± 5.25 278.8 ± 32.9 1.6 4 196.7 ± 23.5 318.2 ± 23.6 1.6 6 212.0 ± 18.3 333.9 ± 21.6 1.6 10 208.7 ± 7.8 326.6 ± 11.0 1.6 20 231.2 ± 16.5 332.8 ± 40.7 1.4 Reaction mixture: 0.6 M mannitol, 5 mM MES pH 6.8 (TEA), 2 ll ethanol/mL, 10 mM KCl and Pi as indicated. Glucose-6-phosphate (G6P) as indicated. Mitochondria (250 lg prot./mL). The uncoupled state was generated using CCCP (1.5 lM). Table 2 Effect of F1,6BP on the rate of oxygen consumption under conditions where the ScMUC is opened (Pi 0.1 mM) or closed (Pi 4 mM). Pi F1,6BP (mM) State IV natgO(min*mg prot)1 Uncoupled state natgO(min*mg prot)1 U/IV 0.1 mM (ScMUC open) 0 328.4 ± 29.0 339.2 ± 24.0 1.0 2 167.6 ± 21.3 257.9 ± 46.0 1.5 4 143.3 ± 27.3 263.2 ± 25.0 1.8 6 129.4 ± 4.9 254.0 ± 43.0 2.0 10 142.2 ± 12.5 276.7 ± 66.0 1.9 20 140.6 ± 21.7 250.4 ± 46.0 1.8 4 mM (ScMUC closed) 0 240.7 ± 21.1 452.5 ± 40.3 1.9 2 214.2 ± 5.1 408.0 ± 48.5 1.9 4 229.0 ± 19.4 422.2 ± 57.9 1.8 6 208.3 ± 24.6 385.9 ± 8.8 1.8 10 194.1 ± 24.4 357.3 ± 56.0 1.8 20 192.7 ± 27.6 334.7 ± 28.3 1.7 Reaction mixture as in Table 1, except F1,6BP as indicated. Fig. 1. Effects of G6P on mitochondrial swelling. Reaction mixture: 0.3 M mannitol, 5 mM MES pH 6.8 (TEA), 2 lL ethanol/mL, mitochondria 250 lg prot./mL, and Pi as indicated. Swelling was measured spectrophotometrically at 540 nm. The arrow indicates the addition of 20 mM KCl. (A) Pi 1 mM. (B) Pi 4 mM. G6P (mM) was: a, 0; b, 2; c, 4; d, 6; e, 10; f, 20. Fig. 2. Effects of F1,6BP on mitochondrial swelling. Reaction mixture as in Fig 1 except (A) Pi 0.1 mM. (B) Pi 4 mM. At the arrow 20 mM KCl was added. G6P (mM) was: a, 0; b, 0.25; c, 0.5; d, 1; e, 2; f, 4. 68 M. Rosas-Lemus et al. / Archives of Biochemistry and Biophysics 555–556 (2014) 66–70 increasing F1,6BP concentrations, reaching the highest value at 10 mM (Fig. 4A, trace e) and 20 mM (Fig. 4A trace f). Under closed ScMUC conditions, a biphasic effect was observed, where a slight hyperpolarization was detected at 6 (Fig. 4B trace d) and 10 mM (Fig. 4B trace e) whereas a modest decrease in the transmembrane potential was observed at 20 mM F1,6BP (Fig. 4B trace f). Both phosphate hexoses tested here seem to induce opposite effects. G6P is a mild uncoupler, probably opening ScMUC, while F1,6BP has a strong coupling effect that probably results from clos- ing ScMUC. As both molecules are accumulated simultaneously during active glycolysis, it was decided to test which of their effects predominates when both are present. To close ScMUC even at low Pi (0.1 mM), 2 mM F1,6BP was added. Under these conditions K+ addition did not induce swelling (Fig. 5A, trace a). Then, increasing G6P concentrations promoted swelling, reaching a maximum at 20 mM G6P. The opposite exper- iment was performed under partially closed ScMUC conditions (1 mM Pi) and in the presence of 10 mM G6P, where a slight swell- ing was promoted by K+ addition. Then, at increasing F1,6BP con- centrations inhibition of swelling was observed, suggesting that the ScMUC-closing effect of F1,6BP was much stronger than the ScMUC-opening effect of G6P. Thus, we propose that the two hexose-phosphates known to accumulate during active glycolysis are effectors of the ScMUC. G6P is a mild uncoupler working through the opening ScMUC while F1,6BP has stronger coupling properties that probably result in ScMUC closure. The effect of the hexose-phosphate derivatives tested here was observed at lower concentrations than those needed to inhibit respiration. In mammalians, the mitochondrial permeability transition trig- gers cell death programs while in turn, a persistently closed MUC results in resistance to apoptosis. Indeed, in rat liver, overexpres- sed hexokinase seems to interact directly with mitochondria, maintaining MUC in a closed state and thus inhibiting cell death [40–42]. F1,6BP promoted ScMUC closure, therefore inhibiting the permeability transition. In addition, a closed ScMUC inhibits apop- tosis and promotes unregulated cell growth, indicating that there Fig. 3. Effects of G6P on the mitochondrial transmembrane potential. Reaction mixture as in Table 1 (except 15 lM safranin-O), 10 mM KCl and Pi as indicated. (A) Pi 1 mM, (B) Pi 4 mM. G6P (mM) as follows: a, 0; b, 2; c, 4; d, 6; e, 10; f, 20. Where indicated, mitochondria (250 lg prot./mL) or CCCP (1.5 lM) were added. Fig. 4. Effects of F1,6BP on the transmembrane potential. Reaction mixture as in Fig. 3, except (A) Pi 0.1 mM and (B) Pi 4 mM. F1,6BP (mM) was: a, 0; b, 2; c, 4; d, 6; e, 10; f, 20. Mitochondria (250 lg prot./mL), CCCP (1.5 lM). Fig. 5. Effects of competition between F1,6BP and G6P on mitochondrial swelling. Reaction mixture: as in Fig. 1. Pi as indicated. (A) Pi 0.1 mM, 2 mM F1,6BP. G6P (mM) was: a, 0; b, 4; c, 10; d, 20. (B) Pi 1 mM, 10 mM G6P. F1,6BP (mM) was a, 0; b, 0.5; c, 4; d,10. M. Rosas-Lemus et al. / Archives of Biochemistry and Biophysics 555–556 (2014) 66–70 69 may be a causal relationship between tumor cell immortalization and F1,6P accumulation. If the F1,6BP-mediated inhibition of oxygen consumption by S. cerevisiae were related to the Crabtree effect, then Crabtree- negative yeasts should not be inhibited. To test this, we compared the effect of 10 mM F1,6BP on mitochondria isolated from either S. cerevisiae or from the Crabtree negative yeast Kluyveromyces lactis [43]. As expected from the results shown in Table 2, F1,6BP inhibited the rate of oxygen consumption in mitochondria from S. cerevisiae at both 0.1 mM (Fig. 6A) and 1.0 mM Pi (Fig. 6B). By contrast, in mitochondria from K. lactis, F1,6BP did not have any effects on the rate of oxygen consumption at either phosphate con- centration (Fig. 6). These results strongly support the notion that F1,6BP is a key metabolite that signals closure of ScMUC, triggering the Crabtree effect. Indeed, upon glucose addition, F1,6BP rises to 5–10 mM, which is much higher than the concentration of 0.5 mM F1,6BP needed to maintain ScMUC in a closed state [7]. Furthermore, at 5 mM F1,6BP, additional mitochondrial effects are observed, such as inhibition of complex III and IV activities in the resting state IV. Further studies are needed in order to eluci- date the physiological role of maintaining ScMUC closed and dissect its likely relationship with the Crabtree effect. Acknowledgments M.R.L. and C.U.A. are CONACYT fellows enrolled in the Biochem- istry PhD program at UNAM. Partially funded by PAPIIT-DGAPA/ UNAM (grant IN202612). The authors thank Dr. Roberto Coria and Dr. Rocío Navarro for the kind donation of the K. lactis 12/8 strain. Dr. Diego González Halphen critically read the manuscript and participated in discussion of the data. References [1] R. Diaz-Ruiz, M. Rigoulet, A. Devin, Biochim. Biophys. Acta 1807 (2011) 568–576. [2] A. Devin, L. Dejean, B. Beauvoit, C. Chevtzoff, N. Averet, O. Bunoust, M. Rigoulet, J. Biol. Chem. 281 (2006) 26779–26784. [3] J.M. Thevelein, S. Hohmann, Trends Biochem. Sci. 20 (1995) 3–10. [4] B. Beauvoit, M. Rigoulet, O. Bunoust, G. Raffard, P. Canioni, B. Guerin, Eur. J. Biochem. 214 (1993) 163–172. [5] N. Averet, H. Aguilaniu, O. Bunoust, L. Gustafsson, M. Rigoulet, J. Bioenerg. Biomembr. 34 (2002) 499–506. [6] N. Averet, V. Fitton, O. Bunoust, M. Rigoulet, B. Guerin, Mol. Cell. Biochem. 184 (1998) 67–79. [7] C. Stefan, U. Sauer, FEMS Yeast Res. 11 (2011) 263–272. [8] J.R. Ernandes, C. De Meirsman, F. Rolland, J. Winderickx, J. de Winde, R.L. Brandao, J.M. Thevelein, Yeast 14 (1998) 255–269. [9] J. Francois, E. Van Schaftingen, H.-G. Hers, Eur. J. Biochem. 145 (1984) 187–193. [10] H.G. Crabtree, Biochem. J. 23 (1929) 536–545. [11] E.F. Greiner, M. Guppy, K. Brand, J. Biol. Chem. 269 (1994) 31484–31490. [12] A. Merico, P. Sulo, J. Piškur, C. Compagno, FEBS J. 274 (2007) 976–989. [13] I. Mustea, T. Muresian, Cancer 20 (1967) 1499–1501. [14] D.H. Koobs, Science 178 (1972) 127–133. [15] R.L. Veech, J.W. Lawson, N.W. Cornell, H.A. Krebs, J. Biol. Chem. 254 (1979) 6538–6547. [16] S. Rodriguez-Enriquez, O. Juarez, J.S. Rodriguez-Zavala, R. Moreno-Sanchez, Eur. J. Biochem. 268 (2001) 2512–2519. [17] R. Diaz-Ruiz, N. Averet, D. Araiza, B. Pinson, S. Uribe-Carvajal, A. Devin, M. Rigoulet, J. Biol. Chem. 283 (2008) 26948–26955. [18] D.H. Huberts, B. Niebel, M. Heinemann, FEMS Yeast Res. 12 (2012) 118–128. [19] R. Diaz-Ruiz, S. Uribe-Carvajal, A. Devin, M. Rigoulet, Biochim. Biophys. Acta 1796 (2009) 252–265. [20] B. Guerin, O. Bunoust, V. Rouqueys, M. Rigoulet, J. Biol. Chem. 269 (1994) 25406–25410. [21] S. Manon, X. Roucou, M. Guerin, M. Rigoulet, B. Guerin, J. Bioenerg. Biomembr. 30 (1998) 419–429. [22] S. Uribe-Carvajal, L.A. Luevano-Martinez, S. Guerrero-Castillo, A. Cabrera- Orefice, N.A. Corona-de-la-Pena, M. Gutierrez-Aguilar, Mitochondrion 11 (2011) 382–390. [23] P. Bernardi, Physiol. Rev. 79 (1999) 1127–1155. [24] R.A. Haworth, D.R. Hunter, Arch. Biochem. Biophys. 195 (1979) 460–467. [25] V. Castrejon, C. Parra, R. Moreno, A. Pena, S. Uribe, Arch. Biochem. Biophys. 346 (1997) 37–44. [26] V. Perez-Vazquez, A. Saavedra-Molina, S. Uribe, J. Bioenerg. Biomembr. 35 (2003) 231–241. [27] V. Castrejon, A. Pena, S. Uribe, J. Bioenerg. Biomembr. 34 (2002) 299–306. [28] P. Bernardi, M. Forte, Novartis Found. Symp. 287 (2007) 157–164 (discussion 164–159). [29] M. Crompton, Biochem. J. 341 (1999) 233–249. [30] J.J. Lemasters, A.L. Nieminen, T. Qian, L.C. Trost, S.P. Elmore, Y. Nishimura, R.A. Crowe, W.E. Cascio, C.A. Bradham, D.A. Brenner, B. Herman, Biochim. Biophys. Acta 1366 (1998) 177–196. [31] A.P. Halestrap, Nature 430 (2004). 1 p following 983. [32] S. Manon, M. Guerin, Biochem. Mol. Biol. Int. 44 (1998) 565–575. [33] E. Fontaine, O. Eriksson, F. Ichas, P. Bernardi, J. Biol. Chem. 273 (1998) 12662– 12668. [34] R. Navarro-Olmos, L. Kawasaki, L. Dominguez-Ramirez, L. Ongay-Larios, R. Perez-Molina, R. Coria, Mol. Biol. Cell 21 (2010) 489–498. [35] A. Pena, M.Z. Pina, E. Escamilla, E. Pina, FEBS Lett. 80 (1977) 209–213. [36] S. Uribe, J. Ramirez, A. Pena, J. Bacteriol. 161 (1985) 1195–1200. [37] A.G. Gornall, C.J. Bardawill, M.M. David, J. Biol. Chem. 177 (1949) 751–766. [38] S. Prieto, F. Bouillaud, D. Ricquier, E. Rial, Eur. J. Biochem. 208 (1992) 487–491. [39] K.E. Akerman, M.K. Wikstrom, FEBS Lett. 68 (1976) 191–197. [40] C. Fiek, R. Benz, N. Roos, D. Brdiczka, Biomembranes 688 (1982) 429–440. [41] M. Gutierrez-Aguilar, X. Perez-Martinez, E. Chavez, S. Uribe-Carvajal, Arch. Biochem. Biophys. 494 (2010) 184–191. [42] H. Azoulay-Zohar, A. Israelson, S. Abu-Hamad, V. Shoshan-Barmatz, Biochem. J. 377 (2004) 347–355. [43] N. Mates, K. Kettner, F. Heidenreich, T. Pursche, R. Migotti, G. Kahlert, E. Kuhlisch, K.D. Breunig, W. Schellenberger, G. Dittmar, B. Hoflack, T.M. Kriegel, Mol. Cell. Proteomics 13 (2014) 860–875. Fig. 6. Effect of F1,6BP on the rate of oxygen consumption of isolated mitochondria from S. cerevisiae or K. lactis. Reaction mixture as in Table 2, except (A) Pi 0.1 mM; (B) Pi 1 mM. F1,6BP was absent (empty bars) or 10 mM (black bars).⁄Differences are statistically significant P < 0.01, based on ANOVA tukey’s multiple comparison test. 70 M. Rosas-Lemus et al. / Archives of Biochemistry and Biophysics 555–556 (2014) 66–70 Effects of ubiquinone derivatives on the mitochondrial unselective channel of Saccharomyces cerevisiae Manuel Gutiérrez-Aguilar & Helga M. López-Carbajal & Cristina Uribe-Alvarez & Emilio Espinoza-Simón & Mónica Rosas-Lemus & Natalia Chiquete-Félix & Salvador Uribe-Carvajal Received: 15 June 2014 /Accepted: 25 November 2014 /Published online: 3 December 2014 # Springer Science+Business Media New York 2014 Abstract Ubiquinone derivatives modulate the mammalian mitochondrial Permeability Transition Pore (PTP). Yeast mito- chondria harbor a similar structure: the respiration- and ATP- induced Saccharomyces cerevisiae Mitochondrial Unselective Channel (ScMUC). Here we show that decylubiquinone, a well- characterized inhibitor of the PTP, suppresses ScMUC opening in diverse strains and independently of respiratory chain mod- ulation or redox-state. We also found that naturally occurring derivatives such as hexaprenyl and decaprenyl ubiquinones lacked effects on the ScMUC. The PTP-inactive ubiquinone 5 (Ub5) promoted the ScMUC-independent activation of the re- spiratory chain in most strains tested. In an industrial strain however, Ub5 blocked the protection elicited by dUb. The results indicate the presence of a ubiquinone-binding site in the ScMUC. Keywords Ubiquinone analogues .Mitochondria . Permeability transition pore . Yeast Abbreviations dUb Decylubiquinone dVO4 Decavanadate Δ= Mitochondrial transmembrane potential FCCP Carbonyl cyanide p-trifluoro-methoxyphenyl-hydrazone Cyclosporine A CsA PTP Mitochondrial permeability transition pore ScMUC Saccharomyces cerevisiae mitochondrial unselective channel Ub5 Ubiquinone 5 Ub30 Hexaprenylquinone Ub50 Decaprenylquinone Introduction Themitochondrial permeability transition can be defined as the rise in unselective conductance to ions and metabolites trig- gered by the opening of an unidentified non-selective pore (Brenner and Moulin 2012). In mammalian mitochondria, the permeability transition pore (PTP) depletes the protonmotive force and exhibits a molecular mass cutoff of up to 1.5 kDa (Bernardi 2013). The Saccharomyces cerevisiaeMitochondrial Unselective Channel (ScMUC) is probably an equivalent of the PTP (Uribe-Carvajal et al. 2011). The biochemistry and physiopathology of the PTP has been studied ad extenso. Most hypotheses suggest that this pore opens irreversibly during several disease states, inducing a collapse in mitochondrial homeostasis (for a review, see Di Lisa and Bernardi 2006). In contrast, PTP transient opening or flickering has also been proposed to regulate Ca2+ homeosta- sis in mitochondria (Ichas and Mazat 1998). Less is known in terms of the molecular composition of the PTP; earlier models proposing that the Adenine Nucleotide Translocator and the Voltage Dependent Anion Channel could form the PTP have not successfully passed genetic tests (reviewed in Bonora et al. 2014). When the mitochondrial phosphate carrier is de- leted, this results in changes in the properties of both, the PTP (Kwong et al. 2014) and the ScMUC (Gutiérrez- Aguilar et al. 2010) likely by controlling inorganic phosphate M. Gutiérrez-Aguilar (*) Dalton Cardiovascular Research Center, University of Missouri-Columbia, 134 Research Park Dr, Columbia, MO 65211, U.S.A e-mail: gutierrezaguilarm@missouri.edu H. M. López-Carbajal :C. Uribe-Alvarez : E. Espinoza-Simón : M. Rosas-Lemus :N. Chiquete-Félix : S. Uribe-Carvajal Department of Molecular Genetics, Instituto de Fisiología Celular, Universidad Nacional Autónoma de México, UNAM, Mexico City, Mexico J Bioenerg Biomembr (2014) 46:519–527 DOI 10.1007/s10863-014-9595-3 (Pi) availability in mitochondria. However, a moderate change in the expression levels of the Pi carrier does not impact the Ca2+-induced PTP (Gutiérrez-Aguilar et al. 2014). Up to now, Cyclophilin D (CypD) and mitochondrial Complex I are the only widely accepted modulators of the PTP (Giorgio et al. 2010; Di Lisa et al. 2011; Li et al. 2012). Topical studies suggest that CypD regulates F1F0-ATP synthase. In addition, the purified dimeric enzyme from both mouse and S. cerevisiae mitochondria forms a multiple conductance channel with PTP-like behavior (Giorgio et al. 2013; Carraro et al. 2014). This has led to propose that the unselective pores observed in yeast and higher eukaryotes are equivalent struc- tures that form at the interface of two F0 sectors of ATP synthase and that the F0 sector may play an important role in PTP formation (Bernardi 2013; Bonora et al. 2013). The ScMUC probably participates in energy surplus dissi- pation processes (Prieto et al. 1995). Although the ScMUC and the mammalian PTP present similar molecular exclusion properties, it was earlier proposed that the ScMUC could be hardly considered a yeast counterpart of the PTP (Manon et al. 1998). Since S. cerevisiae lacks a mitochondrial Ca2+- uniporter (Uribe et al. 1992), Ca2+ does not activate the ScMUC unless S. cerevisiae mitochondria are incubated in the presence of the Ca2+ ionophore ETH129 (Yamada et al. 2009; Carraro et al. 2014). In regard to similarities in their properties, ScMUC and PTP are both regulated by ADP, octylguanidine, Mg2+, Pi, mercurials and mastoparan (Uribe-Carvajal et al. 2011). Indeed it has been sug- gested that MUCs are conserved throughout the eukary- otic domain (for reviews see Azzolin et al. 2010; Bernardi and Von Stockum 2012). Different ubiquinone analogues seem to interact withmam- malian mitochondria on a specific site. Then, depending on the analogue substituent, PTP may be activated, unaffected or inhibited (Walter et al. 2000). In addition, since ubiquinones are natural ligands of respiratory complexes I, II and III, certain analogues can also interfere with respiration thus mak- ing difficult to detect off-site effects (Walter et al. 2000). Here we aimed to determine whether ubiquinone analogues modu- late the ScMUC. This is interesting as S. cerevisiae mitochon- dria lack respiratory complex I. Our results show that known PTP inhibitors modulate ScMUC activity and support the notion of a conserved ubiquinone-binding site on the channel. Materials and methods Materials All chemicals were reagent grade. dUB, Ub5, Ub30, Ub50, Mannitol, MES, ethanol, safranine-O, CaCl2, MgCl2, ADP, FCCP and bovine serum albumin type V were from Sigma Chem Co. (St. Louis, MO). All other reagents were of the highest purity commercially available. Industrial and laboratory yeast strains A commercial strain of the baker’s yeast S. cerevisiae (La Azteca) was purchased from a local bakery. The industrial strain Yeast Foam (YF) was obtained from a previous collab- oration (Díaz-Ruiz et al. 2008). The laboratory strains were BY4741 (BY) (MATa; his3Δ1; leu2Δ0; met15Δ0; ura3Δ) and W303 (MATα; ura3-1; trp1Δ 2; leu2-3,112; his3-11,15; ade2-1; can1-100). Isolation of Yeast Mitochondria For experiments in Figs. 1, 2A, B, C, 3, 4B and 5, an industrial strain of S. cerevisiae (La Azteca) was used. Cells (40 g) were suspended and incubated in a rich liquid medium under aera- tion (3 L/min) for 16 h, washed, suspended in distilled water and starved overnight under aeration (de Kloet et al. 1961). Cells were washed by centrifugation three times and suspended in 0.6 M mannitol, 5 mM MES, 0.1 % bovine serum albumin, pH 6.8 adjusted with triethanolamine (TEA). Cells were disrupted using a Braun cell-homogenizer and 0.45 mm diameter glass beads. Mitochondria were isolated by differential centrifugation in a SS34 rotor (Sorvall) (Cortés et al. 2000). Protein concentration was determined by a biuret method. For experiments in Figs. 2D and 4, the strains YF, W303 and BY were also used. The S. cerevisiae industrial strain Yeast Foam (YF) was subcultured 8 hours in YPD and cultured in YPLac until reaching an optical density of 3.0-3.5. The S. cerevisiae laboratory strains W303 and BY were subcultured in YPD for 24 hours and cultured in of YPLac for 24 hours. All cultures were grown under constant agitation (250 rpm) at 30 °C. Mitochondria were isolated from the YF, W303 and BY strains after spheroplast homogeniza- tion and differential centrifugation (for detailed protocols see Gutiérrez-Aguilar et al. 2010). Oxygen consumption The rate of oxygen consumption was measured in the resting state (State 4) and in the phosphorylating state (State 3) using an YSI model 5,300 oxygraph equipped with a Clark-Type electrode at room temperature in a 1.5 mL chamber containing mitochondria at a final concentration of 0.5 mg protein/mL. Samples were suspended in respiration buffer (0.6 M manni- tol, 5 mMMES pH 6.8 (TEA) plus 5 μL/mL 96 % ethanol as respiratory substrate, unless indicated otherwise). The concen- trations of Pi and K+ used are indicated under each figure. Stock solutions were 1.0 MMgCl2, 2.0 M KCl, and either 1.0 520 J Bioenerg Biomembr (2014) 46:519–527 or 0.1 M PO4 3− buffer, pH 6.8 (TEA) and 20 mM dUb, Ub5, Ub30, Ub50. Transmembrane potential (Δψ) TheΔ= was determined using 10 μM safranine-O, following the absorbance changes at 511–533 nm in a DW2000 Aminco spectrophotometer in dual mode (Akerman and Wikström 1976). At the end of each trace,Δψ was collapsed by adding 6 μM FCCP. Mitochondrial swelling The K+-mediated swelling of mitochondria was measured as described before (Castrejón et al. 2002). Typically, coupled isolated mitochondria are impermeable to K+. However, when the ScMUC opens, it allows unselective transport of externally added K+ along with anions present in the medium, resulting in the transport of osmotically active species. This will result in the transport of water towards the mitochondrial matrix following swelling of the organelles, which is optically mea- sured as a decrease in light scattering of isolated mitochondria in suspension. Swelling buffer, containing 0.3 M mannitol, 5 mM MES, pH 6.8 (TEA), plus 5 μL/mL ethanol or NADH was used to promote swelling under energized conditions. Swelling was promoted by adding 20 mM KCl where indi- cated by an arrow. The absorbance changes were measured at 540 nm in a DW2 Aminco spectrophotometer in split mode equipped with a magnetic stirrer. Sample volume was kept constant at 4 mL of respiration buffer. Mitochondrial concen- tration was 0.5 mg protein/mL. NADH:NAD+ ratio determination In order to determine whether the increase in alcohol dehy- drogenase activity led to an increase in the percentage of reduced NADH, we made a NADH concentration curve, which we used to determine the amount of NADH present in samples incubated in the presence of increasing etha- nol. Then, the 100 % percent NADH concentration was evaluated after adding 3 μM sodium dithionite, which was prepared within one hour (Quinlan et al. 2013). NADH absorbance was read at 340 nm in a Varian 50 Bio-UV/ Vis spectrophotometer. Results In isolated mitochondria, dUb inhibits opening of the ScMUC The ubiquinone derivative dUb closes the PTP in mitochon- dria from different cell lines and mammalian sources (Walter et al. 2000; Devun et al. 2010). With this in mind, we decided to assess whether other ubiquinone derivatives also regulate ScMUC opening (Fig. 1A). We first monitored oxygen consumption of isolated S. cerevisiae mitochondria from the industrial strain La Azteca under control conditions where the ScMUC is typically closed by high phosphate (Fig. 1B, “c”). Under these conditions, the respiration rate of isolated mitochondria remained low. Respiration was signifi- cantly increased when phosphate was decreased, indicating opening of ScMUC (Fig. 1B, “0”). This high respiration rate phenotype was gradually attenuated with dUb in a concentration-dependent manner (Fig. 1B “10” to “30”). We next wanted to assess if the protective effects of dUb on respiration were derived from a direct interaction with the respiratory chain (Fig. 1C). To address this possibility we tested the effects of increasing amounts of dUb in mitochon- dria incubated with the uncoupler FCCP. Under these condi- tions, dUb failed to decrease the respiration rate of isolated mitochondria suggesting that the protection was not at the level of the respiratory chain. The ScMUC can be regulated by fluctuations in the NADH:NAD+ ratio (Bradshaw and Pfeiffer 2013). This is of particular relevance as S. cerevisiae lacks respiratory complex I, which has been proposed to regulate PTP opening (Li et al. 2012). To further address if dUb regulates the ScMUC through modifications of the NADH dehydrogenase activity, we performed state 4 oxygen consumption experiments in the presence of increasing con- centrations of ethanol (which generates NADH), in the ab- sence and presence of dUb (Fig. 1D). As expected, increasing concentrations of ethanol enhanced the rate of respiration, being maximal at 20 mM ethanol. The presence of dUb under these conditions resulted in a decreased state four respiration, reaching significance at 20 mM ethanol. Further Lineweaver- Burk processing of these results suggests that dUb behaves as a non-competitive inhibitor of NADH-linked respira- tion and further implying that the dUb effects on ScMUC activity are not related to NADH:NAD+ ratio fluctuations (Fig. 1E). Furthermore, the NADH:NAD+ ratio did not change in any of the ethanol concentra- tions tested (result not shown); this probably indicates that alcohol dehydrogenase is much slower than NADH dehydrogenase activities and thus it cannot affect the NADH reduction percentage. Opening of the ScMUC prevents energized mitochondria from building up a stableΔψ (Gutiérrez-Aguilar et al. 2010). With this in mind, we tested the effects of dUb on the Δψ of isolated mitochondria from La Azteca strain under the same conditions as those used for oxygen consumption. The results show that in the presence of high phosphate, mitochondria are able to sustain a high, constant and FCCP-sensitive Δψ (Fig. 2A trace a). Decreasing phosphate in the incubation media resulted in a fast drop in Δψ, indicative of ScMUC opening. This Δψ reading was not sensitive to further J Bioenerg Biomembr (2014) 46:519–527 521 addition of FCCP (Fig. 2A trace b). Under this condition, increasing dUb resulted in the gradual buildup of a Δψ Fig. 2A traces c to h), reaching maximal values at 50 and 100 μM dUb (Fig. 2A traces g, h). A typical parameter used to measure ScMUC (and PTP) activity is the swelling resulting from opening of the pore (Castrejón et al. 2002).Mitochondria suspended in buffer with ethanol as respiratory substrate and high levels of phosphate were not sensitive to K+-induced swelling (Fig. 2B trace a). Isolated mitochondria in the presence of ethanol plus low phosphate levels rapidly swelled following K+ addition (Fig. 2B trace b). Then increasing levels of dUb, attenuated mitochondrial swelling confirming a direct inhibition of the ScMUC (Fig. 2B traces c-h). The experiments above show that dUb closed the ScMUC in the presence of 0.4 mM phosphate. However, all experiments were performed in the presence of ethanol as respiratory substrate. Ethanol reduces NAD+ to NADH+H+, which in turn is reoxidized by the internal µµ Fig. 1 Ubiquinone derivatives used in this study and effects of dUb on the rates of oxygen consumption in closed/open ScMUC conditions in mitochondria isolated from S. cerevisiae La Azteca strain. Chemical structures in (A) represent the ubiquinone derivatives used in this study. For panels B-E, experimental conditions were: 0.6 M Mannitol, 5 mM MES, pH 6.8, 20 mM KCl, pH 6.8 (TEA), 5 μL ethanol /mL. To obtain the uncoupled state respiration, 6 μM FCCP was added in the experi- ments on panel C. Measurements were conducted in a water-jacketed chamber (30 °C) connected to an oxymeter interfaced to a computer. Rates of oxygen consumption are expressed in natoms gram O (min.mg prot)−1. Isolated mitochondria were used at a final concentration of 0.5 mg prot/mL. Bars in both B and C were: “C”=4 mM Pi, no dUb, 0=0.4 mM Pi no dUb, 10=0.4 mM Pi plus 10 μM dUb, 20=0.4 mM Pi plus 20 μM dUb, 30=0.4 mM Pi plus 30 μM dUb, 40=0.4 mM Pi plus 40 μM dUb, 50=0.4 mM Pi plus 50 μM dUb. In (D), oxygen uptake in open MUC (0.4 mM Pi) condition was evaluated in the presence (●) or absence (○) of 30 μM dUb. Rates of respiration were calculated at different ethanol concentrations (0.5 mM, 1 mM, 2.5 mM, 5 mM, 10 mM, 20 mM, 30 mM) with and without dUb added. (E) Lineweaver-Burk plot from data presented in (D), which indicates a non-competitive inhibition of dUb. Each point represents the mean of three experiments±Standard Deviation. *P<0.05 vs. “C” 522 J Bioenerg Biomembr (2014) 46:519–527 NADH dehydrogenase. In our hands the redox state of the pyridine nucleotides did not vary under these condi- tions. Nonetheless, it has been reported that increased NADH:NAD+ ratios and/or high respiratory rates can result in ScMUC or PTP opening (Leverve and Fontaine 2001; Manon 1999; Manon et al. 1998). To determine whether dUb inhibited ScMUC opening in the presence of increasing NADH, we directly added NADH to iso- lated mitochondria (Fig. 2C). As expected, at 1 and 2 mM, NADH promoted ScMUC opening as indicated by an increase in mitochondrial swelling (Fig. 2C, “NADH” traces). In contrast, in the presence of 30 μM dUb swelling was prevented regardless of the NADH addition (Fig. 2C, “NADH+dUb” traces). Thus it may be concluded that the effect of dUb is independent of the purine nucleotide pool redox state. Early studies assessing the regulation and transport prop- erties of the ScMUC concluded that industrial and laboratory strains of S. cerevisiae presented a mitochondrial pore with different effector sensitivities (Manon et al. 1998). These differences were later proposed to be context-specific and were abolished under appropriate experimental conditions (Bradshaw and Pfeiffer 2013). In mammalian mitochondria, cell type-dependent differential response to ubiquinone deriv- atives has been reported (Devun et al. 2010). With this in mind, we assessed the sensitivity of different industrial and laboratory strains of S. cerevisiae to dUb (Fig. 2D). We performed state 4 oxygen uptake rate experiments on the industrial strains La Azteca and Yeast Foam (YF) and the laboratory W303 and BY strains. As expected, conditions leading to closure of the ScMUC induced a typical-baseline oxygen uptake rate phenotype in isolated mitochondria from C D Azteca YF W303 BY - 0.02 - 0.01 - 0.0 NADH + dUb NADH 50 0 100 150 200 250 300 400 350 0.060 Fig. 2 Effect of dUb on the (A) Δψ and (B) swelling of mitochondria isolated from different industrial and laboratory strains of S. cerevisiae. Experimental conditions: As in Fig. 1 except in (A), 10 μM safranine-O. Traces in both (A) and (B) were: a=4 mM Pi, no dUb, b=0.4 mM Pi no dUb, c=0.4 mM Pi plus 10 μM dUb, d=0.4 mM Pi plus 20 μM dUb, e= 0.4 mMPi plus 30μMdUb, f=0.4 mMPi plus 40μMdUb, g=0.4 mMPi plus 50μMdUb, h=0.4mMPi plus 100μMdUb.Mitochondria (M) were added at the arrow. Representative experiment from n=3. For the exper- iments detailed in (C), externally added NADH was used instead of ethanol to energize mitochondria in the presence of 0.4 mM Pi being 0 mM NADH (black traces), 1 mM NADH (yellow traces) and 2 mM NADH (green traces) in the absence or presence of 30 μM dUb as indicated. Representative experiment from n=3. In (D), data are presented as oxygen uptake rate in natgO (min*mg prot)−1. Bars labeled “C” represent the oxygen uptake rate in the presence of 4 mM phosphate. Bars labeled “dUb” represent the oxygen uptake rate in the presence of 30 μM dUb. Please refer to section “Industrial and laboratory yeast strains” for information of the strains used in these experiments. Each bar represents the mean of three independent experiments±Standard Error. *P<0.05 vs. values of “ScMUC” labeled bars J Bioenerg Biomembr (2014) 46:519–527 523 all strains (Fig. 2D, black bars). In the presence of low phos- phate loads (ScMUC), oxygen consumption was enhanced (Fig. 2D, gray bars). In agreement with Fig. 1A, addition of 30 μM dUb reduced the oxygen uptake rate in the industrial and laboratory strains (Fig. 2D, yellow bars). The effect was ScMUC-specific and concentration-dependent as confirmed with Δψ and swelling experiments performed in the labora- tory W303 and BY strains (results not shown). Effects of naturally occurring ubiquinones on the ScMUC of industrial and laboratory strains Based on our results showing that dUb-induced ScMUC clo- sure does not depend on a potential interaction of the ubiqui- none derivative with the respiratory chain, we next wanted to assess whether naturally occurring ubiquinones such as hexaprenyl (Ub30) and decaprenyl quinone (Ub50) could po- tentially influence ScMUC activity in addition to its physio- logical role in the respiratory chain (Fig. 3). We performed Δψ experiments on isolated mitochondria from the industrial strain La Azteca under control conditions where we detected a high and stable Δψ (Fig. 3A, trace a). As shown before, opening of the ScMUC led to a decrease inΔψ (Fig. 3A, trace b). Increasing concentrations of Ub30 (10–100 μM) did not confer any potential protection on the ScMUC-dependentΔψ decrease (Fig. 3A, traces c-f). Oxygen consumption experi- ments in the presence of Ub30 under the same experimental conditions resulted in no protection against ScMUC-mediated increase in the oxygen consumption rate (not shown). We measuredΔψ of isolated mitochondria from La Azteca strain in the presence of Ub50 (Fig. 3B). Although we occasionally measured weak, concentration-independent increases in Δψ (see Fig. 3B, trace d), oxygen consumption experiments evidenced lack of Ub50 protection against ScMUC-dependent increase in respiration (not shown). Ub5 does not modulate the ScMUC We decided to test whether Ub5, which has been reported to behave as a PTP-inactive derivative, could modulate the ScMUC in isolated mitochondria from the industrial and lab- oratory strains of S. cerevisiae used in this study. Consequently, we measured state 4 oxygen uptake rates of isolated mitochondria from La Azteca YF, W303 and BY strains under control conditions (C), where oxygen uptake rates were low (Fig. 4A, black bars) and in the presence of low phosphate loads, which trigger ScMUC opening (Fig. 4A, gray bars). Addition of 200 μMUb5 under ScMUC conditions had no effects on the uptake rates of mitochondria from La Azteca strain. Conversely, Ub5 increased oxygen uptake rates ~2-3 fold under ScMUC conditions in the YF, W303 and BY strains (Fig. 4A, white bars). Further oxygen uptake experi- ments in the presence of high phosphate loads (closed ScMUC) resulted in a concentration-dependent increase in mitochondrial respiration mediated by Ub5 in all strains (Fig. 4B). The increase in oxygen uptake was significantly lower in La Azteca strain (Fig. 4B, ●). Such effects in the oxygen uptake of all strains were ScMUC-independent, given Ub5 failed to modulateΔψ on isolated mitochondria from all strains in the presence of either low or high phosphate loads (not shown). Ub5 suppresses dUb protective effects in La Azteca strain While dUb promoted closure of ScMUC, Ub5 did not exhibit measurable ScMUC-related effects in La Azteca strain. Therefore, to determine if Ub5 could still bind (but not Fig. 3 Effects of Ub30 and Ub50 on the Δψ of isolated mitochondria of S. cerevisiae La Azteca strain. Experimental conditions were as in Fig. 2. Traces in (A) were: a=4 mM Pi, no Ub30, b=0.4 mM Pi, no Ub30, c= 0.4 mM Pi plus 10 μMUb30, d=0.4 mMPi plus 30 μMUb30, e=0.4 mM Pi plus 50μMUb30, f=0.4 mMPi plus 100 μMUb30. Traces in (B) were: a=4 mM Pi, no Ub50, b=0.4 mM Pi, no Ub50, c=0.4 mM Pi plus 10 μM Ub50, d=0.4 mM Pi plus 30 μM Ub50, e=0.4 mM Pi plus 50 μM Ub50, f=0.4 mM Pi plus 100 μM Ub50. Mitochondria (M) were added at the arrow. Representative experiment from n=3 524 J Bioenerg Biomembr (2014) 46:519–527 modulate) the ScMUC in this strain, we designed a competi- tion protocol measuring the rate of oxygen consumption in the presence of dUb and increasing concentrations of Ub5 (Fig. 5). At 0.4 mMPi, addition of 50μMdUb promoted the return to a basal rate. Further additions of Ub5 from 25 to 200 μM increased oxygen consumption similarly to uncoupled rates (Fig. 5A). These results were confirmed withΔψ experiments under the same conditions. At 4 mM Pi,Δψ values were high and stable but low at 0.4 mM Pi. Δψ values returned to high values at 0.4 mMPi plus 50 μMdUb. Then, in the presence of increasing Ub5 concentrations Δψ values decreased again (Fig. 5B). These results indicate that dUb-mediated closure of ScMUC was reverted by Ub5, suggesting that these ubiqui- none derivatives compete for the same binding site. Discussion The PTP-modulating effects of ubiquinone analogues have been proposed to be downstream from the regulatory role of CypD (Basso et al. 2005). Fontaine et al. (1998) previously proposed that the ubiquinone effect-site was respiratory Fig. 4 Effects of Ub5 on the oxygen uptake rates of mitochondria isolated from different industrial and laboratory strains of S. cerevisiae. Experimental conditions: As in Fig. 2. A, B=oxygen uptake rates. Bars labeled “ScMUC” represent oxygen uptake rates in the presence of 0.4 mM phosphate. Bars labeled “C” represent percent oxygen uptake rates in the presence of 4 mM phosphate. Bars labeled “Ub5” represent percent oxygen uptake rates in the presence of 200 μM Ub5. Please refer to section “Industrial and laboratory yeast strains” for information of the strains used in these experiments. Each bar represents the mean of three independent experiments±Standard Deviation. *P<0.05 vs. values of “ScMUC” labeled bars. In (B), oxygen uptake rates were evaluated with increasing concentrations of Ub5 using isolated mitochondria from La Azteca (●), YF (○), W303 (☐), and by (■) strains. Data are presented as oxygen uptake rate in natgO (min*mg prot)−1. Rates of respiration were calculated at different Ub5 concentrations (0 μM, 25 μM, 50 μM, 100 μM, 200 μM). Each value represents the mean of three independent experiments±Standard Deviation. *P<0.05 vs. values of YF, W303 and BY strains Fig. 5 Combined effects of dUb and Ub5 on the rates of oxygen consumption and Δψ of mitochondria isolated from S. cerevisiae La Azteca strain. Experimental conditions: As in Fig. 2. A=oxygen consumption, B=Δψ. Bars in A were: “C”=4 mM Pi, no Ub5 or dUb, 0=0.4 mM Pi no Ub5 or dUb, 25=0.4 mM Pi plus 25 μM Ub5, 50= 0.4 mM Pi plus 50 μM Ub5, 100=0.4 mM Pi plus 100 μM Ub5, 200= 0.4 mM Pi plus 200 μM Ub5. Where indicated, 50 μM dUb was present in the reaction mixture. Each point represents the mean of three experiments±Standard Deviation. *P<0.05 vs. C. Traces in B were: a= 4 mM Pi, no Ub5, b=0.4 mM Pi and no Ub5, c=0.4 mM Pi and no Ub5, d=0.4 mMPi plus 25 μMUb5 e=0.4 mMPi plus 50μMUb5, f=0.4 mM Pi plus 100 μM Ub5, g=0.4 mM Pi plus 200 μM Ub5. For traces c-g, 50 μM dUb was present in the reaction mixture. Mitochondria (M) were added where indicated by an arrow. Representative experiment from n=3 J Bioenerg Biomembr (2014) 46:519–527 525 complex I. It is important to note that these analogues present divergent modulating properties depending on the ubiquinone side chain (Walter et al. 2002). In addition such divergent properties are cell line-specific (Devun et al. 2010). This implies that PTPs (and probably the ScMUC) may present context-specific accessory components. Indeed, (Li et al. 2012) proposed that rotenone-mediated inhibition of complex I may be even more protective against PTP opening than CsA as long as CypD levels do not exceed those of discrete complex I subunits. Manon (1999) also concluded that ScMUC activity is strictly dependent on respiratory chain activity. These data suggest that MUCs are likely modulated by the pyridine nucleotide redox state. In fact, Hunter and Haworth (1979) were the first to report NADH-induced PTP inhibition indicating that the PTP remained closed upon inhi- bition of complex I with rotenone or through the regulation of the NADH:NAD+ ratio using β-hydroxybutyrate and acetoacetate. Ubiquinone derivatives regulate the PTP down- stream of mitochondrial CypD, strongly indicating that these molecules bind directly to the pore or to another regulatory factor (Basso et al. 2005). Since the ScMUC is probably not regulated by the yeast mitochondrial Cyclophilin (Cpr3), but is still sensitive to ubiquinone derivatives, the ScMUC and the PTP still present conserved characteristics. To this, the utili- zation of S. cerevisiae as a model to understand the PTP constitutes a powerful genetic tool to unveil the molecular componentry of the ScMUC as recently proposed by Carraro et al. (2014). Here, we provide evidence supporting the notion that the ScMUC presents a conserved ubiquinone-sensitive site and that the effects of ubiquinone derivatives are independent of the presence of mitochondrial complex I, which is naturally absent in our yeast model. We also show that dUb blocks the ScMUC, like the PTP, in a similar concentration range. Then we confirm that the effects of dUb are not related to the regulation of the mitochondrial respiration nor changes in the matrix NADH:NAD+ ratio, which are also known pore effectors (Leverve and Fontaine 2001). This suggests that respiration-induced ScMUC opening and dUb-mediated ScMUC closure likely occur through unrelated mechanisms. We finally show that although the PTP-inactive Ub5 counteracts the effects of dUb on the ScMUC of La Azteca strain, this derivative also strongly activates ScMUC-independent respiration in several yeast strains tested. To this, the Ub5-mediated increase in respiration has also been reported for the laboratory CEN.PK2–1C strain of S. cerevisiae (James et al. 2005). Although the cause for such divergent phenotype between La Azteca and the rest of the strains tested is unknown and is subject of further research in our laboratory, adaptive evolution could account for the differences monitored herein, where close to 22 % of the total transcripts detected in industrial strains do not match annotated sequences for laboratory strains (Varela et al. 2005). We have discussed this possibility for the strain- specific differences in ScMUC activity reported before (Uribe-Carvajal et al. 2011). Altogether, our results suggest that ubiquinone analogues can regulate the ScMUC as seen with the mammalian PTP. Consequently, ubiquinone analogues may bind to a conserved/discrete site and its lateral chain may be involved in the gating of the ScMUC as well as the PTP. This likely explains why ubiquinone derivatives with disparate side chains have similar properties on the PTP and the ScMUC. The results presented here also imply that ubiquinone ana- logues display its permeability-modulating effects in a com- plex I-independent context. Acknowledgments M.G.-A. is currently supported by an American Heart Association Midwest Affiliate Postdoctoral Fellowship (13POST14060013). HLC is a CONACyT fellow enrolled in the Ms. Sc. Biochemistry program at UNAM. CUA, EGS and MRL are CONACyT fellows enrolled in the Ph. D. Biochemistry program at UNAM. Partially funded by DGAPA/PAPIIT Project IN202612. We acknowledge the technical assistance of Ramón Mendez. Mariana Valenzuela kindly helped to build the figures. References Akerman KE, Wikström MK (1976) Safranine as a probe of the mito- chondrial membrane potential. FEBS Lett 68:191–197 Azzolin L, Von Stockum S, Basso E et al (2010) The mitochondrial permeability transition from yeast to mammals. FEBS Lett 584: 2504–2509 Basso E, Fante L, Fowlkes J et al (2005) Properties of the permeability transition pore in mitochondria devoid of Cyclophilin D. J Biol Chem 280:18558–18561 Bernardi P (2013) The mitochondrial permeability transition pore: a mystery solved? Front Physiol 4:95 Bernardi P, Von Stockum S (2012) The permeability transition pore as a Ca2+ release channel: new answers to an old question. Cell Calcium 52:22–27 Bonora M, Bononi A, De Marchi E et al (2013) Role of the c subunit of the FO ATP synthase in mitochondrial permeability transition. Cell Cycle 12:674–683 Bonora M, Wieckowski MR, Chinopoulos C, et al. (2014) Molecular mechanisms of cell death: central implication of ATP synthase in mitochondrial permeability transition. Oncogene. doi:doi:10.1038/ onc.2014.96 Bradshaw PC, Pfeiffer DR (2013) Characterization of the respiration- induced yeast mitochondrial permeability transition pore. Yeast 30: 471–483 Brenner C, Moulin M (2012) Physiological roles of the permeability transition pore. Circ Res 111:1237–1247 Carraro M, Giorgio V, Sileikytė J, et al. (2014) Channel Formation by Yeast F-ATP Synthase and the Role of Dimerization in the Mitochondrial Permeability Transition. J Biol Chem 289:15980– 15985 Castrejón V, Peña A, Uribe S (2002) Closure of the yeast mitochondria unselective channel (YMUC) unmasks aMg2+ and quinine sensitive K+ uptake pathway in Saccharomyces cerevisiae. J Bioenerg Biomembr 34:299–306 526 J Bioenerg Biomembr (2014) 46:519–527 Cortés P, Castrejón V, Sampedro JG, Uribe S (2000) Interactions of arsenate, sulfate and phosphate with yeast mitochondria. Biochim Biophys Acta 1456:67–76 de Kloet S, van Wermeskerken R, Koningsberger VV (1961) Studies on protein synthesis by protoplasts of Saccharomyces carlsbergensis. I. The effect of ribonuclease on protein synthesis. Biochim Biophys Acta 47:138–143 Devun F, Walter L, Belliere J et al (2010) Ubiquinone analogs: a mito- chondrial permeability transition pore-dependent pathway to selec- tive cell death. PLoS ONE 5:e11792 Díaz-Ruiz R, Averet N, Araiza D, Pinson B, Uribe-Carvajal S, Devin A et al (2008)Mitochondrial oxidative phosphorylation is regulated by fructose 1,6-bisphosphate. A possible role in Crabtree effect induc- tion? J Biol Chem 283:26948–26955 Di Lisa F, Bernardi P (2006) Mitochondria and ischemia-reperfusion injury of the heart: fixing a hole. Cardiovasc Res 70:191–199 Di Lisa F, Carpi A, Giorgio V, Bernardi P (2011) The mitochondrial permeability transition pore and cyclophilin D in cardioprotection. Biochim Biophys Acta 1813:1316–1322 Fontaine E, Eriksson O, Ichas F, Bernardi P (1998) Regulation of the permeability transition pore in skeletal muscle mitochondria. Modulation By electron flow through the respiratory chain complex I. J Biol Chem 273:12662–12668 Giorgio V, Soriano ME, Basso E et al (2010) Cyclophilin D in mitochon- drial pathophysiology. Biochim Biophys Acta 1797:1113–1118 Giorgio V, Von Stockum S, Antoniel M et al (2013) Dimers of mitochon- drial ATP synthase form the permeability transition pore. Proc Natl Acad Sci U S A 110:5887–5892 Gutiérrez-Aguilar M, Douglas DL, Gibson AK et al (2014) Genetic manipulation of the cardiac mitochondrial phosphate carrier does not affect permeability transition. J Mol Cell Cardiol 72:316–325 Gutiérrez-Aguilar M, Pérez-Martínez X, Chávez E, Uribe-Carvajal S (2010) In Saccharomyces cerevisiae, the phosphate carrier is a component of the mitochondrial unselective channel. Arch Biochem Biophys 494:184–191 Hunter DR, Haworth RA (1979) The Ca2+-induced membrane transition in mitochondria. I. The protective mechanisms. Arch Biochem Biophys 195:453–459 Ichas F, Mazat JP (1998) From calcium signaling to cell death: two conformations for the mitochondrial permeability transition pore. Switching from low- to high-conductance state. Biochim Biophys Acta 1366:33–50 James AM, Cochemé HM, Smith RAJ, Murphy MP (2005) Interactions of mitochondria-targeted and untargeted ubiquinones with the mitochondrial respiratory chain and reactive oxygen species. Implications for the use of exogenous ubiquinones as therapies and experimental tools. J Biol Chem 280:21295–21312 Kwong JQ, Davis J, Baines CP et al (2014) Genetic deletion of the mitochondrial phosphate carrier desensitizes the mitochondrial per- meability transition pore and causes cardiomyopathy. Cell Death Differ 21(8):1209–1217 Leverve XM, Fontaine E (2001) Role of substrates in the regulation of mitochondrial function in situ. IUBMB Life 52(3–5):221–229 Li B, Chauvin C, De Paulis D et al (2012) Inhibition of complex I regulates the mitochondrial permeability transition through a phosphate-sensitive inhibitory site masked by cyclophilin D. Biochim Biophys Acta 1817:1628–1634 Manon S (1999) Dependence of yeast mitochondrial unselective channel activity on the respiratory chain. Biochim Biophys Acta 1410:85–90 Manon S, Roucou X, Guérin M et al (1998) Characterization of the yeast mitochondria unselective channel: a counterpart to the mammalian permeability transition pore? J Bioenerg Biomembr 30:419–429 Prieto S, Bouillaud F, Rial E (1995) The mechanism for the ATP-induced uncoupling of respiration in mitochondria of the yeast Saccharomyces cerevisiae. Biochem J 307(Pt 3):657–661 Quinlan CL, Peresvoshchikova IV, Hey-Mogensen M, Orr AL, Brand MD (2013) Sites of reactive oxygen species generation by mito- chondria oxidizing different substrates. Redox Biol 1:304–312 Uribe S, Rangel P, Pardo JP (1992) Interactions of calcium with yeast mitochondria. Cell Calcium 13:211–217 Uribe-Carvajal S, Luévano-Martínez LA, Guerrero-Castillo S et al (2011) Mitochondrial unselective channels throughout the eukaryotic do- main. Mitochondrion 11:382–390 Varela C, Cárdenas J, Melo F, Agosin E (2005) Quantitative analysis of wine yeast gene expression profiles under winemaking conditions. Yeast 22:369–383 Walter L, Miyoshi H, Leverve X et al (2002) Regulation of the mito- chondrial permeability transition pore by ubiquinone analogs. a progress report. Free Radic Res 36:405–412 Walter L, Nogueira V, Leverve X et al (2000) Three classes of ubiquinone analogs regulate the mitochondrial permeability transition pore through a common site. J Biol Chem 275:29521–29527 Yamada A, Yamamoto T, Yoshimura Yet al (2009) Ca2+-induced perme- ability transition can be observed even in yeast mitochondria under optimized experimental conditions. Biochim Biophys Acta 1787: 1486–1491 J Bioenerg Biomembr (2014) 46:519–527 527  1            2      3   4     5 ! "# $   %6 & '7 (&)& (  '&8 *&  +9 && ,   & ,-10 12          !   13 " # $%& "#  ' " !  #14 "(# ##  "# )   #(#  !15      #  # ##"*(  #   (#16 +   + # #("    "",-.  17 -    #   +  #  " 18   &/($%!" /( ##(#  ( 19    + ##,     (  #" !20 (&       # #        +     !#(    #   21 # (    !  (#"  ! "  22   " " "  " ("#  0  " 23  #   +   " (#      24 #  $%  ('  # )"(#   "  " 25 # ("  (   ""   .!,-.1 ,-.  26 #. #( #("   !!#  (   2 #27 " # ( "# ! #" ( #(" " 34.( #(" .28    !  # ) #     0(#(" 29  ( # , # "! !    30 (#  !+     # !)31 ./012 3 4$  52$2 - & &&  ,      3-677   $ )7  7879$04:-  & &   &- & 8&- && ): ; - -8&$  )     # ! (  " 1   2       3 - "#   $5%$657% $458%+ $%+  9 4 " " #  .,:$%,  !!+  #$78% #  5   #  (#545$ ;%+  # ##"+( !( 6 67$<%(&+"  !$=>% #    # #   7 &  $%8 9        !!    "# #    10       -!         +  /(      !! # 11 "#  #  "# -4#   #   ( "# ! ##  ?3412 ( #(" " 34.,    (  " # ( # (# " 13  "     "  (      " "      14 15 " & /      !"      # 1 ,""         +"# "  2   #  "# $%    "  # #   ! #  #  $78%3 - "! # ##"( !#(   #   4  (  -   #(#  !"   !5  " !(  # (  '      !#   /( 6 ! (#    (    #  ##(  ( # 0 #   @7  #   (    "     !#  8 "#  ) $ %, +# #   )(!(     #( + 9  # #   ) & # 4  (# $% + !( 10 " (" )"(#      &" +  $;%11 4  "+#  + (" (A    "  12 (#  @(# (  !(   ( " (#  13         # ! "     14 ( !!    !##   # #  #15 $   !   %&'( )      *  ,: ;   = $==%    87 $=>%    7   $=>% $>% +*  7 $=>% ,   $=>%    7 $=>% -  > $=>% '   ?  !#("  ?  " $>% .    7 $>% /    (!#>= 7><   ?BC $>7% $78% $>8% $  (!#7<  2; $> % $>;%  # #   "+ ! !"  "( # # #   D?( 5 E34 +7 F,:   35   # #     !!     36 <#8)6" 2 #=  <-32 #4" , , 9 "# #"+     ? (  !! 1    "    " "  (+  2  "   "#  0#   ($% # ! 3 (  "  !!     "(# #  4 ' # ! # "      $% "  5  ""   # (   "  (     6 "     + #  - # (# ! # 7 " #  #    ," (   +    (8 " (     # ! $<%G  #"  ( "  4 # " 9 ? "#    "5"' # 4(# !"#10    &   6 /( # # "   +"! #( #     #11  ( ( ! "#  0" (#(+&+ #  12 $%,/( #  # ( !#(#"    $%13 + #   ;   +     " $=>% '  + $%   + 14 "( " # #              !+  15 .    6 ? (& ,     "( #(     ( 16 (   #  + ! (#( $%$%)& 17 !+(  4(#  18 ' #   !)# !(# ##  ( " H19    ##   #(#  "  !!  "  " H  - 20 "   #+#(#   + "  #   21    # (+# ( !   (0 ?B22   $%#" +    # $7% ""# (#23 (+    + ##   24  " #   #   ! # (# "  ((25 (+ (  ("    !    !    > !   $8%26  + & + !    #  G ! "# ( 27 + (!(#" "  !   #$ ;%? 28  #"      #+ # +  #   #  29  !( #   ! "( I(     # ("   #  ##   $<%30 5+    # + #   !# ! "  "  +31 " #  "(#  # +# (    # 32   # "$=>%33 " & > 1  ?   ! "(   !##  "" !  ! " +2     + # #   (   !!     6(" ( .0 ?   #   "  3  ( +(# I(   (    !4  "  #(  #  ##  ( " -    " 5 & "++ +   !! # #   6 , ( # (   "# # (   $% !"7 #$#   +$%(!    ( "8 !#(   #  -  #  ! $% ! 9 "#    !!    (! +  #@" 10 ( + !    $"(# ( !  + % !11 "(#  "(## ! ##  #!+ $7%,  $12 " # " # !   +% !"#  !  (13 !(  (  " $77%J   " 14  ! ("   # ( #("   #( 15 ?  # !#(  , &!!  ( "  16     # #    (#    (   17        +  !$%2# "      $%   18 #    (# ! 6$7778%  #"   ! 19  #" #  0+ ##   "!" 20   " # $7 7;% +   # + + 21 +    #    $%22 <#8)6" 2 #=  <-32 #4" , , ? 1 2  0*  ! #  " #  !! $%-" # !&!!( 3    #       ? ! !$7 7;%3 /(   " $% 6,*54 *5"'' "#"6,*5*5"'+ # (  " +$%-I5 !    ##*(    " #  &!!(##   6 "+ !( (#  (#   !   # ##"15" # 7 "  # !'! # (# !2:,-  /( # "  $<;<<%, 8 $%## #  !! ## "3  # ##    ##9 "- (     (# "10      (#( )*+'!     #"  #11 #( !(  # (  -#"   #" #    /( " 12 " & 1 "+  # (    )  !  0)&   1   #  " #   #!'! 2  #  "  # (  013 ? "     ( ! ##  + #   !!         )4    (#&!#",! (     " 5 !## + +A!   "    (! ! 6 #  # (  +  "   # ! 7 #"$7<%. #  " #" '''''' 'K+    8 #  +   "      ""    . # 9  &        (##  "   ( #("         10 "    * !! #                +    $11 "   5  $7=%12 '    -# * "  #     #"  ''   '''13 #   '   ## 4L#  ##  M # 14   #&N!  #  #  &("(# )-  15 "#    "   # # !"#   " 16    )     (   - #   #   17 #  ( - * !## "  &  #"  !(   18  !! $7>%19 ?   " (    (   # !20 -#   #  #  " #  #"  ' '' '''  'K" (    21  #  ""+?    #  #    !22 "       # 0 O $8% .  "   ! +23  !!  ("   ( *  # # @P "   *  "24 (( # # !!" -# *   #    25 " # " #"   /( #- ( "   26  "#  "(#  !  #  ) ("#  ( 27 " ! $8%28 )     (  #"  # $% #  +    #   29 +    (# "   !   "",-.30 "(#   "#& + "   # ( #(" )    031 # 1   ! #  "   # ( #("   + 32 )     0 (#  ("   (   #   !(   +33 $887%34 02    *!3 *  *  35 )!/*  36 2 # !  (  # #   (#37  1 ,-.  " # "  # 0 (#  1 38 <#8)6" 2 #=  <-32 #4" , , @   (" (# ("   ( #(" !,-.  +  1 !"  )"(#  $88%, + "   # ( #(" # 2    #  ! !! "# !  "( #  3 $8 % J  #    ( #("  #     "   & (#  4  #   ( "# ! ##  $8;Q8=% ( #(" " 34.$8> % 5  "("     0!(    #" # $ Q %6 %(2  4-" ! #   "     "?.-. 7  #   ( #("  #   !      "" $ ;%8 + # + !  #      #     "     ("   !9 # ( # # ( ' #(# ( I#"  #   !( # 10   + ( $ < =%        # (  # 11 # # ( ""+ ,-."(#     "  ( !12 "  !  ?.-. '   $;%       " ,!!13 $ >%"  !?.-." 5++14 #(# "?.-.   ! 2 #(#  #    15 & + "      (  #     16  !"( ?.-.    /(  17 %(1  *  A2#   "     - 18     #      '  #       #      #19 " # '  !! "# ! #   !  20     0' #  # #  (#+  #  "21    -( "&  #" #   22 # !# #   !# ("  + I( ,-." 23 (#   /(  !# '     #!! #  #!24 # "  !  # !5P"(""  (25 " # $;%'       &    # 26      #" " "   "(" !! #  #$7;%27 ,    (#     #"  !" # 28  !! (( #" '('K?    (# #&" 29 "("  #     # +   (  ( !  " " "(" 30 #" ,    0# 0" ( #(" ! +! # +31 ,   6,*5   (  ( !   $ # + 32  # "    !(  #" '$;;%33 ,    ,L# 0   !( /(  /(   (#  34 !5   #!"   #  $ 7%, (  "  35 "  !(   " "#   ,L  " #   ? (&36 6 4$;7%)#   ( !" "  ",L37 # # ( . #0. !4  ,  # 5 #38  4'   (# "( #(    39 /    /,L  #$;8Q;;%5+40  # ! "!,L  #  !#(# $ %'  !! 41 "     "# #  #& ,L+  #(#" (42 ,O7 " & A 5 "   "  $;<%-(  #(" !  #  ! +##(+ 1 6,*5 # # #+     -0)#2  # # !+ #  #   # "" #     3 "(# #!       !# (  0$;=%"(#  4 !  # #  $;>%   #    ! ! #     &  $<% ' 0  #5    ##(   #"  +& +  #"  (#  " 6  "  # #( ( "     #  $;>%? #  "   " 7   ,-."(#  +     #!6,*5H6,*P $<%8 -" #  #"!#  ##" A'''''' 'K    9 6,*5    6,*5 $<%  + !!,L $<7%*(  10   # + " 6,*5 # +  ("#"  '''Q'K #   11  #  + "(" "  #" ''' 'K$<8%' # ( 12   +" #  #  !!   6*5,L13 (( #("   ""    # "(#  !)$ 8 %- 14    (  "  + # (  "   #  ( #("   15 "      @( 0 # "  &   #16 #  $  8%17 2#   ## #        -  0   !!     18 "  "   !!  # #     +    19   #!#(  "# '     # "   20 "# (  (   "  !!      #  $< % ' &    !! 21  ""   $%,  7 "+  + 22 ## @(&  #" !+(    ( 23 "  #   #  !      ( ( /(    /(   24   /(    #  0(  ##" !! 25  0$7 7;%2 #" # " " !# ( 26 + ("(# ,-.' 0 #  # (&  "   27 ) #&  '!  !" #  (#+ 28 $%  ,-.   " "(" !! #  #  ' # !#29 (#    " #" ##    "    30 "   !      6,*5    H  ,L     !( 31 (#   !  $;% , "     !  "  #  !'! " 32 ( 01+  ( !"  #    0(#33  /(  ( /(     (  (# !    # ##"   0  34 "## " #! #" !$<;<<%35 563#  *  36 6  !   #    !#(    1    #  # 37 *$2*!,#  !     38  !    0    "#  #  " 39     ! $% -(  6 !   #   6 (#    !! 40 <#8)6" 2 #=  <-32 #4" , , B  "A $#    # " #    1 I("  !  +  !$%, ##2  !! FR D?  ## ( 6!   $ <=Q=%' 3 ( 6!   5PH   +$=%' 2 *! !! " "  #4     0 (#   (#  #        (# 5 /(  + # (    # + !!  + # #(" 6 ,-.   3+ #  #("  (     "    # !7  (#$=%8 78)!/  # 9 '  "  !  "(#  "    #  (    )  #  10 # #   !" (  #  "!(  -  !!   ! 11 #   0(#("  (* # # )*12   ("   ! #!#+ ##  @? 6 4(HB $=7%13 -@ * !(   #"    ? #   #14     "!? *$=8%4  ( " +" (15 $= %  #" !5 (   ! #  -16  (  + #   0"  # ,# (&$=;%17 ' # #  #(    + "18 # !( $=<% !( #   !( ! *19 9+  20 *(  " "0 #"   ( !   21 " #' (    #"+  # + 22 "!   !       #("    (#        23     ,      + !   /(24 # #    # ( +  "  "   #    #  25 #      '#   #    /( # " 26  "   (#  +  "# ! #   '        #     !27 (#   &""  "# "   !,-."(#   ( 28 # !"   # ( #(" !  ""    .   # 29 ( #(" +#   " "  & (  "   !30 "   -# "  # .  & # (31 ( "# ! ##   ( #(" " + "    "  # (" 32   !       (#!(    #" # !33 !(  "   "' " !!( #  !    # 34 #  #( "# ! # !)+ ## ("#(#35  ""  #  #!)      0(#36 ,O8 " & 0 * # + # + +$87% (#! !# 1 (   #   + (# +   2 (  3 4    4 ,( &)S ?T 0 @ #!# #   #.  !(  .,.''-5 "   *,.,H36,?   '6; ?): 6:?   43,  46,4J-6 ! +   2 # (.36,?7 .   ,  -(    # 8   9 ?S #) :(4  3  , 0?4  B  10 :( , :(T  ?U 076 4 /( @T 6: ?  #U11 ,  ?(  , 0V 8#  ?V   3  4I W12 W, #"  #A( X !#( 13 *" !? #(   #'  (!4 ( .  36,?4*?L?T #14 *" !2 #  (#( 2  '  (!4 ( .  36 15 ,?4*?L?T #16 7*" !2 # '  (!4 3.( .( .20 17 8: !2   # ? #(   #4',*5  ?T #18 )    19 $% : 6  #( + !A!3  .G20 "7=821 $%   ,:*(*?1  .K( )6+ *F-#  ( 22 "(00 !    4( 2  >G>8A) ;7Q83 $ % 6   "65-   (!  !6(G8>;=7A=7Q4 >5 $;% ?  1 ?(  ? -   "  !  !  (& 6(6 >>=G7>;;<A7> GA887Q=9 $=% ?1 (  !   4( "     #[* " 10  >>>G>;A;<=Q=<11 $>% F(  4,         (   !  #    "12 ? #   ? #( 2  ) +G;88A<=;Q=13 $% 5  YYF  ,1  5-   ,?2 # #   (  14 "#!  # !( #   #  . " # - #  !15 ) # !:   2A2   # #  #7G7 =8>A Q 16 $% ?   ? ?  1        (& #      !17 .0 ## # . " # - #  !) # !:  18  22   # #  #=G7;7 8A<19 $% 5Y?1  (Y)-#  ##  # "#(20   . " #  - #   !  )  #  2A 2   #  #  #21 ;G7;8<A>7Q 22 $7% 5  5*-   !" # . " # - # 23   !) # !:   22   # #  #;G7;8<A>7Q24  25 $8%  4:  -?1 ,Y2  !" #  26    6(;G887<A;=7Q;27 $ % . )F*E? )5 '  6:( *1(- #  !28 #  " " A    2 #  #2 " #29 ,#>>8G=<A;Q730 $;% 5  5)" ! # , (  +!  31 >;>G8A787Q;=32 $<% 5##& .1  6 2 # #  "  A #    "# 33 "   #  (  3 !, #A!3  .G8;<34 "35 " & / $=% 5 )11,,  ?,  "  ?,3,A (,# 1 ' #.( G8"<<2 $>% ,  *- # A #  !  6(G8;>A<3 $% ? 0 4(04   2#,?3  4I ?(  , 0 ,-4 !( #  ! #   @@,-.  !+   ",5 $(# ( " 4" 2 #  .  .26 2 # [? #( 2  ;8A 10 $% * 15 2Y)  .4" *Y-  !.  , #11 ? 2  G>>""8=><4')? :  .24  12  O 8;7,( >>13 $7% &(1,( 5 .] 5 * '"# ! "     (#(  14 "#  "  # #(   0"  &  #     ! 15 2 #  #G< A;;>Q>>16 $8% ?(& 5F &'2  "   !2(+  "3" I17 5  4  I" #5 Y(  !4(# 2  >=8G8A18 >Q19 $ % 4 Y !, ! # # ( !(!#  ((  A20 # ! #"    #  "   Y(   ! "    2  21 >>A);=Q<;26 $<%   Y ) # Y ? #   !            # 27    (  + (   Y(   ! 4"  .   228 8G=87A= Q729 $=%  Y*  )# ??5 ,  *?  # "   # 30 "   (!     ,# #    # ! #  #31 4" 2 #  .  .,? #( ['  .   32 G =8A 7Q>33 $>% 2(1,,  *4  * @    A      34   @( #   # G8 A><Q=735 $7% ) 'K  ?* 0 .4# 0  !   (# #   !36    #   -Y(  !,"" 2#  >>8G<< A >Q<37 ,O ,O; <#8)6" 2 #=  <-32 #4" , , 9 $7% ) )@ 5+!  & # #  &#" 1    '     Y(  !@? #  >>;G7Q7A Q>2 $7%  & :#  @  0  1 ) 5 -#  )+  & !  !!#3 #"    /( !2&^? #   !   #"( 4 : >>>G<>8A7= Q>;5 $77% 2##  Y4-## #!!#!   # -Y(  !6 .  2#  > >G<<A ; Q<87 $78% 3 4 !  **: @: )?+@Y? #  # "!8   #  (0 .# !6   ,#!#  #!9 3 !, #G>8A >>;Q;710 $7 % '  + 1Y .  )F - "  #  ! &!!  ? #   # 11 ) +>=8G8=7AQ<12 $7;% 3  2 Y,   " "+!&!!A  #13   # "   (    "  # ##"2 #  #2 " 14  #,#>>8Q =18 $7=% K  ,# - *## ?  :(0 ), ? : 4 . :   #"19 #  A        @ ) #  2   [ ? # 20 G A77%  _  ): 2 )@ . #" 4)   @) 4 :    ?@ ,22 #"  ! #   !( #   "    23 "  !-# * Y(   ! 2   #   2   24 G87;A; Q;25 $8% F( & Y-(  "  ! #   !   " . 26  8G>. A Q827 $8% ?( )     !  " ."28 ? #( ? #  8G 7 A>Q7 29 $8% ?#4Y?F 22Y@  #',  0 !    30  A"   # !( #  !("  (.# !6   31 ,#!#  #!3 !, #><G;= A8Q<32 $87% *E,((2-  ?2)    #( A#  33 "# ! #  ) 6() +? #( 4 2  837 " & > $8 % ( 4   , 0   * 4  ! # , "  Y  Y1 ( 0 ,(  ? :(  ? 0 :,    .   #  ( #("  !2  #     ""   (   !! "# Y(  !3 2   # 2   G877A77Q74 $8;% ?  )(#(L( ?) ( ?( 24# 0  !5  #   (  #  #  A  #( "      " 6     "ZY(  !2   #2   >>=G7 A8>Q>7 $8<% 2  .- #   "     "A Z@ 8   .  7G8A> 9 $8=% 3  4I   :(  ? 0 :, ( 4   4  ! # ,10 4    .  6, ( 0 ,(  ? ? #    (  #  #  11 (((& # ? #   G7A7=Q>12 $8>% 6 #  * )    ,   !  !  ( #("  "  34. Y(   !13 2   # 2   >>>G7 A7>>Q8;14 $ % :(  ? 0:,? :# ?)  3  4I '  ! # 15   ! #   # " J+  "  #+ !#  16 (#   (#       ( #("  " & #   2 #  # 17 2 " #,#G<><A=Q=18 $ % ?#*  ,K  4" Y@,       A( /(19 ##  #     #   (   Y(   ! "    2  20 >G.;A;A Q823 $ 7% K  4?#' :,   A !   !( #  , ( 24 ) +!.  .   .  ? #( 2  >>>>G<>8A>;G<7A<77Q>3 $ =% 2*5 4? #   )6,  "     (    4 (#/( # #    ", ! # # -Y(  !" 5   2  7G;.A7;=Q>6 $ >% 5  Y*5 4?  #"      #    "  7 ( "          ",!! 8 # >7 Y(  !"   ? 2   # >G7<;A= Q9 >710 $;% 2 K2?( )K&&?:2 #*,5 5 )2 , #11 " # !&!!   ++& !( ( #(" 12 .# !6   ,#!#  #G=8A<7Q813 $;% F#Y*     !   6,*5A( /(   (#14 2 #  #2 " #,#22, 2   #G8 >`aM7A<8Q=715 $;% 2\#)2 B  ?1 !F6A3 /(   (# 16    #J>>8G8A8< Q>17 $;7% ?#*   , K    2 #  #     #   "  18 ,  A " # !             "  '32?2 : !19 8G ;;A777Q820 $;8% -# #&F,  *. 5? #   # !  # "  21 " #   !2  # 22 1 -Y(  !"   2  G7.A77 Q;=23 $; % 2(# -,  *. 5# !      + 24 A   #    #&(      # # /( # 4" 25 2 #  .  .22 # [? #( 2  G>A26 >Q27 $;;% 5   -?  ?F- 0 ##   # 0   !28 ( !    ( !          #   @2 Y(  29 =G< 7A77 Q;30 $;<% K  4)  4,J "YJ' (#  ! #       31 " #    "++ (  ##"+" 32 "# .  .  G>8A=>Q833 $;=% 2#& # Y? 2  2(  ,    4 J+  "  #A   34  !" #  ( '     ? #  A-!! #  Y(  35 !" # !? #  >>=GA7Q736 " & 1 $;>% 45 0?2.(#  ! #,#  0)#' A21    0) #A 2 #   #  ,"" #   2  5  A2 " 2 5  G7"73 $<% *  50 @0)#A,  +' A2 #   # ,"" # 4   !J0)#4A" '     .(  G8"5 Q;6 $<% F#*]B+ #&FB #& K2 30)#7   #( #   #" '2 #  #2 " #,#22,8 Q2   #G Q7A=7Q>9 $<% F# Y &(  Y 2  3 ,        0 # !    10 6,*5A( /(    (# #    0) # Y(   ! 4 11 #  #>>>G.8A78Q815 $<8% ( 4 K0/(0 ,#? 0 0 5 " *3  4I ' 16 0) #  #        6,*5   #17 "# ! #  +   ## #"  !  #  # "  "+18 2 #  #2 " #,#>G<=<A< Q= 19 $< % 4&? .  )F    " "  # ##   &!!20  F A 4*4   4#,2   /(  !     #   21 ? #  G8;.A 25 $<<% F   : 1 & -     ?   ?Y O(  ?, : ,     26  (  !1 #  +. "!4("? #( 2  27   (  =G >A=<<>30 $<>% Y F,#   (#   ! (     ( " #   A31 " #  (    #  6+.  ><> G77A>Q>36 ,O< <#8)6" 2 #=  <-32 #4" , , @ $=% 2JK2#,K&( #K.-+6,*5A( /(   (#1 !* $         "  "#   2 #  # 2 2 " #,#>>=G7;7A Q773 $=%  0V 0.Y4 4?('2  4*?(YY2#   (#A4  #(     # "#! (#  Y(  !'  #2 #  5 ;G `aM;A Q76 $=7% 1 &??1 &Y1, (      !   7    #       ("   ( - Y(   ! 2   # 8 4 >>=G<77 A==Q>79 $=8% 4  ) @     ?  , )  ? 2 (##    A !    !Z10 ,# ("  ( "#  !   # (   11 @   2 #  #A,Y(   K ( : G A*<;=Q<>12 $= % F 0 ? :+  .4 -  #(   (   ! #  # " A13   #!(  "    !!  + "& ! # 14 (&? #( 2    (  7G<A>=Q15 $=;% B#&?@(( . 4 (  !# ! # ( 16 ,    [)   =G>A >=G7<<; A;7Q;22 $=>% 5  Y (  ,4 3  K'' )"    ' A 5  Y   - & ! ? # 23 .  .  " .,3,A  G24 $>% ."  , - !    "   ( 4  #  ) +  2  # 25    >=>G<7A % 1   *@ )( 1:   -Y K &  Y? -   "  # !27  #       ""    (   + " #   !28 (    # #    - Y(   ! 2   #  4  >==G;7;A29 <Q=30 $>%  ?*( B. #  !  (  "(+   (" 31 "( "(#  #4#  #,#G<8>A ;7Q832 $>7% 4" .#&:," "#(#  0"#A +      33  " +  0   &8G;A;8% 2  Y? 4   ?- *      #        #( 35 #"    # E   (0 6(4( #  36 7G8A< 37 " & A $> % 2(& ? + 4, :( # Y ), .  51 . #&  Y: ?   1   #       ! (A   !"#( !  2 ( 4   !#  #G A77Q8>3 $>;%   K(YF)!      "" #  !   ##    4 !6 ( !!? #( ( >>>G7A;8Q7 5 :;!)<:$),$/ b,Ob-!!   #     " F  ##&+    """   b,Ob. " !( !  !(A6: ? 9#U b,O7b-  #c@ #    #  "   ("  ! # ( # # ( c   ! #   F  ##& b,O8b)"c4  ( " c    F  ##& b,O b. ##&"(  !##  )!$=% b,O;b*(" # !)!$%    #   # ##   . ##& b,O